Abstract
Background
Mounting evidence summarizes that circRNA is closely implicated in the development of numerous cancers. Our study aimed to investigate the role of circ_0119412 whose function was not explored in cervical cancer.
Methods
RT‐qPCR analysis was utilized for the expression analysis of circ_0119412, miR‐217, and anterior gradient 2 (AGR2). CCK‐8 assay, transwell assay, and MTT assay were employed to assess cell proliferation, migration, and adhesion, respectively. Animal study was performed to check the role of circ_0119412 in vivo. Bioinformatics analysis was applied to predict the downstream targets of circ_0119412. RIP assay was utilized to examine miRNAs potentially bound by circ_0119412. The interplays between miR‐217 and circ_0119412 or AGR2 were validated by dual‐luciferase reporter assay.
Results
circ_0119412 expression was highly enhanced in cervical tumor tissues and cancer cells. circ_0119412 overexpression aggravated cervical cancer cell proliferation, migration, and adhesion, and its overexpression was also conducive to tumor formation and growth in animal models. AGR2 was upregulated in cervical cancer by the public bioinformatics data. circ_0119412 bound to miR‐217, and miR‐217 bound to AGR 3’UTR. The promoting effects of circ_0119412 overexpression on cancer cell malignant phenotypes were reversed by miR‐217 enrichment. In addition, increased expression of miR‐217 suppressed AGR2 expression, thus weakening the functional effects of AGR2.
Conclusion
circ_0119412 functioned as an oncogenic driver to promote the malignant development of cervical cancer by targeting the miR‐217/AGR2 pathway.
Keywords: AGR2, cell proliferation, cervical cancer, circ_0119412, miR‐217
circ_0119412 functioned as an oncogenic driver to promote the proliferation, migration, adhesion, and tumor growth of cervical cancer cells by targeting the miR‐217/AGR2 pathway.
1. INTRODUCTION
Cervical cancer is the fourth leading malignant tumor and the fourth leading cause of death from cancer, mainly caused by persistent human papillomavirus (HPV) infection. 1 , 2 This gynecological health burden is prevalent worldwide. In underdeveloped countries, the 5 years survival rate of cervical cancer patients is less than 50% mainly due to the lack of effective screening systems. 3 , 4 Despite the rapid progression of radiotherapy, chemotherapy, and surgery, the survival rate of patients with advanced cervical cancer remains poor. 5 Therefore, exploring the molecular mechanism of cervical cancer is necessary for patients with cervical cancer to obtain better treatment outcomes.
circRNAs, a new type of endogenous RNAs, are products of precursor mRNA splicing, with specific closed‐loop structures. 6 , 7 circRNA is one of the novel objects that have been recently evaluated in a variety of cancers, and its primary function and potential as a biomarker have intrigued numerous researchers. 8 Compared with other linear molecules, circRNA has an advantage in widespread expression and high stability, which provides a basis for circRNA as a more ideal biomarker in cancer management. 9 Accumulating reports illustrate that cervical tumorigenesis is partly initiated by the dysregulation of circRNAs. 10 They hold the view that certain circRNAs have great potencies to modulate the aggressive biological behaviors of cervical cancer cells, such as cell viability, cell cycle, cell metastasis, and glycolysis metabolism. 11 , 12 , 13 Although the application of RNA‐sequencing technology has identified many circRNAs that are differentially expressed in cancer, their functions are still largely unknown. 14 circ_0119412, also named circRNA_102958, was originally declaimed to be upregulated in gastric cancer, 15 and the subsequent studies defined circ_0119412 as an oncogenic driver in multiple cancers. 16 , 17 Nevertheless, the role of circ_0119412 in cervical cancer remained unclear, which arouse our concern.
Emerging evidence concludes that the circRNA/miRNA/mRNA pathway is closely implicated with tumorigenesis. 18 , 19 In a word, circRNA binds to target miRNAs and relieves miRNA‐mediated inhibition on target genes, which is widely studied to address the functional mechanism of circRNA. The data from the public GEO database displayed that anterior gradient 2 (AGR2) was highly expressed in cervical tumor samples, and it has been demonstrated to be an oncogene in various cancers, including cervical cancer. 20 , 21 , 22 We speculated that circ_0119412 might upregulate the expression of AGR2 by targeting certain miRNAs that jointly bound to both circ_0119412 and AGR2. Advances in bioinformatics make it easy to predict the potential interactions between miRNA and circRNA or mRNA. 23 , 24 Accordingly, miR‐217 was predicted to harbor the binding site with both circ_0119412 and AGR2 3’UTR. It was of great importance to explore whether circ_0119412 could regulate AGR2 expression by targeting miR‐217.
The present work investigated the function of circ_0119412 in cervical cancer. Besides, the relationship between miR‐217 and circ_0119412 or AGR2 was verified, and their interplays in cervical cancer development were assessed by rescue experiments. This work aimed to first uncover the role of circ_0119412 in cervical cancer, thus providing new opinions to understand cervical cancer pathogenesis.
2. MATERIALS AND METHODS
2.1. Clinical tissues
Cervical tumor tissues (n = 38) and matched nontumor normal tissues (n = 38) were collected from patients with cervical cancer during surgical operation in General Hospital of Western Theater Command of the Chinese People’ s Liberation Army. Ahead of the surgery, all patients signed written informed consent, and they never received any therapies. Clinical specimens were uniformly preserved at −80℃ conditions for use. This study was carried out with the permission of the Ethics Committee of General Hospital of Western Theater Command of the Chinese People’ s Liberation Army.
2.2. Cells and cell culture
Human cervical epithelial cells (HcerEpic) were purchased from Bluefcell and cultured in DMEM containing 10% FBS. Cervical cell line, CaSki, was obtained from Procell and cultured in RPMI1640 medium containing 10% FBS. Cervical cell lines, Hela, SiHa, and C33A, were obtained from Procell and cultured in DMEM containing 10% FBS. All cells were maintained in an incubator with 5% CO2 at 37℃.
2.3. RT‐qPCR
Total RNA was obtained with the use of Trizol reagent (Cwbio), and the concentration of RNA was checked by NanoDrop2000 (Thermo Fisher Scientific). The equal amount of RNA was used for cDNA synthesis using the ProtoScript® First Strand cDNA Synthesis Kit (New England Biolabs,) or miRcute Plus miRNA First Strand cDNA Kit (TianGen) and, afterward, the PowerUp™ SYBR Green Master Mix (Thermo Fisher Scientific). Relative expression normalized by GAPDH or U6 was calculated using the 2−ΔΔCt method. The sequences of primers used in this study were shown in Table 1.
TABLE 1.
Primer sequence of qRT‐PCR assay
| qRT‐PCR | Primer sequence |
|---|---|
| circ_0119412 | Antisense: 5′ GACGCCCTACCTGGTCAAG 3′ |
| Sense: 5′ GAAATTCCGCGTATCCATTC 3′ | |
| miR−217 | Antisense: 5′ CGCAGATACTGCATCAGGAA 3′ |
| Sense: 5′ CTGAAGGCAATGCATTAGGAACT 3′ | |
| miR−578 | Antisense: 5′ CTTCTTGTGCTCTAGGAT 3′ |
| Sense: 5′ GAACATGTCTGCGTATCTC 3′ | |
| AGR2 | Antisense: 5′ GGAGGACAAACTGCTCTGCCAA 3′ |
| Sense: 5′ TCCAAGACAACAAACCCTTG 3′ | |
| MUC21 | Antisense: 5′ GAATGCACACAACTTCCCATAGT 3′ |
| Sense: 5′ GGCTATCGAGGATACTGGTCTC 3′ | |
| U6 | Antisense: 5′ CGCTTCGGCAGCACATATAC 3′ |
| Sense: 5′ AAATATGGAACGCTTCACGA 3′ | |
| GAPDH | Antisense: 5′ TGATGGCATGGACTGTGGTCATGAG 3′ |
| Sense: 5′ CTCCTGCACCACCAACTGCTTAGC 3′ |
2.4. circRNA location analysis
Cytoplasmic RNA and nuclear RNA were separately isolated using the PARIS kit (Thermo Fisher Scientific), and the abundance of circ_0119412 in cytoplasm or nucleus was determined by RT‐qPCR, employing GAPDH as an internal reference in cytoplasm and U6 as an internal reference in nucleus.
2.5. RNase R digestion
Total RNA isolated from Hela and SiHa cells was quickly exposed to RNase R (BioVision) at 37℃ conditions for 0.5 h. Then, the digested RNA was assembled into cDNA and subjected to RT‐qPCR analysis.
2.6. Cell transfections
circ_0119412 overexpression vector was constructed using pCD‐ciR by Geneseed, named oe‐circ, using blank vector as the negative control (oe‐NC). The mimic of miR‐217 (miR‐217 mimic) and mimic negative control (mimic‐NC) were bought from Ribobio (China). AGR2 overexpression vector was constructed using pcDNA by Genepharma, named oe‐AGR2, using blank vector as the negative control (oe‐NC). Hela and SiHa cells were transfected with these oligonucleotides or vectors using Lipofectamine 3000 (Invitrogen).
2.7. CCK‐8 assay
The transfected cells were seeded into 96‐well plates (5 × 104 cells in 100 µl per well) and subsequently cultured in 37℃ incubator. CCK‐8 reagent (Cwbio) was used to incubate cells in different wells at the indicated time points (24, 48, 72 or 96 h post‐seeding). Cells were reacted with CCK‐8 for another 2–4 h. The optical density (OD) value was determined at 450 nm using a microplate reader (BioTek,).
2.8. Transwell assay
The transfected cells (5 × 104) suspended in serum‐free medium were transferred into the top of 8 µm transwell chambers. We supplemented the growth medium containing 20% FBS into the bottom of chambers to induce cell migration across the membrane. Cells were incubated for 24 h, and cells migrated to the lower surface of membrane were fixed with methanol and stained with crystal violet. After washing with ultrapure water, the number of cells was assessed under a light microscope (Olympus).
2.9. Adhesion assay
Matrigel (BD Biosciences) was diluted in serum‐free media and then transferred into 96‐well plates (50 µl/well). The transfected cells (5 × 104) suspended in serum‐free medium were plated into the 96‐well plates (100 µl/well) coated with Matrigel and next cultured at 37℃ for 4 h. After removing the medium, the nonadherent cells in wells were washed with PBS. Subsequently, the adherent cells were examined using the MTT reagent (Cwbio). OD value was determined at 570 nm using a microplate reader (BioTek), reflecting the proportion of cells in Matrigel‐coated 96‐well plates.
2.10. Animal study
Balb/c mice (female, 6‐week‐old) were bought from Vital River Animal Laboratory and regularly kept in a pathogen‐free room. circ_0119412 overexpress vector (oe‐circ) and control vector (oe‐NC) were subjected to lentivirus package by Geneseed. Hela cells infected with lentivirus‐packaged oe‐circ or oe‐NC were subcutaneously introduced into the right armpit of nude mice (n = 5 per group). During tumorigenesis, tumor volume (length × width2 × 1/2) was calculated once a week. These mice were housed for 5 weeks and then euthanized to excise tumor tissues. The procedures of animal study were permitted by the Ethics Committee of General Hospital of Western Theater Command of the Chinese People's Liberation Army.
2.11. Bioinformatics analysis
Two mRNA microarrays (GEO accession: GSE64217 and GSE89657) were used to screen the significantly upregulated genes in cervical cancer. CircInteractome and TargetScan databases were utilized to predict miRNAs bound to circ_0119412 and AGR2.
2.12. RIP assay
The antibodies of Ago2 (Rabbit Anti‐Human AGO2 Antibody, Cat#: HPA058075, Sigma‐Aldrich) and IgG (Rabbit Anti‐Human IgG Antibody, Cat#: 32160702, Sigma‐Aldrich) were used to enrich circ_0119412 and target miRNAs. RIP assay was conducted with the use of the Magna RIP® Kit (Millipore). Simply put, Hela and SiHa cells were lysed by RIP lysis buffer and then cultured with magnetic beads coupled with anti‐Ago2 or anti‐IgG. Eventually, RNA complexes on beads were eluted and used for RT‐qPCR analysis.
2.13. Dual‐luciferase reporter assay
circ_0119412 and AGR2 3’UTR fragments with the wild‐type (WT) or mutant‐type (MUT) complementary sequence of miR‐217 were subcloned into pmirGLO plasmid by GenePharma. Hela and SiHa cells were transfected with miR‐217 mimic or miR‐NC and the WT or MUT reporter plasmid of circ_0119412 or AGR2 3’UTR. After transfection, cells were cultured for 48 h and next detected with the Dual‐Luciferase® Reporter Assay System (Promega, USA) to determine the change of luciferase activity.
2.14. Western blotting
The total proteins were extracted by radioimmunoprecipitation assay (RIPA) (Beyotime) lysate. BCA assay (Beyotime) was used to determine the protein concentrations. Subsequently, equal amounts of proteins were separated through sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) and electrophoretically transferred to polyvinylidene fluoride membranes for 2 h. After blockage in 5% skim milk for 1 h, the membranes were then incubated with anti‐AGR2 rabbit antibody (Cat#: 55003, 1:1000 dilution, Cell Signaling Technology,) and anti‐GAPDH (Cat#: 5174, 1:1000 dilution, Cell Signaling Technology,) overnight at 4°C. HRP‐conjugated secondary antibody (Cat#: 14708, 1:2000 dilution, Cell Signaling Technology,) was used to incubate the membranes. The protein bands were detected by gel imaging system through electrochemiluminescence (ECL) (Pierce,), and an imaging system was used to detect signals. Densitometry was performed using ImageJ software (National Institutes of Health, Bethesda).
2.15. Statistical analysis
Data were collected from three independent experiments for each assay and then processed by GraphPad Prism 7.0 (GraphPad,). The difference in various groups was compared using the Student's t‐test or ANOVA as appropriate. The correlation between miR‐217 expression and circ_0119412 expression or AGR2 expression in tumor tissues was ascertained by Pearson's analysis. The final data were shown as mean ± standard deviation (SD). p‐value less than 0.05 was defined as statistical significance.
3. RESULTS
3.1. circ_0119412 was overexpressed in cell lines and tumor tissues of cervical cancer
First, we identified the basic characteristics of circ_0119412 in cervical cancer. As displayed in Figure 1A, circ_0119412 expression was noticeably enhanced in Hela, CaSki, SiHa, and C33A cells relative to HcerEpic cells. Besides, circ_0119412 expression was also increased in cervical tumor tissues relative to normal tissues (Figure 1B). Given that the expression of circ_0119412 was relatively higher in Hela and SiHa cells, Hela and SiHa cells were used in the following assays. Subcellular location assay exhibited that circ_0119412 was abundantly located in the cytoplasm but not in the nucleus (Figure 1C). In addition, RNase R digestion significantly degraded the expression of GAPDH but hardly affected the expression of circ_0119412 (Figure 1D), which verified the existence of circ_0119412. The data mainly introduced that circ_0119412 was upregulated in cervical cancer.
FIGURE 1.
circ_0119412 was forcefully expressed in cervical cancer. (A) circ_0119412 expression in HcerEpic, Hela, CaSki, SiHa, and C33A cells was tested by RT‐qPCR, *p < 0.05 and **p < 0.001 relative to HcerEpic. (B) circ_0119412 expression in tumor tissues and normal tissues was tested by RT‐qPCR, **p < 0.001 relative to normal. (C) The distribution of circ_0119412 in cytoplasm or nucleus was checked by RT‐qPCR. (D) The existence of circ_0119412 was checked by RNase R, **p < 0.001 relative to RNase R
3.2. circ_0119412 overexpression aggravated Hela and SiHa cell proliferation, migration, and adhesion and promoted tumor growth in vivo
To illustrate the functional role of circ_0119412, the endogenous level of circ_0119412 was increased in Hela and SiHa cells. The data displayed that circ_0119412 expression was strikingly elevated in these cells transfected with oe‐circ compared with oe‐NC (Figure 2A). In function, CCK‐8 assay uncovered that Hela and SiHa cells with circ_0119412 overexpression had aggravated cell proliferative capacity (Figure 2B). Transwell assay displayed that the number of migrated cells was strikingly heightened in the experimental cells with circ_0119412 upregulation (Figure 2C). In addition, MTT assay presented that circ_0119412 upregulation strengthened the ability of adhesion in Hela and SiHa cells (Figure 2D). Moreover, in vivo models were constructed in nude mice by injecting with oe‐circ‐ or oe‐NC‐infected Hela cells. The results figured that Hela cells with circ_0119412 overexpression induced tumor nodes with increased tumor size and tumor weight (Figure 2E). All in all, circ_0119412 overexpression promoted cervical cell proliferation, migration, and adherence and accelerated tumor growth in mice.
FIGURE 2.
circ_0119412 downregulation suppressed cervical cancer cell malignant behaviors and tumor growth in animal models. (A) The efficiency of circ_0119412 overexpression was checked by RT‐qPCR. (B) Cell proliferation affected by circ_0119412 overexpression was assessed by CCK‐8 assay. (C) Cell migration affected by circ_0119412 overexpression was assessed by transwell assay. (D) Cell adhesion affected by circ_0119412 overexpression was assessed by MTT assay. (E) The role of circ_0119412 in vivo was assessed by animal study. *p < 0.05, **p < 0.001 relative to oe‐NC
3.3. The miR‐217/AGR2 axis might be the downstream target of circ_0119412
To identify the potential mRNAs involved in cervical cancer, two mRNA microarrays (GEO accession: GSE64217 and GSE89657) were used to screen the significantly upregulated genes with adj.p < 0.01 and logFC>2. The results showed that a total of 16 upregulated genes were overlapped in two datasets (Figure 3A). We then uploaded these 16 genes to Metascape and found that three genes (PLPP3, AGR2, and MUC21) were related to the regulation of cell adhesion (Figure 3B). Subsequently, their expression levels were examined in our collected clinical samples, and AGR2 with the highest expression in cervical cancer samples was selected as the gene of our interest (Figure 3C). Next, CircInteractome and TargetScan databases were used to predict the potential miRNAs binding to circ_0119412 and AGR2, respectively. The results showed that miR‐217 and miR‐578 were overlapped in CircInteractome and TargetScan (Figure 3D). Finally, RIP assay displayed that circ_0119412, miR‐217, and miR‐578 were abundantly enriched in the anti‐Ago2 RIP group, and the enrichment of miR‐217 was relatively higher than miR‐578 (Figure 3E). Thereby, miR‐217 was selected as a target in our following study.
FIGURE 3.
AGR2 and miR‐217 were screened in further analysis. (A) A total of 16 upregulated genes were screened from two mRNA microarrays (GSE64217 and GSE89657) with adj.p < 0.01 and logFC>2. (B) Metascape analysis confirmed that the regulation of cell adhesion including three genes (PLPP3, AGR2, and MUC21) was the key biological process. (C) The expression of PLPP3, AGR2, and MUC21 in our clinical samples was detected by RT‐qPCR, *p < 0.05 and **p < 0.001 relative to normal. (D) miR‐217 and miR‐578 were collectively predicted from CircInteractome and TargetScan. (E) The binding between circ_0119412 and miR‐217 or miR‐578 was confirmed by RIP assay, **p < 0.001 relative to anti‐IgG
3.4. circ_0119412 bound to miR‐217 whose expression was reduced in cervical cancer
To further ensure the relationship between circ_0119412 and miR‐217, dual‐luciferase reporter assay was performed. The binding site between them was depicted in Figure 4A, and circ_0119412 WT and MUT reporter plasmids were constructed. As a result, miR‐217 enrichment in Hela and SiHa cells markedly reduced luciferase activity in cells with circ_0119412 WT plasmid transfection but not circ_0119412 MUT plasmid transfection (Figure 4B). The expression of miR‐217 was pronouncedly declined in clinical cervical tumor tissues relative to normal tissues (Figure 4C). As expected, miR‐217 expression was also pronouncedly lower in Hela and SiHa cells than that in HcerEpic cells (Figure 4D). Furthermore, a negative correlation was detected between miR‐217 expression and circ_0119412 expression in tumor tissues (Figure 4E). The evidence strongly supported that miR‐217 was targeted by circ_0119412.
FIGURE 4.
miR‐217 was targeted by circ_0119412. (A) The binding site between circ_0119412 and miR‐217 was provided by CircInteractome. (B) Their relationship was further ensured by dual‐luciferase reporter assay, **p < 0.001 relative to mimic‐NC. (C) miR‐217 expression in clinical samples was checked by RT‐qPCR, **p < 0.001 relative to normal. (D) miR‐217 expression in HcerEpic, Hela, and SiHa cells was checked by RT‐qPCR, **p < 0.001 relative to HcerEpic. (E) Pearson's analysis showed the correlation between miR‐217 expression and circ_0119412 expression in tumor tissues (R 2 = 0.6694, p < 0.0001)
3.5. circ_0119412 triggered Hela and SiHa cell malignant behaviors by sequestering miR‐217
Following rescue experiments were performed to determine whether circ_0119412 played functions by targeting miR‐217. miR‐217 expression was prominently weakened in Hela and SiHa cells transfected with alone oe‐circ but notably enhanced in cells transfected with alone miR‐217 mimic, and miR‐217 expression was partly restored in Hela and SiHa cells by oe‐circ + miR‐217 mimic cotransfection relative to alone oe‐circ transfection (Figure 5A). The proliferation of Hela and SiHa cells was markedly promoted by circ_0119412 overexpression but repressed by miR‐217 enrichment (Figure 5B). Compared with alone oe‐circ, the cotransfection of oe‐circ + miR‐217 mimic partly impaired cell proliferative capacity (Figure 5B). Similarly, cell migration was induced by circ_0119412 overexpression but inhibited by miR‐217 upregulation, and the reintroduction of miR‐217 mimic partly repressed cell migration that was enhanced by alone circ_0119412 overexpression (Figure 5C). The adhesion of Hela and SiHa cells was induced by circ_0119412 overexpression but impaired by miR‐217 upregulation, and further miR‐217 mimic transfection alleviated cell adhesion in oe‐circ‐transfected cells (Figure 5D). All in all, miR‐217 upregulation largely reversed the effects of circ_0119412 overexpression.
FIGURE 5.
miR‐217 upregulation reversed the effects caused by circ_0119412 overexpression. (A) The expression of miR‐217 in Hela and SiHa cells transfected with oe‐circ, miR‐217 mimic, or oe‐circ+miR‐217 mimic was checked by RT‐qPCR. In these transfected cells, (B‐D) cell proliferation, migration, and adhesion were monitored by CCK‐8, transwell, or MTT assay, respectively, **p < 0.001 relative to oe‐NC; & p < 0.05, && p < 0.001 relative to mimic‐NC; # p < 0.05, ## p < 0.001 relative to oe‐circ+mimic
3.6. miR‐217 directly bound to AGR2 3’UTR
The relationship between miR‐217 and AGR2 was further confirmed. The binding site between miR‐217 and AGR2 3’UTR was shown in Figure 6A. Dual‐luciferase reporter assay exhibited that miR‐217 enrichment substantially weakened luciferase activity in Hela and SiHa cells transfected with AGR2 WT plasmid but not AGR2 MUT plasmid (Figure 6B). The expression of AGR2 mRNA was significantly elevated in Hela and SiHa cells compared with that in HcerEpic cells (Figure 6C). Moreover, miR‐217 expression in tumor tissues harbored a negative correlation with AGR2 expression (Figure 6D). The evidence supported that AGR2 was a target gene of miR‐217.
FIGURE 6.
AGR2 was a target of miR‐217. (A) The binding site between miR‐217 and AGR2 3’UTR was provided by TargetScan. (B) Their relationship was validated by dual‐luciferase reporter assay, **p < 0.001 relative to mimic‐NC. (C) The expression of AGR2 in HcerEpic, Hela, and SiHa cells was measured by RT‐qPCR, **p < 0.001 relative to HcerEpic. (D) Pearson's analysis showed the correlation between miR‐217 expression and AGR2 expression in tumor tissues (R 2 = 0.6560, p < 0.0001)
3.7. miR‐217 enrichment inhibited Hela and SiHa cell malignant behaviors by degrading AGR2
Following rescue experiments were carried out to disclose the interplay between miR‐217 and AGR2 in cervical cancer development. The expression of AGR2 protein was prominently strengthened in Hela and SiHa cells transfected with alone oe‐AGR2, and its expression was markedly reduced in cells transfected with alone miR‐217 mimic (Figure 7A). Besides, AGR2 expression enhanced in cells transfected with oe‐AGR2 was partially weakened by additional miR‐217 mimic transfection (Figure 7A). In terms of function, the abilities of proliferation, migration, and adhesion in Hela and SiHa cells were strikingly facilitated by AGR2 overexpression but strikingly depleted by miR‐217 mimic (Figure 7B–7D). In addition, the reintroduction of miR‐217 mimic partially impaired the abilities of proliferation, migration, and adhesion in Hela and SiHa cells transfected with oe‐AGR2, compared with alone oe‐AGR2 transfection (Figure 7B–7D). Overall, miR‐217 enrichment suppressed AGR2 expression, leading to the partial loss of AGR2 function.
FIGURE 7.
miR‐217 inhibited cervical cancer cell malignant behaviors by degrading AGR2. (A) The expression of AGR2 protein in Hela and SiHa cells transfected with oe‐AGR2, miR‐217 mimic, or oe‐AGR2+miR‐217 mimic was measured by western blot. In these transfected cells, (B‐D) cell proliferation, migration, and adhesion were investigated by CCK‐8, transwell, and MTT assay, respectively, **p < 0.001 relative to oe‐NC; & p < 0.05 and && p < 0.001 relative to mimic‐NC; # p < 0.05, ## p < 0.001 relative to oe‐AGR2+mimic
4. DISCUSSION
The findings from the current study mainly showed that circ_0119412 expression was markedly upregulated in cervical tumor tissues and cancer cells. Functional assays presented that the forced expression of circ_0119412 promoted the proliferation, migration, and adhesion of cervical cancer cells, and solid tumor growth in animal models. We also disclosed that circ_0119412 targeted miR‐217 to relieve the inhibition of AGR2, thereby accelerating the progression of cervical cancer.
An increasing number of circRNAs have been functionally investigated in cervical cancer. For example, circ_0000745 was abundantly expressed in cervical cancer, and the impaired expression of circ_0000745 repressed cancer cell proliferation, migration, and invasion. 25 Besides, circ_0085616 was also richly expressed in cervical cancer, and its knockdown inhibited cancer cell growth by impairing glycolysis metabolism. 26 Nonetheless, the relationship between circRNA deregulation and cervical cancer progression is still poorly explored. Through reviewing and summarizing the previous studies, we found that circ_0119412 was stated to be overexpressed in gastric cancer, and its expression was linked to TNM stage. 15 Besides, circ_0119412 was upregulated in colorectal cancer, and its downregulation blocked cancer cell growth and metastasis. 16 In addition, circ_0119412 upregulation was also shown in ovarian cancer tissues and cells, and high circ_0119412 expression drove a poor prognosis of patients, and the downregulation of circ_0119412 obstructed ovarian cancer cell proliferation, migration, and invasion. 17 These studies consistently highlighted that circ_0119412 facilitated the aggressive progression of different cancers. Our study for the first time investigated the role of circ_0119412 in cervical cancer. Largely consistent with previous studies, we monitored that circ_0119412 was also highly upregulated in cervical cancer, and the forced expression of circ_0119412 aggravated cancer cell proliferation, migration, and adhesion. The tumor‐promoting role of circ_0119412 was further confirmed in animal models. All in all, circ_0119412 was a carcinogenic driver in cervical cancer.
The data from the public GEO database illustrated that AGR2 was upregulated in cervical cancer tissues and closely associated with the regulation of cell adhesion. Interestingly, further study identified that miR‐217 interacted with circ_0119412 and AGR2, implying that circ_0119412 might regulate AGR2 expression by targeting miR‐217. The expression of miR‐217 was pronouncedly reduced in cervical cancer tissues and cells, which was consistent with previous studies. 27 , 28 Besides, previous studies reported that miR‐217 as a tumor suppressor inhibited cervical cancer cell proliferation, invasion, and chemoresistance by weakening the expression of some oncogenes. 27 , 28 , 29 Our study showed consistent results. Importantly, we found that the reintroduction of miR‐217 mimic partly reversed the effects of circ_0119412 overexpression, suggesting that circ_0119412 promoted cervical carcinogenesis by sequestering miR‐217. These results enriched the mechanism of miR‐217 and highlighted that miR‐217 was involved in circ_0119412‐mediated regulatory networks.
Previous studies have widely explored the role of AGR2 in cancers, and AGR2 expression was concertedly enhanced in tumor tissues, such as pancreatic cancer, endometrial carcinoma, and colorectal cancer. 30 , 31 , 32 AGR2 conferred the promotion of cancer cell growth, survival, glucose metabolism, migration, invasion, and chemoresistance in various cancers. 30 , 31 , 32 The role of AGR2 in cervical cancer was poorly studied, and evidence showed that miR‐3647‐5p restrained cervical cancer cell growth and evoked apoptosis by depleting AGR2 expression, 22 suggesting that AGR2 downregulation was associated with the inhibitory behaviors of cancer cells. In agreement with these findings, our data displayed that AGR2 overexpression aggravated cervical cancer cell proliferation, migration, and adhesion. However, miR‐217 effectively suppressed AGR2 expression, leading to the loss of AGR2 function. The data hinted that miR‐217‐mediated AGR2 inhibition might be a strategy for the treatment of cervical cancer.
Our findings provided a reference for the role of circ_0119412 in cervical cancer. However, some limitations existed in our present study. For instance, the correlation between circ_0119412 expression and clinicopathologic characteristics of patients was lacking, which weakened the clinical significance of circ_0119412 in practice. This issue should be addressed in future work.
High expression of circ_0119412 was monitored in cervical cancer. circ_0119412 upregulation aggravated the malignant development of cervical cancer by targeting the miR‐217/AGR2 pathway. Our study proposed that the targeted inhibition of circ_0119412 might be a therapeutic strategy for cervical cancer.
CONFLICT OF INTERESTS
The authors declare that they have no competing interests.
AUTHOR CONTRIBUTIONS
MYW and MLC performed the experiments and data analysis. YML conceived and designed the study. DW made the acquisition of data. MYL and QYZ did the analysis and interpretation of data. All authors read and approved the manuscript.
ETHICAL APPROVAL
The present study was approved by the Ethics Committee of General Hospital of Western Theater Command of the Chinese People’ s Liberation Army (Chengdu, China). The processing of clinical tissue samples is in strict compliance with the ethical standards of the Declaration of Helsinki. All patients signed written informed consent.
CONSENT FOR PUBLICATION
Consent for publication was obtained from the participants.
CODE AVAILABILITY
Not available.
ACKNOWLEDGEMENTS
None.
Lv Y, Wang M, Chen M, Wang D, Luo M, Zeng Q. hsa_circ_0119412 overexpression promotes cervical cancer progression by targeting miR‐217 to upregulate anterior gradient 2. J Clin Lab Anal. 2022;36:e24236. doi: 10.1002/jcla.24236
Yumei Lv and Mingyi Wang equally contribute to this work.
Funding information
Funding information is not available.
DATA AVAILABILITY STATEMENT
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
REFERENCES
- 1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394‐424. [DOI] [PubMed] [Google Scholar]
- 2. Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209‐249. [DOI] [PubMed] [Google Scholar]
- 3. Sankaranarayanan R, Swaminathan R, Brenner H, et al. Cancer survival in Africa, Asia, and Central America: a population‐based study. Lancet Oncol. 2010;11(2):165‐173. [DOI] [PubMed] [Google Scholar]
- 4. Sharma S, Deep A, Sharma AK. Current treatment for cervical cancer: an update. Anticancer Agents Med Chem. 2020;20(15):1768‐1779. [DOI] [PubMed] [Google Scholar]
- 5. Czerniak B, Olszewska‐Słonina D. Biomarkers could facilitate prediction of worse clinical outcome of cancer with special insight to cervical cancer. Contemp Oncol (Pozn). 2018;22(1):1‐7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Li Z, Ruan Y, Zhang H, Shen Y, Li T, Xiao B. Tumor‐suppressive circular RNAs: Mechanisms underlying their suppression of tumor occurrence and use as therapeutic targets. Cancer Sci. 2019;110(12):3630‐3638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Zhang L, Hou C, Chen C, et al. The role of N(6)‐methyladenosine (m(6)A) modification in the regulation of circRNAs. Mol Cancer. 2020;19(1):105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Chaichian S, Shafabakhsh R, Mirhashemi SM, Moazzami B, Asemi Z. Circular RNAs: a novel biomarker for cervical cancer. J Cell Physiol. 2020;235(2):718‐724. [DOI] [PubMed] [Google Scholar]
- 9. Li Z, Zhu X, Huang S. Extracellular vesicle long non‐coding RNAs and circular RNAs: biology, functions and applications in cancer. Cancer Lett. 2020;489:111‐120. [DOI] [PubMed] [Google Scholar]
- 10. Dong P, Xu D, Xiong Y, et al. The expression, functions and mechanisms of circular RNAs in gynecological cancers. Cancers (Basel). 2020;12(6):1472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Zhang Y, Zhao L, Yang S, et al. CircCDKN2B‐AS1 interacts with IMP3 to stabilize hexokinase 2 mRNA and facilitate cervical squamous cell carcinoma aerobic glycolysis progression. J Exp Clin Cancer Res. 2020;39(1):281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Li X, Ma N, Zhang Y, et al. Circular RNA circNRIP1 promotes migration and invasion in cervical cancer by sponging miR‐629‐3p and regulating the PTP4A1/ERK1/2 pathway. Cell Death Dis. 2020;11(5):399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Hong H, Zhu H, Zhao S, et al. The novel circCLK3/miR‐320a/FoxM1 axis promotes cervical cancer progression. Cell Death Dis. 2019;10(12):950. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. López‐Jiménez E, Rojas AM, Andrés‐León E. RNA sequencing and prediction tools for circular RNAs analysis. Adv Exp Med Biol. 2018;1087:17‐33. [DOI] [PubMed] [Google Scholar]
- 15. Wei J, Wei W, Xu H, et al. Circular RNA hsa_circRNA_102958 may serve as a diagnostic marker for gastric cancer. Cancer Biomark. 2020;27(2):139‐145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Li R, Wu B, Xia J, Ye L, Yang X. Circular RNA hsa_circRNA_102958 promotes tumorigenesis of colorectal cancer via miR‐585/CDC25B axis. Cancer Manag Res. 2019;11:6887‐6893. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Wang G, Zhang H, Li P. Upregulation of hsa_circRNA_102958 indicates poor prognosis and promotes ovarian cancer progression through miR‐1205/SH2D3A Axis. Cancer Manag Res. 2020;12:4045‐4053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Xu D, Wu Y, Wang X, et al. Identification of functional circRNA/miRNA/mRNA regulatory network for exploring prospective therapy strategy of colorectal cancer. J Cell Biochem. 2020;121(12):4785‐4797. [DOI] [PubMed] [Google Scholar]
- 19. Bai S, Wu Y, Yan Y, et al. Construct a circRNA/miRNA/mRNA regulatory network to explore potential pathogenesis and therapy options of clear cell renal cell carcinoma. Sci Rep. 2020;10(1):13659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Huang L, Yang C, Wang Y, et al. Anterior gradient 2 is a novel pro‐tumor factor in pancreatic cancer under NF‐κB subunit RelA trans‐regulation that can be suppressed by eugenic acid. Biomed Pharmacother. 2020;132:110830. [DOI] [PubMed] [Google Scholar]
- 21. Li Z, Zhu Q, Hu L, Chen H, Wu Z, Li D. Anterior gradient 2 is a binding stabilizer of hypoxia inducible factor‐1α that enhances CoCl2 ‐induced doxorubicin resistance in breast cancer cells. Cancer Sci. 2015;106(8):1041‐1049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Liu R, Qian M, Zhou T, Cui P. TP53 mediated miR‐3647‐5p prevents progression of cervical carcinoma by targeting AGR2. Cancer Med. 2019;8(13):6095‐6105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Dudekula DB, Panda AC, Grammatikakis I, De S, Abdelmohsen K, Gorospe M. CircInteractome: a web tool for exploring circular RNAs and their interacting proteins and microRNAs. RNA Biol. 2016;13(1):34‐42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNA target sites in mammalian mRNAs. Elife. 2015;4:e05005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Jiao J, Zhang T, Jiao X, et al. hsa_circ_0000745 promotes cervical cancer by increasing cell proliferation, migration, and invasion. J Cell Physiol. 2020;235(2):1287‐1295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Lin L, Li N, Hu X, Sun J, He Y. Identification of circ_0085616 as an upregulated and oncogenic circular RNA in cervical cancer Via the miR‐503‐5p‐Mediated ATXN7L3 activation. Cancer Biother Radiopharm. 2020. doi: 10.1089/cbr.2020.3865 [DOI] [PubMed] [Google Scholar]
- 27. Dong J, Wang M, Ni D, et al. MicroRNA‐217 functions as a tumor suppressor in cervical cancer cells through targeting Rho‐associated protein kinase 1. Oncol Lett. 2018;16(5):5535‐5542. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 28. Yin Z, Ren W. MicroRNA‐217 acts as a tumor suppressor and correlates with the chemoresistance of cervical carcinoma to cisplatin. Onco Targets Ther. 2019;12:759‐771. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 29. Zhu L, Yang S, Wang J. miR‐217 inhibits the migration and invasion of HeLa cells through modulating MAPK1. Int J Mol Med. 2019;44(5):1824‐1832. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 30. Liu C, Wang JO, Zhou WY, et al. Long non‐coding RNA LINC01207 silencing suppresses AGR2 expression to facilitate autophagy and apoptosis of pancreatic cancer cells by sponging miR‐143‐5p. Mol Cell Endocrinol. 2019;493:110424. [DOI] [PubMed] [Google Scholar]
- 31. Gong W, Ekmu B, Wang X, Lu Y, Wan L. AGR2‐induced glucose metabolism facilitated the progression of endometrial carcinoma via enhancing the MUC1/HIF‐1α pathway. Hum Cell. 2020;33(3):790‐800. [DOI] [PubMed] [Google Scholar]
- 32. Li J, Hu J, Luo Z, et al. AGR2 is controlled by DNMT3a‐centered signaling module and mediates tumor resistance to 5‐Aza in colorectal cancer. Exp Cell Res. 2019;385(1):111644. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.