Skip to main content
Physiological Research logoLink to Physiological Research
. 2022 Jan 19;71(1):135–145. doi: 10.33549/physiolres.934747

The Protective Effect of Mangiferin on Osteoarthritis: An In Vitro and In Vivo Study

Yulu WANG 1,2,*, Xinling GUO 3,*, Xiaolong FAN 2, Haidong ZHANG 2, Deting XUE 1,, Zhijun PAN 1,
PMCID: PMC8997682  PMID: 35043648

Summary

Mangiferin is a kind of polyphenol chemical compound separated from these herbal medicines of Mangifera indica L., Anemarrhena asphodeloides Bge. and Belamcanda chinensis L., which has anti-inflammatory, anti-virus, and other physiological activities without toxic effects. Osteoarthritis (OA) is a chronic disease that is also a kind of arthritis disease in which articular cartilage or bones under the joint is damaged. In addition, artificial replacements are required in severe cases. At present, there are not too much researches on the potential biological activities of mangiferin that plays a protective role in the treatment of OA. In this study, we evaluated the protective effect of mangiferin on osteoarthritis (OA) in vitro and in vivo. First, the effect of different concentrations of mangiferin on rat chondrocytes was determined by MTT assay. Second, the effects of mangiferin on the expression levels of matrix metalloproteinase (MMP)-13, TNF﷓α, Collagen II, Caspase-3, and cystatin-C in interleukin-1β (IL-1β)-induced rat chondrocytes were examined by the real-time polymerase chain reaction in vitro, meanwhile the effects of mangiferin on the nuclear factor kappa-B (NF-κB) signaling pathway were also investigated by Western Blot. Finally, the anti-osteoarthritic protective effect of mangiferin was evaluated in the rat model by anterior cruciate ligament transection (ACLT) combined with bilateral ovariectomy-induced OA in vivo. The results showed that the mangiferin was found to inhibit the expression of MMP-13, TNF-α, and Caspase-3 which also increased the expression of Collagen II and cystatin-C in IL-1β-induced rat chondrocytes. In addition, IL-1β-induced activation of nuclear factor kappa-B (NF-κB) and the degradation of inhibitor of κB (IκB)-α were suppressed by mangiferin. For the in vivo study in a rat model of OA, 100 μl of mangiferin was administered by intra-articular injections for rats, the results showed that the cartilage degradation was suppressed by mangiferin through Micro CT and Histological Examination. According to both in vitro and in vivo results, mangiferin has a protective effect in the treatment of OA which may be a promising therapeutic agent for OA.

Keywords: Mangiferin, Osteoarthritis (OA), Cytokines, Gene expression, In vitro, In vivo

Introduction

Nowadays, osteoarthritis (OA) is one of the most frequent chronic diseases which is complex and multifactorial epidemiology, meanwhile, the most important factor initiating and amplifying this disease is the inflammatory response [1]. Interleukin-1 (IL-1) was first described as a monocyte/macrophage product in articular tissue. As a lymphokine, interleukin-1 (IL-1) also could induce the production of collagenase and prostaglandin in synovial fibroblast cultures [2]. Further, Mengshol et al. reported that IL-1 significantly down-regulated the expression of matrix metalloproteinases (MMPs) [3] and caused the degradation of extra-cellular matrix (ECM).

The exact mechanism of OA has not been elucidated [4], which is not yet discovered in the early phase with an effective drug for the treatment of OA. In the clinical, non-steroidal anti-inflammatory drugs (NSAIDs), hyaluronan and corticosteroids have been used in the treatment of OA [5]. However, these drugs could not reverse the cartilage damage, and this disease continues to progress significantly to the stage in which prosthetic replacement is need required. Therefore, there is an urgent need for better therapeutics that can impede cartilage damage so that the later stages of OA can be better treated. In recent years, more researchers are interested in natural herbal compounds, which are regarded as promising remedial agents in immunological disorders that could halt the progression of the disease without any toxicity [6].

Mangiferin is a polyphenol that has been used as a non-prescription drug [7]. However, the anti-inflammatory properties of mangiferin in OA chondrocytes remain unclear [7,8]. However, some studies have revealed that mangiferin dampens the inflammatory response in tumor necrosis factor-alpha (TNF-α)-induced RAW264.7 cells in vitro by inhibiting the activation of the nuclear factor kappa-B (NF-κB) pathway [9]. Therefore, the mangiferin was speculated that could be effective in protecting against OA because of its anti-inflammatory effects. In this study, the mangiferin was proposed that had a protective effect against OA due to it was initiated by the inflammatory response in the early phase.

Methods

Primary rat chondrocytes culture

Rat chondrocytes were prepared by combine digestion with collagenase-neutral protease which was isolated from the Procell laboratory, with a total cell volume of approximately 5×105 cells/bottle (Wuhan Procell Life Technology Co. Ltd, China). The cells were grown and passaged in Dulbecco’s modified Eagle medium which was supplemented with 10 % fetal bovine serum (Gibco BRL, Grand Island, NY, USA) (37 °C, 5 % CO2). Cells from the third generation were used in this study.

Assay of chondrocytes proliferation

Each well was inoculated with 8000 (cells/well) rat chondrocytes in a 96-well plate containing a serum-free medium. The concentrations of 10, 20, 40, 60, 80, and 100 μmol/l mangiferin were added to a 96-well plate and incubated for 24 h (cells were grown to confluence in Dulbecco’s modified Eagle’s medium supplemented with, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37 °C with 5 % CO2). After that, 20 μl of MTT (Sigma Chemical Co, St. Louis, MO, USA) solution (5 mg/ml in serum-free medium for 24 h) were added into the wells and incubated for another 4 h. Next, the culture medium was removed and 150 μl of dimethyl sulfoxide (DMSO) was added into the wells. Finally, the absorbance was measured by a microplate reader at 570 nm [10]. Furthermore, this absorbance determination needed repeat three times. The results were expressed as chondrocytes proliferative index (CPI), which was calculated as the ratio of optical density (OD) of the treatment group to control cells.

CPI=ODtreatment groups/ODcontrol groups

Assay for chondrocytes inducement by IL-1β

Subconfluent cells were serum-starved overnight before the experiments were performed. The final concentrations of 10, 20, and 40 μmol/l of mangiferin were added into the wells after seeding in six-well plates (1×105 cells/well). Then, they were incubated at 37 °C with 5 % CO2 for 1 h. The final concentration of 10 ng/ml of IL-1β was added into each well and continued to culture for 24 h. The cells were harvested and the optimum mangiferin concentration was assessed for subsequent experiments, such as western blot analysis [11,12].

Gene expression analysis (rat chondrocytes inducement by IL-1β)

Total RNA was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA (600 μg), 1 μl dNTPs (10 mM), DEPC-treated water (15 μl), and primer mixture were mixed into a 200 μl RNase-free centrifuge tube. Then the tube was incubated at 70 °C for 5 min after it was incubated on ice. Next, 5× first-strand buffer, 0.1 M dithiothreitol, 25 units of RNase inhibitor, and 200 units of Superscript II reverse transcriptase (Invitrogen) were added into the centrifuge tube. The RNA was reverse-transcribed into cDNA. A quantitative real-time polymerase chain reaction conducted by iCycler system (BioRad, Hercules, CA, USA) and iQ SYBR Green Supermix PCR kit (BioRad) based on sequence information (Table 1) which had been described in our previous study [10]. The relative levels of targeted gene expressions were calculated following the formula:

Table 1.

Real-Time PCR primers and conditions.

Gene GenBank Accession Primer Sequences Size (bp) Annealing (°C)
Rat-18S M11188 5′ GAATTCCCAGTAAGTGCGGGTCATA 3′
5′ CGAGGGCCTCACTAAACCATC 3′
105 62
Rat MMP-13 NM_133530 5′ CAACCCTGTTTACCTACCCACTTAT 3′
5′ CTATGTCTGCCTTAGCTCCTGTC 3′
85 62
Rat-TNF-α NM_012675 5′ GGTCCCAACAAGGAGGAGAAGTTC 3′
5′ CCGCTTGGTGGTTTGCTACGAC 3′
136 64
Rat col II L48440 5′ CTGGTGGAGCAGCAAGAGC 3′
5′ GTGGACAGTAGACGGAGGAAAG 3′
144 64
Rat Caspase3 NM_012922.2 5′ AGAGTTGGAGCACTGTAGCACACA 3′
5′ TCATGTCCACCACTGAAGGATGGT 3′
187 64
Rat cystatin C NM_012837.1 5′ ACTTCGCCGTAAGCGAGTACAACA 3′
5′ TCGGCCCATCTCCACATCCAAATA 3′
128 64
2(Δct18s rRNA-Δcttarget gene)

Western blot analysis

Cytoplasmic protein and nuclear protein from the above samples (normal group, IL-1β-induced group, and mangiferin-treated group) were prepared by nuclear/cytoplasmic Protein Extraction Kit (Signosis, Santa Clara, CA, USA). Membranes were incubated with antibodies (IκB-α, p-IκB-α, NF-κB p65, p-NF-κB p65, β-actin) at 4 °C for overnight after blocking in Tris-buffered saline-Tween. Then, membranes were incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. The membranes were developed using an enhanced chemiluminescence kit (GE Healthcare, Shanghai, China) which was exposed by X-ray films (Kodak, Hangzhou, China) for detecting the proteins [10].

Mangiferin treatment in the induction of OA rats (in vivo)

Twenty-four eight-week-old female Sprague Dawley rats (SPF Biotechnology Co, LTD, Beijing, China) were chosen, which were weighed at 180–230 g. As a result of OA was induced in the left knee joint [13] so that the left knee joint of rats was used as the modeling experiment. The patella and patellar tendon were exposed after the rats were anesthetized by sodium pentobarbital (40 mg/kg), in which the patella was dislocated, and the ACL was cut with sharp scissors. Then, the patella was reset. Six rats were also used as sham-operated controls. All rats were allowed to move freely in the feeding conditions (23±2 °C, the humidity of 40–60 %, 12 h light/dark cycles with food and water).

The animals were removed from the experiment, if the rat’s knee joint was associated with infection or whether the animal died. In this study, all 24 rats met the inclusion criteria. Rats had been divided into group 1 (control group treated with solvent alone, n=6); group 2 (20 μmol/l mangiferin group; n=6); group 3 (40 μmol/l mangiferin group; n=6); and group 4 (sham-operated group, n=6).

In group 2 and 3, rats were injected with 100 μl of mangiferin (20 μmol/l) and intra-articular injections of 100 μl of mangiferin (40 μmol/l) respectively in the left knee once a week for four weeks. Group 1 and 4 were injected with 100 μl of solvent alone in the left knee once per week for six weeks. Rats were sacrificed seven days after the last injection. All rats were sacrificed after they have surged for nine weeks.

Micro-computed tomography (CT) and gross morphology imaging

After surgery for nine weeks, the knee joints of the rats were scanned and imaged by micro-computed tomography (CT) scanner (SkyScan 1174, Bruker, Kontich, Belgium). The femur condyles of the rats from the four groups were harvested after the CT scanning. The gross morphological changes of the femur condyles were assessed in a blind manner: grade 1: intact surface; grade 2: minimal surface fibrillation; grade 3: overt surface fibrillation; grade 4: erosion [14].

Histological examination

Knee joints specimens were fixed in 10 % neutral buffer formalin and then decalcified in EDTA for seven days, after that the knee joints specimens were cut into sections (5 μm) for safranin O-fast green staining and H&E staining. The damage was graded according to the Mankin score system by a blind investigator [1517]. The definition of different damage grades was as follows the Table 2.

Table 2.

The definition of different damage grades.

Grades Modified Mankin score system Cellular abnormalities Matrix staining
0 Normal Normal Normal
1 Surface irregularities Diffuse hypercellularity Slight reduction
2 Pannus and surface irregularities Cloning Moderate reduction
3 Clefts to transitional zone Hypocellularity Severe reduction
4 Clefts to radial zone / No dye note
5 Clefts to calcified zone / /
6 Complete disorganization / /

Statistical analysis

SPSS 16.0 (SPSS Inc., Chicago, IL, USA) was used for data statistical analysis. Data were expressed as the mean ± standard deviation (SD). The data of MTT assay, histological, gross morphological changes, western blot, and gene expression were statistically analyzed by paired t-test, in which p-values less than 0.05 were considered statistically significant.

Results

Effect of mangiferin on the viability proliferation

Rat chondrocytes were initially plated in each well of a 96-well plate and added in different concentrations of mangiferin within 0, 10, 20, 40, 60, 80, 100 μmol/l. The number of viable cells was measured by MTT assay after incubated for 24 h. The results (Fig. 1) showed that the rat chondrocytes were proliferated in three different concentrations of mangiferin (10, 20, 40 μmol/l) groups, among which the concentrations of 10 μmol/l and 40 μmol/l mangiferin presented significant promotions as compared with the control group (0 μmol/l) (p<0.05). Meanwhile, the rat chondrocytes proliferation indexes (60, 80, 100 μmol/l groups) were seriously damaged when the concentration was more than 40 μmol/l, which that means it had toxic effects on rat chondrocytes (p<0.05). Therefore, the concentrations of mangiferin used in the follow-up experiments were 10, 20, and 40 μmol/l.

Fig. 1.

Fig. 1

The effects of mangiferin on chondrocyte proliferation index (CPI) as determined by the MTT assay (n=5). (* p<0.05 compared with the control group).

Gene expression of MMP-13, TNF-α, Col II, caspase-3, and cystatin C

The expression levels of MMP-13, TNF-α, Col II, caspase-3, and cystatin C were measured in rat chondrocytes. The expression of MMP-13, TNF-α, and caspase-3 (Fig. 2c, d, e) was upregulated by stimulation with IL-1β and the expression of Col II and cystatin C (Fig. 2a, b) was downregulated. As predicted, IL-1β-induced an upregulation of MMP-13, TNF-α, and caspase-3, meanwhile the downregulation of Col II and cystatin C gene expression in rat chondrocytes were dramatically inhibited by mangiferin (Fig. 2). As this result show, the highest concentration of mangiferin (40 μmol/l) was used for the western blot experiments.

Fig. 2.

Fig. 2

Effects of mangiferin on gene expression of MMP-13, TNF-α, Caspase-3, Collagen II, and cystatin-C in rat chondrocytes induced by IL-1β (n=3) (* p<0.05 compared with cells stimulated with IL-1β alone).

Analysis mangiferin blocking IL-1β-mediated induction of NF-κB signaling pathway

The results showed that IκB-α and the phosphorylation of IκB-α were reduced significantly by IL-1β in the cytoplasm of chondrocytes (Fig. 3d, e, f), meanwhile, this reduction was significantly blocked by mangiferin. Moreover, phosphorylation of NF-κB p65 was dramatically inhibited by mangiferin (Fig. 3a,c). However, the content of nuclear NF-κB p65 was not significantly affected in the IL-1β group but it was significantly decreased in the mangiferin-treated group (Fig. 3a, b).

Fig. 3.

Fig. 3

Effects of mangiferin on cytoplasmic protein levels of IκB-α and phosphorylation of IκB-α, and nucleoprotein levels of nuclear factor kappa-B p65 (NF-κB p65) and phosphorylation of NF-κB p65 in chondrocytes induced by IL-1β. (n=3) (* p<0.05 compared with cells stimulated with IL-1β alone).

Analysis of cartilage histomorphology

In the control group within solvent only, general characteristics of OA were shown in Figure 4a. In group 2, less bone wear was observed which was compared to the control group, as it was determined by gross appearance (Fig. 4b). In group 3, the macroscopic examination indicated that the cartilage on the femoral condyles was nearly normal, which was shown in Figure 4c. Furthermore, the score in group 3 was lower than the control group (Fig. 4d).

Fig. 4.

Fig. 4

After anterior cruciate ligament transection (ACLT), mangiferin was administered by intra-articular injections of 100 μl to rats per week for 4 weeks. The control group was observed to induce the degradation of articular cartilage (a), and mangiferin inhibited these degenerative changes (20-b, 40-c), and sham group (d). The score was reduced significantly in the group 3 treated by 40 μmol/l compared with the control group (e, * p<0.05).

Meanwhile, the same pattern was observed by micro-CT (Fig. 5). In the control group, the knee joints had a rough and irregular surface at the medial and lateral femur areas (Fig. 5a). In group 2, there was only slight damage to the cartilage surface (Fig. 5b). But in group 3 and sham group, no obvious macroscopic changes were found (Fig. 5c, d).

Fig. 5.

Fig. 5

The images of micro-computed tomography (micro-CT) of the knee joints from the rat models (original magnification is ×100) (control group (a and e), treatment group by 20 μmol/l mangiferin (b and f), treatment group by 40 μmol/l mangiferin (c and g), sham group (d and h).

Histopathological changes in articular cartilage

In the control group, the characteristics of OA were obvious, such as chondrocyte degeneration, depletion, and irregular cartilage surface (Fig. 6a). But well-formed cartilaginous tissues containing cytoplasm and nuclei, and a smooth and regular cartilage surface, which were observed in group 3 (Fig. 6c). However, some erosions were exhibited at the cartilage surface which rats in group 2 (Fig. 6b). There was a normal cartilage matrix in the sham group (Fig. 6h) and the treatment group of the concentration with 40 μmol/l (Fig. 6h) (the cartilage surface was uniform red matrix which in the picture), furthermore, the cartilage matrix was distributed uniformly, the chondrocyte nuclei were arranged neatly, the tide line was neat. Meanwhile, the control group (Fig. 6e) cartilage has degenerated, the cartilage was showed irregularly, there were a large number of cracks, red color was lost staining, cell nucleus was arranged disorderly and showed clustered, the number of nuclei was significantly reduced, and the tide line was disordered. The expression mediation in the mangiferin-treated group (20 μmol/l) was introduced between the control group and the mangiferin-treated group of 40 μmol/l. Moreover, ACLT led to histopathological changes such as the surface depletion and the reduction of Safranin O-fast green-staining in the cartilage (Fig. 6e), and the cartilage degradation was inhibited by the treatment group of mangiferin, which was developed in the progression of OA (Fig. 6f, g). Consistent with these findings, the modified Mankin score was reduced in the mangiferin-treated group as compared with the control group (Fig. 7).

Fig. 6.

Fig. 6

The representative pictures with each staining which the effects of different concentrations of mangiferin on the cartilage in vivo (original magnification is ×100), control group (a, e), treatment group by 20 μmol/l mangiferin (b, f), treatment group by 40 μmol/l mangiferin (c, g), sham group (d, h).

Fig. 7.

Fig. 7

The data of Mankin scores (n=6) (* p<0.01 compared with control group. *# p<0.05 treatment groups comparison between 20 μmol/l and 40 μmol/l).

Discussion

In this study, the effects of mangiferin were progressed on OA which were evaluated in vitro and in vivo. The breakdown of cartilage macromolecules could cause by many biochemical factors such as proteolytic enzymes, MMPs, and cytokines [18,19]. IL-1β was played a critical role in cartilage degradation through the induction of MMPs, especially MMP-13, which was secreted by chondrocytes. Thus, IL-1β had been widely used in in vitro studies to generate a micro environment that mimics that of OA [11,12]. Moreover, MMP-13, a predominant proteinase, had the distinctive ability to cleave Col II, a major component of the ECM in OA. Our study found that the IL-1β-mediated induction of MMP-13 in rat articular chondrocytes which was inhibited by mangiferin (Fig. 2c), this result was consistent with previous studies [20,21].

Previously, Lotz (2001) found that TNF-α could inhibit chondrocyte compensatory biosynthesis pathways. In this study, the TNF-α expression was observed that decreased in the mangiferin-treated groups, especially the group in which was pretreated with the concentration of 40 μmol/l of mangiferin (Fig. 2d). Moreover, as IL-1 was contributed to cartilage degradation through upregulating some cytokines, the inhibition of IL-1 was proposed that in chondrocytes could treat OA. An IL-1 receptor antagonist was shown to inhibit the cleavage of Col II and the release of glycosaminoglycan in the cartilage of OA [13]. Our findings were demonstrated that the mangiferin was reversed the IL-1β-induced decrease in the Col II expression in chondrocytes, which may partly be due to the anti-inflammatory effects of mangiferin (Fig. 2a). These findings suggest that TNF-α, Col II, and MMP influenced and restricted each other at the gene expression level. Thus, the joint cartilage was might be protected by mangiferin with influencing the presence of Col II and maintaining the integrity of cartilage by promoting Col II expression [2225].

The chondrocyte oxidative stress-induced apoptosis was found that its caused by the development of OA, and caspase-3 was a key enzyme in the mechanism of apoptosis [2628]. Gao [29] demonstrated a dramatically enhanced caspase-3 gene expression in H2O2-induced injury of chondrocytes. In this study, the caspase-3 gene expression was decreased by following treatment with mangiferin under IL-1β induction (Fig. 2e), which was suggested that mangiferin could inhibit the progression of OA by caspase-3.

Surprisingly, the cystatin C gene expression was noted that was upregulated in the mangiferin-treated groups (Fig. 2b). In the previous report, cystatin C could block cathepsin activity by forming a reversible enzyme-inhibitor complex to counteract preexisting OA [30]. A low gene expression of cystatin C would likely contribute to OA pathology. Thus, mangiferin might be used in the treatment of OA in the early stage, which still should be further researched.

NF-κB plays a critical role in inducing proinflammatory cytokines [31,32]. Many proinflammatory response genes of the expression are controlled by the transcription factor NF-κB. Our study indicated that mangiferin was inhibited the NF-κB activation in chondrocytes via the inhibition of IκB-α degradation. Both IκB-α and the phosphorylation of IκB-α were reduced by IL-1β in the cytoplasm of chondrocytes which were blocked by treatment with mangiferin (Fig. 3d, e, f). The IL-1β-induced increase in the NF-κB phosphorylation in chondrocyte nuclei was inhibited by the mangiferin (Fig. 3a,b,c). That means, NF-κB was retained in the inactive cytoplasm, but NF-κB was activated by IL-1β and led to the translocation of NF-κB p65 from the cytoplasm to the nucleus. This effect was significantly inhibited by mangiferin. Overall, these results showed that mangiferin could inhibit IL-1β-induced inflammation.

The rat model of OA has been widely used [17,33]. Furthermore, cartilage degradation was induced by ACLT. Our study showed that ACLT in rats caused cartilage degradation due to its mechanical instability. The cartilage degradation (Fig. 4), micro-CT (Fig. 5), and histological evaluation (Figs 6, 7) were inhibited by delivering mangiferin to the joint. These outcomes were similar to the in vitro study, which confirmed the protective effect for OA both in vitro and in vivo.

Conclusions

Mangiferin possesses chondroprotective effects in vitro and in vivo. The CPI of different concentrations of mangiferin was different in the MTT analysis, in which the CPI was significantly increased at the concentration of 10, 20, and 40 μmol/l of mangiferin. The CPIIn IL-1β-induced rat chondrocytes, mangiferin not only inhibited the expression of MMP-13, TNF-α, and caspase-3 but also increased the expression of Col II and cystatin C at the mRNA levels by NF-κB pathway. Through micro-CT and histological examination after in vivo injection for OA model rats, it was found that mangiferin could inhibit the degradation of cartilage. The results had indicated that mangiferin would be a promising agent for the treatment of OA.

Acknowledgements

This study was supported by the Inner Mongolia Provincial Natural Science Foundation of China (2018MS08142). The funders provided financial support for the conduct of this research.

Abbreviations

ACLT

Anterior Cruciate Ligament Transection

Col II

Type II Collagen

CT

Computed Tomography

ECM

Extracellular Matrix

IκB-α

Inhibitor of κB-α

IL-1β

Interleukin-1β

MG

Mangiferin

MMPs

Matrix Metalloproteinases

NF-κB

Nuclear Factor kappa-B

NSAIDs

Non-steroidal Anti-inflammatory Drugs

OA

Osteoarthritis

TNF-α

Tumor Necrosis Factor Alpha

Footnotes

Conflict of Interest

There is no conflict of interest.

References

  • 1.Bonnet CS, Walsh DA. Osteoarthritis, angiogenesis and inflammation. Rheumatology (Oxford) 2005;44:7–16. doi: 10.1093/rheumatology/keh344. [DOI] [PubMed] [Google Scholar]
  • 2.Gowen M, Wood DD, Russell RG. Stimulation of the proliferation of human bone cells in vitro by human monocyte products with interleukin-1 activity. J Clin Invest. 1985;75:1223–1229. doi: 10.1172/JCI111819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Mengshol JA, Vincenti MP, Coon CI, Barchowsky A, Brinckerhoff CE. Interleukin-1 induction of collagenase 3 (matrix metalloproteinase 13) gene expression in chondrocytes requires p38, c-Jun N-terminal kinase, and nuclear factor kappaB: Differential regulation of collagenase 1 and collagenase 3. Arthritis Rheum. 2000;43:801–811. doi: 10.1002/1529-0131(200004)43:4<801::AID-ANR10>3.0.CO;2-4. [DOI] [PubMed] [Google Scholar]
  • 4.Pal R, Chaudhary MJ, Tiwari PC, Babu S, Pant KK. Protective role of theophylline and their interaction with nitric oxide (NO) in adjuvant-induced rheumatoid arthritis in rats. Int Immunopharmacol. 2015;29:854–862. doi: 10.1016/j.intimp.2015.08.031. [DOI] [PubMed] [Google Scholar]
  • 5.Lee SW, Song YS, Shin SH, Kim KT, Park YC, Park BS, Yun I, Kim K, Lee SY, Chung WT, Lee HJ, Yoo YH. Cilostazol protects rat chondrocytes against nitric oxide-induced apoptosis in vitro and prevents cartilage destruction in a rat model of osteoarthritis. Arthritis Rheum. 2008;58:790–00. doi: 10.1002/art.23220. [DOI] [PubMed] [Google Scholar]
  • 6.Rajendran P, Rengarajan T, Nishigaki I, Ekambaram G, Sakthisekaran D. Potent chemopreventive effect of mangiferin on lung carcinogenesis in experimental Swiss albino mice. J Cancer Res Ther. 2014;10:1033–1039. doi: 10.4103/0973-1482.137966. [DOI] [PubMed] [Google Scholar]
  • 7.Rajendran P, Jayakumar T, Nishigaki I, Ekambaram G, Nishigaki Y, Vetriselvi J, Sakthisekaran D. Immunomodulatory effect of mangiferin in experimental animals with benzo(a)pyrene-induced lung carcinogenesis. Int J Biomed Sci. 2013;9:68–74. [PMC free article] [PubMed] [Google Scholar]
  • 8.Li Y, Wu Y, Jiang K, Han W, Zhang J, Xie L, Liu Y, Xiao J, Wang X. Mangiferin prevents TBHP-induced apoptosis and ECM degradation in mouse osteoarthritic chondrocytes via restoring autophagy and ameliorates murine osteoarthritis. Oxid Med Cell Longev. 2019;2019:8783197. doi: 10.1155/2019/8783197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Jang JH, Lee KH, Jung HK, Sim MO, Kim TM, Woo KW, An BK, Cho JH, Cho HW. Anti-inflammatory effects of 6’-O-acetyl mangiferin from Iris rossii Baker via NF-kappab signal blocking in lipopolysaccharide-stimulated RAW 264.7 cells. Chem Biol Interact. 2016;257:54–60. doi: 10.1016/j.cbi.2016.07.029. [DOI] [PubMed] [Google Scholar]
  • 10.Chen WP, Wang YL, Tang JL, Hu PF, Bao JP, Wu LD. Morin inhibits interleukin-1beta-induced nitric oxide and prostaglandin E2 production in human chondrocytes. Int Immunopharmacol. 2012;12:447–452. doi: 10.1016/j.intimp.2011.12.024. [DOI] [PubMed] [Google Scholar]
  • 11.Heinecke LF, Grzanna MW, Au AY, Mochal CA, Rashmir-Raven A, Frondoza CG. Inhibition of cyclooxygenase-2 expression and prostaglandin E2 production in chondrocytes by avocado soybean unsaponifiables and epigallocatechin gallate. Osteoarthritis Cartilage. 2010;18:220–27. doi: 10.1016/j.joca.2009.08.015. [DOI] [PubMed] [Google Scholar]
  • 12.Largo R, Alvarez-Soria MA, Diez-Ortego I, Calvo E, Sanchez-Pernaute O, Egido J, Herrero-Beaumont G. Glucosamine inhibits IL-1beta-induced NFkappaB activation in human osteoarthritic chondrocytes. Osteoarthritis Cartilage. 2003;11:290–98. doi: 10.1016/s1063-4584(03)00028-1. [DOI] [PubMed] [Google Scholar]
  • 13.Hayami T, Pickarski M, Zhuo Y, Wesolowski GA, Rodan GA, Duong LT. Characterization of articular cartilage and subchondral bone changes in the rat anterior cruciate ligament transection and meniscectomized models of osteoarthritis. Bone. 2006;38:234–243. doi: 10.1016/j.bone.2005.08.007. [DOI] [PubMed] [Google Scholar]
  • 14.Shikhman AR, Amiel D, D’Lima D, Hwang SB, Hu C, Xu A, Hashimoto S, Kobayashi K, Sasho T, Lotz MK. Chondroprotective activity of N-acetylglucosamine in rabbits with experimental osteoarthritis. Ann Rheum Dis. 2005;64:89–94. doi: 10.1136/ard.2003.019406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Oegema TR, Jr, Deloria LB, Sandy JD, Hart DA. Effect of oral glucosamine on cartilage and meniscus in normal and chymopapain-injected knees of young rabbits. Arthritis Rheum. 2002;46:2495–2503. doi: 10.1002/art.10499. [DOI] [PubMed] [Google Scholar]
  • 16.Tang T, Muneta T, Ju YJ, Nimura A, Miyazaki K, Masuda H, Mochizuki T, Sekiya I. Serum keratan sulfate transiently increases in the early stage of osteoarthritis during strenuous running of rats: Protective effect of intraarticular hyaluronan injection. Arthritis Res Ther. 2008;10:R13. doi: 10.1186/ar2363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Naito K, Watari T, Furuhata A, Yomogida S, Sakamoto K, Kurosawa H, Kaneko K, Nagaoka I. Evaluation of the effect of glucosamine on an experimental rat osteoarthritis model. Life Sci. 2010;86:538–543. doi: 10.1016/j.lfs.2010.02.015. [DOI] [PubMed] [Google Scholar]
  • 18.Stevens AL, Wishnok JS, White FM, Grodzinsky AJ, Tannenbaum SR. Mechanical injury and cytokines cause loss of cartilage integrity and upregulate proteins associated with catabolism, immunity, inflammation, and repair. Mol Cell Proteomics. 2009;8:1475–1489. doi: 10.1074/mcp.M800181-MCP200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lotz M. Cytokines in cartilage injury and repair. Clin Orthop Relat Res. 2001;(391 Suppl):S108–S115. doi: 10.1097/00003086-200110001-00011. [DOI] [PubMed] [Google Scholar]
  • 20.Tetlow LC, Adlam DJ, Woolley DE. Matrix metalloproteinase and proinflammatory cytokine production by chondrocytes of human osteoarthritic cartilage: associations with degenerative changes. Arthritis Rheum. 2001;44:585–594. doi: 10.1002/1529-0131(200103)44:3<585::AID-ANR107>3.0.CO;2-C. [DOI] [PubMed] [Google Scholar]
  • 21.Pelletier JP, Roughley PJ, DiBattista JA, McCollum R, Martel-Pelletier J. Are cytokines involved in osteoarthritic pathophysiology? Semin Arthritis Rheum. 2001;44:585–594. doi: 10.1002/1529-0131(200103)44:3<585::AID-ANR107>3.0.CO;2-C. [DOI] [PubMed] [Google Scholar]
  • 22.Naito K, Takahashi M, Kushida K, Suzuki M, Ohishi T, Miura M, Inoue T, Nagano A. Measurement of matrix metalloproteinases (MMPs) and tissue inhibitor of metalloproteinases-1 (TIMP-1) in patients with knee osteoarthritis: comparison with generalized osteoarthritis. Rheumatology (Oxford) 1991;20:12–25. doi: 10.1016/0049-0172(91)90024-t. [DOI] [PubMed] [Google Scholar]
  • 23.Murphy G, Knauper V, Atkinson S, Butler G, English W, Hutton M, Stracke J, Clark I. Matrix metalloproteinases in arthritic disease. Arthritis Res. 2002;4(Suppl 3):S39–S49. doi: 10.1186/ar572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Knauper V, Bailey L, Worley JR, Soloway P, Patterson ML, Murphy G. Cellular activation of proMMP-13 by MT1-MMP depends on the C-terminal domain of MMP-13. FEBS Lett. 2002;532:127–130. doi: 10.1016/s0014-5793(02)03654-2. [DOI] [PubMed] [Google Scholar]
  • 25.Wang XX, Cai L. Expression level of proteoglycan, collagen and type II collagen in osteoarthritis rat model is promoted and degradation of cartilage is prevented by glucosamine methyl ester. Eur Rev Med Pharmacol Sci. 2018;22:3609–3616. doi: 10.26355/eurrev_201806_15188. [DOI] [PubMed] [Google Scholar]
  • 26.Sun J, Wei X, Lu Y, Cui M, Li F, Lu J, Liu Y, Zhang X. Glutaredoxin 1 (GRX1) inhibits oxidative stress and apoptosis of chondrocytes by regulating CREB/HO-1 in osteoarthritis. Mol Immunol. 2017;90:211–218. doi: 10.1016/j.molimm.2017.08.006. [DOI] [PubMed] [Google Scholar]
  • 27.Pan Y, Chen D, Lu Q, Liu L, Li X, Li Z. Baicalin prevents the apoptosis of endplate chondrocytes by inhibiting the oxidative stress induced by H2O2. Mol Med Rep. 2017;16:2985–2991. doi: 10.3892/mmr.2017.6904. [DOI] [PubMed] [Google Scholar]
  • 28.Sakata S, Hayashi S, Fujishiro T, Kawakita K, Kanzaki N, Hashimoto S, Iwasa K, Chinzei N, Kihara S, Haneda M, Ueha T, Nishiyama T, Kuroda R, Kurosaka M. Oxidative stress-induced apoptosis and matrix loss of chondrocytes is inhibited by eicosapentaenoic acid. J Orthop Res. 2015;33:359–365. doi: 10.1002/jor.22767. [DOI] [PubMed] [Google Scholar]
  • 29.Gao G, Ding H, Zhuang C, Fan W. Effects of hesperidin on H(2)O(2)-treated chondrocytes and cartilage in a rat osteoarthritis model. Med Sci Monit. 2018;24:9177–9186. doi: 10.12659/MSM.913726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lecaille F, Bromme D, Lalmanach G. Biochemical properties and regulation of cathepsin K activity. Biochimie. 2008b;90:208–226. doi: 10.1016/j.biochi.2007.08.011. [DOI] [PubMed] [Google Scholar]
  • 31.Yan C, Boyd DD. Regulation of matrix metalloproteinase gene expression. J Cell Physiol. 2018;22:3609–3616. doi: 10.26355/eurrev_201806_15188. [DOI] [PubMed] [Google Scholar]
  • 32.Ahn KS, Aggarwal BB. Transcription factor NF-kappaB: a sensor for smoke and stress signals. Ann N Y Acad Sci. 2005;1056:218–233. doi: 10.1196/annals.1352.026. [DOI] [PubMed] [Google Scholar]
  • 33.Kim JE, Song DH, Kim SH, Jung Y, Kim SJ. Development and characterization of various osteoarthritis models for tissue engineering. PLoS One. 2018;13:e0194288. doi: 10.1371/journal.pone.0194288. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Physiological Research are provided here courtesy of Institute of Physiology, Czech Academy of Sciences

RESOURCES