Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2022 Apr 8;17(4):e0266609. doi: 10.1371/journal.pone.0266609

Differentially expressed microRNAs during the differentiation of muscle-derived stem cells into insulin-producing cells, a promoting role of microRNA-708-5p/STK4 axis

Yu Ren 1,#, Xiao Wang 2,#, Hongyu Liang 1, Yuzhen Ma 3,*
Editor: Abdul Qadir Syed4
PMCID: PMC8992996  PMID: 35395037

Abstract

Objective

Stem cell therapy is a promising approach for diabetes via promoting the differentiation of insulin-producing cells (IPCs). This study aimed to screen the differentially expressed miRNAs (DEmiRNAs) during the differentiation of muscle-derived stem cells (MDSCs) into IPCs, and uncover the underlying function and mechanism of a specific DEmiRNA, miR-708-5p.

Methods

MDSCs were successfully isolated from the leg muscle of rats, and were induced for IPCs differentiation through a five-stage protocol. miRNA microarray assay was performed for screening DEmiRNAs during differentiation. The features of MDSCs-derived IPCs were identified by qRT-PCR, flow cytometry, and immunofluorescence staining. The targeting of STK4 by miR-708-5p was examined by luciferase assay. The protein expression of STK4, YAP1, and p-YAP1 was determined by Western blot and immunofluorescence staining.

Results

MDSCs were successfully isolated and differentiated into IPCs. A total of 12 common DEmiRNAs were obtained during five-stage differentiation. Among them, miR-708-5p that highly expressed in MDSCs-derived IPCs was selected. Overexpression of miR-708-5p upregulated some key transcription factors (Pdx1, Ngn3, Nkx2.2, Nkx6.1, Gata4, Gata6, Pax4, and Pax6) involving in IPCs differentiation, and increased insulin positive cells. In addition, STK4 was identified as the target gene of miR-708-5p. miR-708-5p overexpression downregulated the expression of STK4 and the downstream phosphorylated YAP1.

Conclusions

There were 12 DEmiRNAs involved in the differentiation of MDSCs into IPCs. miR-708-5p promoted MDSCs differentiation into IPCs probably by targeting STK4-mediated Hippo-YAP1 signaling pathway.

Introduction

Diabetes is a common metabolic disease defined as the disorder of homeostatic control of blood sugar levels, which mainly caused by the insulin secretion deficiency resulting from the destruction of pancreatic β-cells [1]. The incidence of diabetes is progressively increasing annually worldwide, posing a great threat to people’s health. Recently, the development of insulin-producing pancreatic β-cells from stem cells has become a potential approach to treat diabetes [2]. However, the therapeutic strategy of stem cell-derived insulin-producing cells (IPCs) is technically immature and the underlying mechanisms are still illusive.

Muscle-derived stem cells (MDSCs) are a type of postnatal adult stem cells, which possess a high regeneration and differentiation capacity [3]. Currently, MDSCs are increasingly popular used in stem cell therapy, due to abundant and easily accessible source and strong regenerative capacity [4]. MDSCs are considered to have the capacity of differentiation into muscular, vascular, nerve, bone, and cardiac lineage cells [5]. Mitutsova et al. indicated that MDSCs can differentiate into IPCs in pancreatic islets [6]. Lan et al. [7] also confirmed that muscle-derived stem/progenitor cells are capable of differentiating into insulin-producing clusters. However, the underlying mechanisms of MDSCs differentiation into IPCs have not been fully characterized.

MicroRNAs (miRNAs) are endogenous small-non-coding RNAs, which act as crucial regulatory roles in gene expression by complementary binding to the 3’-untranslated regions (3’-UTR) of target mRNAs [8]. Numerous evidences have supported that miRNAs are involved in the differentiation of various stem cells into IPCs by regulating target genes [9–11]. For instance, miRNA-375 promoted the differentiation of human embryonic stem cells into IPCs by affecting its target genes and pancreatic development-related genes, including PDPK1, INSM1, HNF1B, GATA6, NOTCH2, PAX6, and CADM1 [9]. miRNA-690 facilitated the differentiation of induced pluripotent stem cells into IPCs by targeting Sox9 [11]. In addition, some miRNAs, such as miRNA-375, miRNA-29, and miRNA-7, are capable of regulating the expression of key functional genes in pancreatic β-cells [12, 13]. However, there still some miRNAs involved with MDSCs-derived IPCs differentiation have not been illustrated.

In this study, differentially expressed miRNAs (DEmiRNAs) associated with IPCs differentiation from MDSCs were screened via miRNA microarray analysis, and miRNA-708-5p (miR-708-5p) was selected for further functional analyses. The target genes of miR-708-5p were predicted and the underlying mechanism of miR-708-5p regulating the differentiation of MDSCs into IPCs was uncovered. These findings shed light on the underlying mechanism of MDSCs-derived IPCs differentiation and provide a novel therapeutic strategy for diabetes.

Methods

MDSCs isolation, culture and identification

MDSCs were isolated from the leg muscle of Wistar rats according to the previously described method [14]. Briefly, the muscle tissues were collected from Wistar rats and digested with 0.1% type I collagenase for 1 h at 37°C. After centrifugation for 5 min at 150 ×g, the pellet was resuspended and cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F12 containing 20% fetal bovine serum (FBS, Gibco, MA, USA), 10% horse serum, and 1% penicillin/streptomycin. After cultured for 10 h and 48 h, the morphology of cells was observed under a fluorescence microscope (Olympus, Japan). This study was approved by the Institutional Animal Care and Use Committee of Inner Mongolia People’s Hospital.

In vitro differentiation of MDSCs into IPCs

MDSCs were induced to differentiate into IPCs via a five-stage differentiation method according previous description with slight modification [15]. At stage 1, MDSCs were cultured in the Roswell Park Memorial Institute (RPMI) medium containing 0.2% FBS (Gibco, MA, USA) and 100 ng/mL Activin A for two days. At stage 2, cells were cultured in RPMI medium containing 2% FBS and 25 ng/mL keratinocyte growth factor (KGF) for three days. At stage 3, cells were cultured in DMEM (Gibco, MA, USA) containing 1% B-27, 2 μM retinoic acid, 0.25 μM cyclopamine, and 50 ng/mL Noggin for three days. At stage 4, cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM) containing 1% B-27, 10 mM nicotinamide, and 100 nM GLP-1 (Preproglucagon 72–107 amide) for three days. At stage 5, cells were cultured in IMDM containing 1% B-27, 10 mM nicotinamide, 100 nM GLP-1, 50 ng/mL insulin-like growth factor 1 (IGF-I), and 50 ng/mL human hepatocyte growth factor (HGF) for three days. At each stage, cells were visualized using a fluorescence microscope (Olympus, Japan). After 15 days of induction, the MDSCs-derived IPCs were obtained for further experiments. MDSCs at fifth-generation that cultured in RPMI media containing 25 ng/mL Wnt-3a and 100 ng/mL Activin A were used as the control.

miRNA microarray assay and bioinformatics analysis

Total RNA was extracted from MDSCs-derived IPCs at five stages using TRIZOL reagent (AidLab, China). A miRNA library was constructed using the Illumina TruSeq Small RNA kit (Illumina, CA, USA), and miRNA-seq was performed on the Illumina Hiseq 2500 platform. The read quality was evaluated using the online tool FastQC v0.11.9 (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). The high-quality sequencing data (clean reads) were screened according to the criteria as follows: 1) Remove the 3’ linker sequence in the reads, and remove the reads without insert fragments due to the self-ligation of the linker; 2) Remove the reads with low sequencing quality in 3’-base (the quality value is less than 20); 3) Remove reads containing unknown base N; 4) Choose reads with length between 18nt and 32nt. These analysis parameters have been added to the Methods section. The obtained clean reads were applied for DEmiRNAs identification using DESeq2 (v1.34.0) [16], DEGseq (v1.48.0) [17] and edgeR (v3.36.0) [18] in Bioconductor. miRanda (v3.3a), TargetScan (http://www.targetscan.org/vert_72/), and RNAhybrid [19] were employed to determine target genes of DEmiRNAs. For functional enrichment analyses, the target genes of DEmiRNAs were annotated through Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses.

Cell transfection

The miR-708-5p mimics, mimics negative control (NC), STK4 siRNA (siSTK4), and siRNA negative control (siNC) were purchased from Genepharm company (Genepharm, Shanghai, China). These agents were transfected into MDSCs using Lipofectamine 3000 (Invitrogen, CA, USA) for 48 h. The transfected cells were induced for differentiation into IPCs in subsequent experiments.

Quantitative RT-PCR

Total RNA was isolated from MDSCs-derived IPCs using TRIZOL reagent (AidLab, China), and reverse transcription reaction was conducted using a FastKing OneStep Probe RT-qPCR MasterMix (TIANGEN, China). qRT‑PCR was performed in Mx3000P Real-Time PCR System (Stratagene, CA, USA) under the following reaction program: 95°C for 3 min, 40 cycles of 95°C for 12 s and 62°C for 40 s. The relative mRNA expression level of miRNA and IPCs-related genes were calculated using the -2ΔΔCt method. U6 was used as a reference gene for miRNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for IPCs-related genes. The primers used in this study are listed in Table 1.

Table 1. The primers for qRT-PCR.

Genes Primer sequences (5’ to 3’)
Pdx1 Forward: CCTTTCCCGAATGGAACCGA
Reverse: TTTTCCACGCGTGAGCTTTG
NGN3 Forward: CATAGCGGACCACAGCTTCT
Reverse: GGCTACCAGCTTGGGAAACT
Nkx2.2 Forward: ACCAACACAAAGACGGGGTT
Reverse: ACCAGATCTTGACCTGCGTG
Nkx6.1 Forward: GCGGACCAAGTGGAGAAAGA
Reverse: AGTCTCCGAGTCCTGCTTCT
Gata4 Forward: ATGGGTCCTCCATCCATCCA
Reverse: GCTGTTCCAAGAGTCCTGCT
Gata6 Forward: TCCTCTTCCTCCTCCTGCTC
Reverse: GAAGAGCAACAGGTCCTCCC
Pax4 Forward: GACGGTCTCAGCAGTGTGAA
Reverse: GGGGACTAGGAAGAGCTGGA
Pax6 Forward: CAGAACAGTCACAGCGGAGT
Reverse: CAGACCCCCTCGGAGAGTAA
GAPDH Forward: GCAAGGATACTGAGAGCAAGAG
Reverse: GGATGGAATTGTGAGGGAGATG
U6 Forward: AACTCTGGCGTGGATTACCG
Reverse: CACATCCGCCTCTTCTGTGT
Open in a new tab

Flow cytometry

For identification of the insulin positive cells, resuspended MDSCs-derived IPCs (1×106 cells/mL) were incubated with the anti-h/b/m insulin APC-conjugated rat IgG2A (R&D Systems, MN, USA) for 30 min at room temperature in the dark. The insulin positive cells were detected using a flow cytometry (Beckman Coulter, Germany) and analyzed using CellQuest software (BD Biosciences, NJ, USA).

Dual-luciferase reporter assay

The binding site of miR-708-5p on STK4 was predicted using Starbase (v3.0; http://starbase.sysu.edu.cn/index.php). The luciferase reporter assay was performed to observe the interaction between miR-708-5p and STK4. The mutant STK4 (STK4-MT) was established via mutating the putative binding site of miR-708-5p in STK4 3’-UTR. Wild-type STK4 (STK4-WT) and STK4-MT were cloned into pGL3 alkaline luciferase vector. pGL3-STK4-WT and pGL3-STK4-MT were respectively co-transfected with miR-708-5p mimics into HEK293T cells. At 48 h post-transfection, Firefly and Renilla (Firefly: Renilla = 1: 0.1) luciferase activities were measured using a Dual-Luciferase Reporter Assay System (Promega, Madison, USA) according to the manufacturer’s instruction.

Immunofluorescence staining

MDSCs-derived IPCs were washed with phosphate buffered saline (PBS) and then fixed with 3% paraformaldehyde for 15 min at room temperature. After washed with PBS three times, cells were permeabilized with 1% Triton X-100 for 10 min at room temperature, followed by blocking with 3% bovine serum albumin (BSA) for 30 min. Then, cells were incubated with primary antibodies (1:1,000) at 4°C overnight, followed by incubating with fluorescence secondary antibody (1:500, Abcam, UK) and DAPI (Solarbio, China) for 1 h at room temperature in the dark. Subsequently, cells were observed using a confocal laser scanning microscope (Olympus, Japan). Primary antibodies are listed as follows: anti-insulin antibody, anti-C-peptide antibody, anti-Pdx1 antibody, anti-Nkx6.1 antibody, anti-STK4 antibody, and anti-p-YAP1 antibody (Abcam, UK).

Western blotting

MDSCs-derived IPCs were lysed with a RIPA lysis buffer (Takara Bio, Japan) for 15 min at 4°C to extract total protein. Protein concentrations were measured using a BCA Protein Assay Kit (Thermo Fisher Scientific, CA, USA). Total proteins were separated by SDS-PAGE and then transferred onto polyvinylidene difluoride (PVDF) membranes. Membranes were incubated with blocking buffer (5% nonfat dry milk dissolved in 1× Tris buffered saline with 0.1% tween-20 (1× TBST)) at room temperature for 1 h, followed by the primary antibodies (STK4, YAP1, p-YAP1, and GAPDH (1:1,000, Abcam, UK) at 4°C overnight. Then, membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG secondary antibody (1:500, MultiSciences, China) for 1 h at room temperature. Protein bands were visualized using ECL reagent kit (Thermo Fisher Scientific, CA, USA). Protein images were captured using a ChemiDoc™ imaging system (Bio-Rad, CA, USA). GAPDH was used as a reference control.

Statistical analysis

All the experiments were performed with three independent repetitions. Data were expressed as the mean ± standard deviation (SD). Significant differences between different groups were determined via one-way of analyses variance (ANOVA), followed by Tukey’s test. Statistical analysis was carried out using SPSS 27.0 software (IBM, IL, USA). P < 0.05 was considered significant differences.

Results

The isolation and identification of MDSCs

MDSCs were isolated from the muscle tissues from the leg of rats, which showed circular morphology (Fig 1A). After induced for 10 h, MDSCs presented as fusiform or polygonal morphology without complete cell adherence (Fig 1B). After 48 h, the fusiform or polygonal MDSCs were expanded and completed adherence (Fig 1C). In addition, the muscle cells-specific proteins, including desmin, sarcomeric α-actinin, MyoD1, Myf5, and Pax7, presented positive expression in MDSCs compared with 0 h MDSCs (Fig 1D–1I).

Fig 1. The isolation and identification of muscle-derived stem cells (MDSCs).

Fig 1

Open in a new tab

(A) MDSCs were isolated from the leg muscle of Wistar rats (0 h). (B) MDSCs were induced for 10 h. (C) MDSCs were induced for 48 h. (D-H) The MDSCs markers, including desmin, sarcomeric α-actinin, MyoD1, Myf5, and Pax7, were detected using immunofluorescence staining, respectively. (I) MDSCs stained with DAPI were considered as the negative control (NC). Scale bar is 100 μm.

In vitro differentiation of MDSCs-derived IPCs

The differentiation process of MDSCs-derived IPCs were divided into five stages. From stage 1 to 5, the cell morphology gradually changed from fusiform or polygonal to spherical (Fig 2A). Insulin is a hormone produced by IPCs and C-peptide is an active form of insulin. These two markers (insulin and C-peptide) of IPCs were detected to evaluate the features of MDSCs-derived IPCs. Immunofluorescence staining showed that most of MDSCs-derived IPCs were positive for insulin and C-peptide compared with MDSCs (Fig 2B). Moreover, the flow cytometry presented that the percentage of insulin in MDSCs-derived IPCs was significantly higher than that in the control cells (P < 0.001) (Fig 2C).

Fig 2. The differentiation of MDSCs into IPCs in vitro.

Fig 2

Open in a new tab

(A) Morphologies of MDSCs-derived IPCs during stage 1–5 of differentiation. Scale bar is 100 μm. (B) MDSCs-derived IPCs at stage 5 were identified via co-immunostaining of insulin (red) and C-peptide (green). Nuclear DAPI staining was presented in blue. Scale bar is 200 μm. (C) The percentage of insulin in MDSCs-derived IPCs was measured using flow cytometry. ***P < 0.001 compared with the Control.

miRNA profiling during MDSCs differentiation into IPCs

miRNA microarray assay was performed to screen the DEmiRNAs associated with the differentiation of MDSCs into IPCs. A Venn diagram showed that there were 49, 77, 119, 159, and 204 DEmiRNAs existing in differentiation stage 1–5, respectively. A total of 12 common DEmiRNAs were obtained in the five stages of differentiation (Fig 3A). The expression of the common DEmiRNAs at five stages of differentiation was clustered by a heatmap (Fig 3B). As shown in Fig 3B, the expression of rno-miR-490-5p, rno-miR-490-3p, rno-miR-7a-5p, and rno-miR-543-3p showed a decreasing trend from stage 1 to stage 5 of differentiation. In contrast, the expression of rno-miR-224-5p, rno-miR-504, rno-miR-335, rno-miR-203a-3p, rno-miR-708-5p, and rno-miR-708-3p presented an increasing trend. These DEmiRNAs were considered as the potential miRNAs related to the regulation of MDSCs-derived IPCs differentiation.

Fig 3. Differentially expressed miRNAs (DEmiRNAs) profiling and bioinformatic analysis.

Fig 3

Open in a new tab

(A) The unique and common DEmiRNAs at stage 1–5 of MDSCs-derived IPCs differentiation were visualized by a Venn diagram. (B) The expression of 12 common DEmiRNAs from stage 1 to 5 was shown by a heatmap. (C) The functions of target genes of DEmiRNAs were enriched by gene ontology (GO) analysis. (D) The functions of target genes were enriched through KEGG pathway analysis.

GO and KEGG enrichment analyses

To further investigate the roles of DEmiRNAs in the differentiation of MDSCs into IPCs, putative target genes were predicted using miRanda, TargetScan, and RNAhybrid databases. A total of 7145 target genes were predicted and then annotated using GO terms and KEGG pathways. GO function analysis showed that these target genes were mainly clustered to 12 terms for biological process, 6 for cellular component, and 2 for molecular function, respectively (Fig 3C). Most of these GO terms were closely related to cellular process and biological regulation that play important roles during IPCs differentiation. In addition, KEGG pathway analysis showed that there were 161, 86, 301, 219, 389, and 499 genes associated with metabolism, genetic information processing, environmental information processing, cellular processes, organismal systems, and human diseases, respectively (Fig 3D).

Overexpression of miR-708-5p promoted the MDSCs-derived IPCs differentiation in vitro

According to the bioinformatics analysis, miR-708-5p draw our attention due to persistently increased expression trend from stage 1–5 of differentiation. To verify the expression of miR-708-5p during MDSCs-derived IPCs differentiation, qRT-PCR was performed and showed that the expression level of miR-708-5p was significantly increased from stage 1 to stage 5 in the progression of MDSCs-derived IPCs differentiation (P < 0.01) (Fig 4A). To further explore the specific function of miR-708-5p during differentiation, miR-708-5p was overexpressed through the transfection of miR-708-5p mimics into MDSCs. The overexpression efficiency of miR-708-5p mimics was confirmed by qRT-PCR, which showed that the expression of miR-708-5p in MDSCs transfected with miR-708-5p mimics was markedly higher than NC (P < 0.05) (Fig 4B). In addition, Pdx1, Ngn3, Nkx2.2, Nkx6.1, Gata4, Gata6, Pax4, and Pax6 are the pivotal transcription factors for early pancreatic development. The overexpression of miR-708-5p in MDSCs dramatically upregulated the expression of these transcription factors compared with NC cells (P < 0.05) (Fig 4C). Moreover, flow cytometry showed that the percentage of insulin significantly increased in MDSCs-derived IPCs of stage 5 in comparison to that in NC cells (P < 0.001). MDSCs overexpressed miR-708-5p presented more insulin positive ratio than MDSCs-derived IPCs (P < 0.001) (Fig 4D). Furthermore, immunofluorescence staining partially verified the above results of qRT-PCR and flow cytometry. The co-expression of insulin/C-peptide, insulin/Pdx1, and insulin/Nkx6.1 presented high expression in MDSCs overexpressed miR-708-5p (Fig 4E–4G).

Fig 4. Overexpression of miR-708-5p promoted the differentiation of MDSCs into IPCs.

Fig 4

Open in a new tab

(A) The expression of miR-708-5p in MDSCs and MDSCs-derived IPCs at stage 1–5 of differentiation was verified by qRT-PCR. **P < 0.01, and ***P < 0.001 compared with MDSCs. (B) The expression of miR-708-5p in MDSCs overexpressed miR-708-5p (miR-708-5p mimics) was measured by qRT-PCR. *P < 0.05 compared with the NC. (C) The expression levels of key transcription factors (Pdx1, NGN3, Nkx2.2, Nkx6.1, Gata4, Gata6, Pax4, and Pax6) in pancreatic β-cells were examined by qRT-PCR. *P < 0.05 and **P < 0.01 compared with the NC. (D) The percentage of insulin in MDSCs-derived IPCs with miR-708-5p overexpression was analyzed by flow cytometry. ***P < 0.001 compared with the NC and ###P < 0.001 compared with the MDSCs-derived IPCs. (E-F) Co-immunostaining of insulin/C-peptide, insulin/Pdx1, and insulin/Nkx6.1 in MDSCs-derived IPCs with miR-708-5p overexpression. The nuclear was stained with DAPI in blue. Scale bar is 200 μm.

miR-708-5p inhibited STK4-mediated Hippo-YAP1 signaling pathway

To further elaborate on the molecular mechanism of miR-708-5p on MDSCs-derived IPCs differentiation, bioinformatics analysis was performed to predict the target genes of miR-708-5p. The results showed that miR-708-5p has 22 potential target genes. Among them, STK4 (a kind of conserved serine/threonine kinase) attracted our attention, due to its regulatory effect on cell proliferation and differentiation [20]. The binding site of miR-708-5p on STK4 was predicted by Starbase (Fig 5A). The interaction between miR-708-5p and STK4 was verified by a dual-luciferase reporter assay. The results showed that the co-transfection of miR-708-5p mimics and STK4-WT led to a significant decrease in luciferase activity compared to transfection with STK4-WT alone (P < 0.01). However, there were no obvious differences in luciferase activity when miR-708-5p mimics co-transfection with STK4-MT in comparison to transfection with STK4-MT alone (Fig 5B). In addition, STK4 is a pivotal kinase regulating the Hippo-YAP1 signaling pathway through the phosphorylation of YAP1. miR-708-5p overexpression dramatically reduced the protein expression of STK4 and phosphorylated YAP1 (p-YAP1) compared with the NC (P < 0.01). siSTK4 showed the same effect with miR-708-5p overexpression, evidenced by the significantly decreased expression of STK4 and p-YAP1 compared to siNC (P < 0.01). However, the protein expression of YAP1 did not show obvious differences among groups (Fig 5C). Furthermore, immunofluorescence staining confirmed the decreased expression of STK4 and p-YAP1 in MDSCs with miR-708-5p overexpression (Fig 5D).

Fig 5. miR-708-5p inhibited STK4-mediated Hippo-YAP1 signaling pathway.

Fig 5

Open in a new tab

(A) The targeting sequence of miR-708-5p in the 3’UTR of STK4 was predicated using Starbase (http://starbase.sysu.edu.cn/index.php). (B) The interaction between miR-708-5p and STK4 was identified using dual-luciferase reporter assay. **P < 0.01 compared with the STK4-WT group. (C) The relative protein expression levels of STK4, YAP1, and p-YAP1 in MDSCs overexpressed miR-708-5p (miR-708-5p mimics) and silenced with STK4 (siSTK4) were examined using Western blot. **P < 0.01 compared with the NC and ##P < 0.01 compared with the siRNA-negative control (siNC). (D) The expression of STK4 and p-YAP1 in MDSCs overexpressed miR-708-5p was verified by immunofluorescence staining. Nuclear DAPI staining was presented in blue. Scale bar is 200 μm.

Discussion

Pancreatic β cell lose is a main characteristic of both type I and type II diabetes [21, 22]. Stem cells are a renewable source of pluripotent cells, which can be utilized to insulin-producing β cells repair and regeneration during diabetes treatment [23, 24]. In this study, we screened 12 DEmiRNAs involved in the differentiation of MDSCs into IPCs. Among them, miR-708-5p was able to promote IPCs differentiation probably by targeting STK4-mediated Hippo-YAP1 signaling pathway.

MDSCs are gradually becoming a favorable candidate for insulin-producing β cells regeneration, thereby treating diabetes. Wang et al. [25] revealed that bovine MDSCs had the potential to develop into insulin-secreting cells. Mitutsova et al. [6] proved that MDSCs had the ability of differentiating into mature insulin-expressing cells in pancreatic islets of diabetic rats. Consistent with previous studies, IPCs were successfully differentiated from MDSCs along with positive expression of insulin and C-peptide (an active form of insulin) in this study. These results suggested that MDSCs have the capacity of differentiating into IPCs, exhibiting a promising strategy for the treatment of diabetes.

Emerging data suggest that miRNAs play a pivotal role in IPCs differentiation from diverse stem cells [10]. Guo et al. indicated that the differentiation of induced pluripotent stem cells into IPCs is dependent on miRNA-related mechanisms [26]. MiRNA-101a and miRNA-107 showed prominent expression during the differentiation of adipose-derived mesenchymal stem cells into IPCs [27]. Williams et al. demonstrated that overexpressing specific miRNAs (such as miR-375 and miR-7) in islets contributes to achieve better differentiation of stem cells into IPCs [28]. These previous studies indicated that miRNAs act as a critical regulatory role in the differentiation of IPCs. In this study, miRNA microarray assay was performed to screen the DEmiRNAs involved in the differentiation of MDSCs into IPCs. There were 12 common DEmiRNAs obtained in the stage 1–5 of differentiation, suggesting that these DEmiRNAs may be involved in the regulation of MDSCs differentiation into IPCs. In order to further investigate the underlying mechanisms, the target genes of DEmiRNAs were predicted and their functions were enriched via GO and KEGG analyses. Enrichment analyses showed that these target genes were mainly related to cellular process and signal transduction, includes cell growth and death, apoptosis signaling pathway, insulin/IGF pathway-MAPK cascade, etc. These results indicate that DEmiRNAs may moderate MDSCs-derived IPCs differentiation through regulating target genes involving these processes.

miR-708-5p is a tumor suppressive miRNA involved in cell proliferation and differentiation [29, 30]. In this study, we found that miR-708-5p presented the increased expression during the differentiation of MDSCs into IPCs. In addition, miR-708-5p overexpression increased the expression of specific β-cell transcription factors and insulin positive ratio in MDSCs-derived IPCs. These results suggested that miR-708-5p has the ability of promoting the differentiation of MDSCs into IPCs. To further explore the downstream mechanism of miR-708-5p regulating MDSCs-derived IPCs differentiation, STK4 was predicted and identified as a target gene of miR-708-5p. STK4 is a conserved serine/threonine kinase regulating cell proliferation and differentiation through the Hippo signaling pathway [31]. Previous studies have demonstrated that STK4 may exert a negative regulatory effect on IPCs differentiation via phosphorylating YAP1 in the Hippo-YAP1 signaling pathway [31, 32]. Our results showed that the expression of STK4 and p-YAP1 was downregulated in MDSCs overexpressed miR-708-5p. Therefore, we speculated that miR-708-5p may promote the differentiation of MDSCs into IPCs by targeting STK4-mediated Hippo-YAP1 signaling pathway.

In conclusion, 12 DEmiRNAs were closely related to the differentiation of MDSCs into IPCs. miR-708-5p played a key role in promoting the differentiation of MDSCs into IPCs probably via targeting STK4-mediated Hippo-YAP1 signaling pathway. This study not only throws light on the potential mechanism of miR-708-5p regulating the differentiation of MDSCs into IPCs, but also provides an important foundation for diabetes therapy. However, more data are needed to illuminate the underlying mechanisms of miR-708-5p/STK4/Hippo-YAP1 axis in MDSCs-derived IPCs differentiation. Besides, the functions of the remaining 11 DEmiRNAs are still need to be studied.

Supporting information

S1 Raw images

(PDF)

Click here for additional data file. (88.4KB, pdf)

Acknowledgments

MiRNA sequencing in this study was supported by Hangzhou Bio-science Co., Ltd, China.

Data Availability

All relevant data are within the paper and its Supporting information files.

Funding Statement

This work was supported by Inner Mongolia Autonomous Region Science and Technology Innovation Guidance Project [No. KCBJ2018042] and Natural Science Foundation of Inner Mongolia Autonomous Region [No. 2016BS0314], funder play the role of Conceptualization, Data curation, Writing – original draft.

References

  • 1.Fan F, Wu Y, Hara M, Rizk A, Ji C, Nerad D, et al. Dynamin deficiency causes insulin secretion failure and hyperglycemia. Proc Natl Acad Sci U S A. 2021;118(32). doi: 10.1073/pnas.2021764118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Trott J, Tan EK, Ong S, Titmarsh DM, Denil S, Giam M, et al. Long-Term Culture of Self-renewing Pancreatic Progenitors Derived from Human Pluripotent Stem Cells. Stem cell reports. 2017;8(6):1675–88. doi: 10.1016/j.stemcr.2017.05.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Usas A, Mačiulaitis J, Mačiulaitis R, Jakubonienė N, Milašius A, Huard J. Skeletal muscle-derived stem cells: implications for cell-mediated therapies. Medicina (Kaunas). 2011;47(9):469–79. [PubMed] [Google Scholar]
  • 4.Musavi L, Brandacher G, Hoke A, Darrach H, Lee WPA, Kumar A, et al. Muscle-derived stem cells: important players in peripheral nerve repair. Expert Opin Ther Targets. 2018;22(12):1009–16. doi: 10.1080/14728222.2018.1539706 [DOI] [PubMed] [Google Scholar]
  • 5.Tamaki T. Biomedical applications of muscle-derived stem cells: from bench to bedside. Expert Opin Biol Ther. 2020;20(11):1361–71. doi: 10.1080/14712598.2020.1793953 [DOI] [PubMed] [Google Scholar]
  • 6.Mitutsova V, Yeo WWY, Davaze R, Franckhauser C, Hani EH, Abdullah S, et al. Adult muscle-derived stem cells engraft and differentiate into insulin-expressing cells in pancreatic islets of diabetic mice. Stem Cell Res Ther. 2017;8(1):86. doi: 10.1186/s13287-017-0539-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lan KC, Wang CC, Yen YP, Yang RS, Liu SH, Chan DC. Islet-like clusters derived from skeletal muscle-derived stem/progenitor cells for autologous transplantation to control type 1 diabetes in mice. Artif Cells Nanomed Biotechnol. 2018;46(sup3):S328–s35. doi: 10.1080/21691401.2018.1492421 [DOI] [PubMed] [Google Scholar]
  • 8.Saliminejad K, Khorram Khorshid HR, Soleymani Fard S, Ghaffari SH. An overview of microRNAs: Biology, functions, therapeutics, and analysis methods. J Cell Physiol. 2019;234(5):5451–65. doi: 10.1002/jcp.27486 [DOI] [PubMed] [Google Scholar]
  • 9.Lu Z, Wang J, Wang X, Li Z, Niu D, Wang M, et al. miR-375 Promotes Pancreatic Differentiation In Vitro by Affecting Different Target Genes at Different Stages. Stem Cells Int. 2021;2021:6642983. doi: 10.1155/2021/6642983 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sabouri E, Rajabzadeh A, Enderami SE, Saburi E, Soleimanifar F, Barati G, et al. The Role of MicroRNAs in the Induction of Pancreatic Differentiation. Curr Stem Cell Res Ther. 2021;16(2):145–54. doi: 10.2174/1574888X15666200621173607 [DOI] [PubMed] [Google Scholar]
  • 11.Xu Y, Huang Y, Guo Y, Xiong Y, Zhu S, Xu L, et al. microRNA-690 regulates induced pluripotent stem cells (iPSCs) differentiation into insulin-producing cells by targeting Sox9. Stem Cell Res Ther. 2019;10(1):59. doi: 10.1186/s13287-019-1154-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wong WKM, Sørensen AE, Joglekar MV, Hardikar AA, Dalgaard LT. Non-Coding RNA in Pancreas and β-Cell Development. Noncoding RNA. 2018;4(4). doi: 10.3390/ncrna4040041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Eliasson L, Regazzi R. Micro(RNA) Management and Mismanagement of the Islet. J Mol Biol. 2020;432(5):1419–28. doi: 10.1016/j.jmb.2019.09.017 [DOI] [PubMed] [Google Scholar]
  • 14.Yu R, Haiqing W, Hefei W, Dong L, Xiao W, Yuzhen M, et al. Biological characteristics of muscle-derived satellite cells isolated from rats at different postnatal days. Cytotechnology. 2015;67(3):397–408. doi: 10.1007/s10616-013-9670-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rajaei B, Massumi M, Wheeler M. Glucose-Responsiveness of Pancreatic β-Like (GRP β-L) Cells Generated from Human Pluripotent Stem Cells. Curr Protoc Hum Genet. 2019;100(1):e71. doi: 10.1002/cphg.71 [DOI] [PubMed] [Google Scholar]
  • 16.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. doi: 10.1186/s13059-014-0550-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wang L, Feng Z, Wang X, Wang X, Zhang X. DEGseq: an R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics. 2010;26(1):136–8. doi: 10.1093/bioinformatics/btp612 [DOI] [PubMed] [Google Scholar]
  • 18.Li X, Brock GN, Rouchka EC, Cooper NGF, Wu D, O’Toole TE, et al. A comparison of per sample global scaling and per gene normalization methods for differential expression analysis of RNA-seq data. PLoS One. 2017;12(5):e0176185. doi: 10.1371/journal.pone.0176185 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Rehmsmeier M, Steffen P, Hochsmann M, Giegerich R. Fast and effective prediction of microRNA/target duplexes. Rna. 2004;10(10):1507–17. doi: 10.1261/rna.5248604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Li W, Deng Y, Feng B, Mak KK. Mst1/2 Kinases Modulate Glucose Uptake for Osteoblast Differentiation and Bone Formation. J Bone Miner Res. 2018;33(6):1183–95. doi: 10.1002/jbmr.3413 [DOI] [PubMed] [Google Scholar]
  • 21.Sathappan SMK, Jeon YS, Dang TK, Lim SC, Shao YM, Tai ES, et al. Transformation of Electronic Health Records and Questionnaire Data to OMOP CDM: A Feasibility Study Using SG_T2DM Dataset. Appl Clin Inform. 2021;12(4):757–67. doi: 10.1055/s-0041-1732301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yang Y, Cai Z, Pan Z, Liu F, Li D, Ji Y, et al. Rheb1 Promotes Glucose-stimulated Insulin Secretion in Human and Mouse β-cells by Upregulating GLUT Expression. Metabolism. 2021:154863. doi: 10.1016/j.metabol.2021.154863 [DOI] [PubMed] [Google Scholar]
  • 23.Siehler J, Blöchinger AK, Meier M, Lickert H. Engineering islets from stem cells for advanced therapies of diabetes. Nat Rev Drug Discov. 2021. doi: 10.1038/s41573-021-00262-w [DOI] [PubMed] [Google Scholar]
  • 24.Kenty JH, Pelayo GC, Leite NC. Retrieval and purification of human β cells from stem cell-derived islet engrafted mice. STAR Protoc. 2021;2(3):100675. doi: 10.1016/j.xpro.2021.100675 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang J, Zhang F, Yang H, Wu H, Cui R, Zhao Y, et al. Effect of TEAD4 on multilineage differentiation of muscle-derived stem cells. Am J Transl Res. 2018;10(3):998–1011. [PMC free article] [PubMed] [Google Scholar]
  • 26.Guo Q, Lu Y, Huang Y, Guo Y, Zhu S, Zhang Q, et al. Exosomes from β-Cells Promote Differentiation of Induced Pluripotent Stem Cells into Insulin-Producing Cells Through microRNA-Dependent Mechanisms. Diabetes Metab Syndr Obes. 2021;14:4767–82. doi: 10.2147/DMSO.S342647 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Rajabi H, Aslani S, Rahbarghazi R. Level of miR-101a and miR-107 in Human Adipose Mesenchymal Stem Cells Committed to Insulin-producing Cells. Int J Mol Cell Med. 2021;10(1):68–74. doi: 10.22088/IJMCM.BUMS.10.1.68 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Williams MD, Joglekar MV, Hardikar AA, Wong WKM. Directed differentiation into insulin-producing cells using microRNA manipulation. Open Med (Wars). 2020;15(1):567–70. doi: 10.1515/med-2020-0170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Monteleone NJ, Lutz CS. miR-708-5p enhances erlotinib/paclitaxel efficacy and overcomes chemoresistance in lung cancer cells. Oncotarget. 2020;11(51):4699–721. doi: 10.18632/oncotarget.27840 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang R, Feng Y, Xu H, Huang H, Zhao S, Wang Y, et al. Synergistic effects of miR-708-5p and miR-708-3p accelerate the progression of osteoporosis. J Int Med Res. 2020;48(12):300060520978015. doi: 10.1177/0300060520978015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Jørgensen SE, Al-Mousawi A, Assing K, Hartling U, Grosen D, Fisker N, et al. STK4 Deficiency Impairs Innate Immunity and Interferon Production Through Negative Regulation of TBK1-IRF3 Signaling. J Clin Immunol. 2021;41(1):109–24. doi: 10.1007/s10875-020-00891-7 [DOI] [PubMed] [Google Scholar]
  • 32.Rosado-Olivieri EA, Anderson K, Kenty JH, Melton DA. YAP inhibition enhances the differentiation of functional stem cell-derived insulin-producing β cells. Nat Commun. 2019;10(1):1464. doi: 10.1038/s41467-019-09404-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Abdul Qadir Syed

12 Jan 2022

PONE-D-21-35752Differentially expressed microRNAs during the differentiation of muscle-derived stem cells into insulin-producing cells, a promoting role of microRNA-708-5p/STK4 axisPLOS ONE

Dear Dr. Ma,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

As you will see, both referees highlight the potential interest of the findings. However, they have raised a number of concerns and suggestions to improve the manuscript, or to strengthen the data and the conclusions drawn. As the reports are below, I will not detail them here, as we think all points need to be addressed. Given the constructive referee comments, we would like to invite you to revise your manuscript with the understanding that both referee concerns must be addressed in the revised manuscript and in a point-by-point response. Acceptance of your manuscript will depend on a positive outcome of a second round of review.

Please submit your revised manuscript by Feb 21 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Abdul Qadir Syed, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. 

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide.

3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. 

  

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

4. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.

5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The objective of the study is well thought and executed.

But there are so many places in the manuscript which need to be improved.

There were no mention of which diabetes was studied here Type I or Type II?

Scientific English need to be used (centrifuging=centrifugation; 150 g=150xg) and reviewed carefully before submission. As line 224 mention: The separate and overlapping DEmiRNAs...... It may be refrain as "Unique and common" DEmiRNAs.... Last line mentioned "Left 11", it can be refrain as "remaining 11".

There are many places where sentences need to be reframed. Few sentences are repeated in Introduction and discussion. Every time Scale bar has been mentioned as separate sentence without making a sentence, which need to be corrected. p-values either be given in sentence or in parentheses.

What is RPMI? Is this a growth medium or Institute?

nictinamide=nicotinamide.

Version and references need to be provided for used Softwares and databases.

Methods: What were the analysis parameters used for processing of Raw sequence data and quality passed data?

Wild-type STK4 (STK4-WT) and the mutant 141 STK4 (STK4-MT) were cloned into pGL3 alkaline luciferase vector. Explain Mutation experiment.

Line 171: performed at least three independent repetitions. Is this assumption or confirmation regarding replicates?

Results:

Sequencing: No result has been mentioned about sequencing (Data obtained, processed in terms of reads and quality). pls provide this detail. What

Line 193: These two markers; Which are these two markers? Explain.

Line 208: Pls provide Figure number for heatmap.

There were 7145 target genes identified but only mention of 1655 for GO term analysis, what about other genes? Pls explain how these GO terms (12 biological process, 6 cellular components and 2 molecular functions) are related to IPCs differentiation.

Venn diagram and heatmap and bar charts are not visible, high quality figures may be submitted.

Line 311: Emerging data suggest that miRNAs act as a pivotal role in IPCs differentiation; "miRNAs play a pivotal role". Refrain the sentence.

Line 315: These researchers; Which researchers referred here?

Line 322: The results showed that these target genes were mainly related to cellular process and signal transduction. "No mention of Which cellular process and signal transduction." Explain and give details.

Line 334: STK4 exerts a regulatory effect on IPCs differentiation via phosphorylating YAP1....... Which kind of regulatory effect "Positive or negative"? Conclusion was based on this comparison and effect was not explained in the manuscript.

Reviewer #2: In the current study, the authors have tried to show the importance and involvement of miR-708-5p during differentiation of MDSCs into insulin producing cells. Although the study is important, experiments needs to be revised properly with proper controls.

1. Most of the experiments involve the expression of proteins by immunofluorescence studies. However, they lack proper control and comparisons. In Fig.1 the MDSCs marker expressions needs to be compared with the 0h cells. Likewise, in Fig.2, the insulin / c-peptide expression can be compared at each stage.

2. Similarly, the experiments involving addition of miR-708-5p mimic needs untreated cells as wells as NC-miRNA as controls.

3. The image quality needs to be improved throughout. The flow plots are not possible to read.

4. Authors need to explain about the STK4-Mut in detail. Is it having a mutated miR-708 binding site? If yes the details needs to be provided.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Ram Nageena Singh

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Apr 8;17(4):e0266609. doi: 10.1371/journal.pone.0266609.r002

Author response to Decision Letter 0

25 Feb 2022

Thanks for giving us the opportunity to submit a revised draft of the manuscript “Differentially expressed microRNAs during the differentiation of muscle-derived stem cells into insulin-producing cells, a promoting role of microRNA-708-5p/STK4 axis” for publication in the Journal of PLOS ONE. We appreciate the time and effort that editors and reviewers dedicated to providing feedback on our manuscript and are grateful for the insightful comments on and valuable improvements to our paper. We have incorporated most of the suggestions made by the reviewers. Those revisions are highlighted in the manuscript with tracked changes. Please see below, in blue, for a point-by-point response to the reviewers’ comments and concerns.

Reviewer #1: The objective of the study is well thought and executed.

But there are so many places in the manuscript which need to be improved.

There were no mention of which diabetes was studied here Type I or Type II?

R: This study is not specific to the type of diabetes. Stem cell therapy is a promising therapeutic approach for both Type I and Type II diabetes. Thus, the type of diabetes is not specified in this study.

Scientific English need to be used (centrifuging=centrifugation; 150 g=150xg) and reviewed carefully before submission.

R: Thanks for pointing this out. We have reviewed this manuscript carefully and revised these non-standard writing.

As line 224 mention: The separate and overlapping DEmiRNAs...... It may be refrain as "Unique and common" DEmiRNAs.... Last line mentioned "Left 11", it can be refrain as "remaining 11".

R: Thanks for pointing this out. We have modified these words as you suggested.

There are many places where sentences need to be reframed. Few sentences are repeated in Introduction and discussion.

R: Thanks for your suggestion. We have revised sentences that were repeated in the Discussion with the Introduction.

Every time Scale bar has been mentioned as separate sentence without making a sentence, which need to be corrected. p-values either be given in sentence or in parentheses.

R: Thanks for pointing this out. We have revised the “Scale bar = 100 or 200 μm” into a sentence “Scale bar is 100 or 200 μm” in the Figure legends. P-values have been given in sentence, e.g., “***P < 0.001 compared with the Control.”.

What is RPMI? Is this a growth medium or Institute?

R: RPMI is a growth medium and its full name has been modified to the Roswell Park Memorial Institute (RPMI) medium in the Methods section.

nictinamide=nicotinamide.

R: The word “nictinamide” has been revised to “nicotinamide”.

Version and references need to be provided for used Softwares and databases.

R: Thanks for pointing this out. The versions and references for used softwares and databases have been added to the Methods section.

Methods: What were the analysis parameters used for processing of Raw sequence data and quality passed data?

R: The high-quality sequencing data were screened according to the criteria as follows: 1) Remove the 3' linker sequence in the reads, and remove the reads without insert fragments due to the self-ligation of the linker; 2) Remove the reads with low sequencing quality in 3'-base (the quality value is less than 20); 3) Remove reads containing unknown base N; 4) Choose reads with length between 18nt and 32nt. These analysis parameters have been added to the Methods section.

Wild-type STK4 (STK4-WT) and the mutant 141 STK4 (STK4-MT) were cloned into pGL3 alkaline luciferase vector. Explain Mutation experiment.

R: STK4-MT was established via mutating the putative binding site of miR-708-5p in STK4 3’-UTR, which has been described in the Methods section.

Line 171: performed at least three independent repetitions. Is this assumption or confirmation regarding replicates?

R: The replicate determination is to confirm the results.

Results:

Sequencing: No result has been mentioned about sequencing (Data obtained, processed in terms of reads and quality). pls provide this detail. What

R: Thanks for pointing this out. The data acquisition and processing about sequencing have been provided in the Methods section. In the Results section, we mainly described the obtained differentially expressed miRNAs from sequencing.

Line 193: These two markers; Which are these two markers? Explain.

R: These two markers are insulin and C-peptide that have been explained in the Results section.

Line 208: Pls provide Figure number for heatmap.

R: The heatmap is in Figure 3B, which has been provided in the Results section.

There were 7145 target genes identified but only mention of 1655 for GO term analysis, what about other genes? Pls explain how these GO terms (12 biological process, 6 cellular components and 2 molecular functions) are related to IPCs differentiation.

R: In this study, we mainly explored the KEGG pathways involved in metabolism, genetic information processing, environmental information processing, cellular processes, organismal systems, and human diseases. A total of 1655 genes were enriched in these pathways, therefore, we mentioned 1655 target genes for KEGG pathway analysis in this manuscript. For GO terms analysis, most of GO terms were closely related to cellular process and biological regulation that play important roles during IPCs differentiation. The association between GO terms and IPCs differentiation has been explained in the Results section.

Venn diagram and heatmap and bar charts are not visible, high quality figures may be submitted.

R: Thanks for pointing this out. We have re-provided these images with high resolution (300 dpi).

Line 311: Emerging data suggest that miRNAs act as a pivotal role in IPCs differentiation; "miRNAs play a pivotal role". Refrain the sentence.

R: We have revised the “miRNAs act as a pivotal role” to "miRNAs play a pivotal role" in the Discussion section as you suggest.

Line 315: These researchers; Which researchers referred here?

R: “These researchers” means the previous studies mentioned in the manuscript. We have modified “These researchers” to “These previous studies” in the Discussion section.

Line 322: The results showed that these target genes were mainly related to cellular process and signal transduction. "No mention of Which cellular process and signal transduction." Explain and give details.

R: Cellular process and signal transduction includes cell growth and death, apoptosis signaling pathway, insulin/IGF pathway-MAPK cascade, etc. That has been added in the Discussion section.

Line 334: STK4 exerts a regulatory effect on IPCs differentiation via phosphorylating YAP1....... Which kind of regulatory effect "Positive or negative"? Conclusion was based on this comparison and effect was not explained in the manuscript.

R: STK4 may exert a negative regulatory effect on IPCs differentiation, which has been revised in the Discussion section. There is direct evidence for the effect of STK4 on IPCs differentiation in this study, which will be further confirmed in subsequent investigation. In this study, we mainly focus on the role of miR-708-5p in IPCs differentiation.

Reviewer #2: In the current study, the authors have tried to show the importance and involvement of miR-708-5p during differentiation of MDSCs into insulin producing cells. Although the study is important, experiments needs to be revised properly with proper controls.

1. Most of the experiments involve the expression of proteins by immunofluorescence studies. However, they lack proper control and comparisons. In Fig.1 the MDSCs marker expressions needs to be compared with the 0h cells. Likewise, in Fig.2, the insulin / c-peptide expression can be compared at each stage.

R: Thanks for your professional suggestion. The experimental design of this study referred to the previous research by Xu et al. (2019) (PMID: 30767782). The comparisons of the results in Fig. 1 have been revised as you suggest. In Fig. 2, the insulin/C-peptide expression of MDSCs-derived IPCs was compared to MDSCs without differentiation.

2. Similarly, the experiments involving addition of miR-708-5p mimic needs untreated cells as wells as NC-miRNA as controls.

R: Thanks for your professional suggestion. The experimental design of this study referred to the previous research by Xu et al. (2019) (PMID: 30767782), which can provide enough evidence to confirm the effect of miR-708-5p.

3. The image quality needs to be improved throughout. The flow plots are not possible to read.

R: Thanks for pointing this out. We have improved images with high resolution.

4. Authors need to explain about the STK4-Mut in detail. Is it having a mutated miR-708 binding site? If yes the details needs to be provided.

R: STK4-MT was established via mutating the putative binding site of miR-708-5p in STK4 3’-UTR, which has been described in the Methods section.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file. (20KB, docx)

Decision Letter 1

Abdul Qadir Syed

21 Mar 2022

PONE-D-21-35752R1Differentially expressed microRNAs during the differentiation of muscle-derived stem cells into insulin-producing cells, a promoting role of microRNA-708-5p/STK4 axisPLOS ONE

Dear Dr. Ma,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Specifically, there is still one comment which was not addressed in the revised manuscript. I highly suggest that author should address this comment in the final version of manuscript. 

Please submit your revised manuscript by May 02 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Abdul Qadir Syed, PhD

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Staff Editor Comments (if provided): PLOS ONE does not provide copyediting or proofs of accepted manuscripts. We therefore recommend that you carefully review your manuscript and correct any language errors at this time.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: There is still one comment which need to be addressed.

Statistical Analysis:

Line 182: Each experiment was performed at least three independent repetitions.

This sentence reflects that Authors were confirmed about number of replicates. Why "at least"? Why not that "All the experiments were performed with 3 replicates"?

Pls revise the sentence.

Reviewer #2: The authors have answered all the comments satisfactorily. Now, it can be considered for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Ram Nageena Singh

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Apr 8;17(4):e0266609. doi: 10.1371/journal.pone.0266609.r004

Author response to Decision Letter 1

22 Mar 2022

Thanks for giving us the opportunity to submit a revised draft of the manuscript “Differentially expressed microRNAs during the differentiation of muscle-derived stem cells into insulin-producing cells, a promoting role of microRNA-708-5p/STK4 axis” for publication in the Journal of PLOS ONE. We appreciate the time and effort that editors and reviewers dedicated to providing feedback on our manuscript and are grateful for the insightful comments on and valuable improvements to our paper. We have incorporated most of the suggestions made by the reviewers. Those revisions are highlighted in the manuscript with tracked changes. Please see below, in blue, for a point-by-point response to the reviewers’ comments and concerns.

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

R: We have carefully reviewed the reference cited in this manuscript, and ensure that it is complete and correct.

Additional Staff Editor Comments (if provided): PLOS ONE does not provide copyediting or proofs of accepted manuscripts. We therefore recommend that you carefully review your manuscript and correct any language errors at this time.

R: We have carefully reviewed this manuscript, and corrected language errors.

Reviewer #1: There is still one comment which need to be addressed.

Statistical Analysis:

Line 182: Each experiment was performed at least three independent repetitions.

This sentence reflects that Authors were confirmed about number of replicates. Why "at least"? Why not that "All the experiments were performed with 3 replicates"?

Pls revise the sentence.

R: Thanks for pointing this out. We have revised the sentence “Each experiment was performed at least three independent repetitions.” to “All the experiments were performed with three independent repetitions.” in line 181.

Reviewer #2: The authors have answered all the comments satisfactorily. Now, it can be considered for publication.

R: Authors appreciate reviewer’s valuable comments and approval for publication.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file. (15KB, docx)

Decision Letter 2

Abdul Qadir Syed

24 Mar 2022

Differentially expressed microRNAs during the differentiation of muscle-derived stem cells into insulin-producing cells, a promoting role of microRNA-708-5p/STK4 axis

PONE-D-21-35752R2

Dear Dr. Ma, 

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Abdul Qadir Syed, PhD

Academic Editor

PLOS ONE

Acceptance letter

Abdul Qadir Syed

30 Mar 2022

PONE-D-21-35752R2

Differentially expressed microRNAs during the differentiation of muscle-derived stem cells into insulin-producing cells, a promoting role of microRNA-708-5p/STK4 axis

Dear Dr. Ma:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Abdul Qadir Syed

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Raw images

    (PDF)

    Click here for additional data file. (88.4KB, pdf)
    Attachment

    Submitted filename: Response to Reviewers.docx

    Click here for additional data file. (20KB, docx)
    Attachment

    Submitted filename: Response to Reviewers.docx

    Click here for additional data file. (15KB, docx)

    Data Availability Statement

    All relevant data are within the paper and its Supporting information files.

    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES