Skip to main content
NCBI home page
ACS Pharmacology & Translational Science logoLink to ACS Pharmacology & Translational Science
. 2022 Mar 9;5(4):216–225. doi: 10.1021/acsptsci.1c00207

Canagliflozin and Dapagliflozin Attenuate Glucolipotoxicity-Induced Oxidative Stress and Apoptosis in Cardiomyocytes via Inhibition of Sodium-Glucose Cotransporter-1

Deepika Dasari †, Audesh Bhat ‡, Sureshbabu Mangali †, Trupti Ghatage †, Ganesh Panditrao Lahane, Dharmarajan Sriram †, Arti Dhar †,*
PMCID: PMC9003386  PMID: 35434529

Abstract

graphic file with name pt1c00207_0010.jpg

Sodium-dependent glucose cotransporter 2 inhibitors (SGLT2) are recently approved drugs for the treatment of diabetes that regulate blood glucose levels by inhibiting reabsorption of glucose and sodium in the proximal tubules of the kidney. SGLT2 inhibitors have also shown cardiovascular (CV) benefits in diabetic patients. However, the therapeutic efficacy of SGLT2 inhibitors with respect to CV disease needs further investigation. Thus, the aim of the present study was to examine the effects of SGLT2 inhibitors, canagliflozin (CANA) and dapagliflozin (DAPA) in vitro under glucolipotoxic condition by treating cultured cardiomyocytes (H9C2) with high glucose (HG) and high lipid, palmitic acid (PA), to investigate whether inhibition of sodium glucose cotransporter could prevent any harmful effects of glucolipotoxicity in these cells. SGLT1 expression was measured by immunofluorescence staining and quantitative polymerase chain reaction. Oxidative stress and apoptosis were measured by flow cytometry. Hypertrophy was measured by hematoxylin and eosin (H&E) and crystal violet staining. A significant increase in SGLT1 expression was observed in HG- and PA-treated cardiomyocytes. Also, a significant increase in reactive oxygen species generation and apoptosis was observed in HG+PA-treated cultured cardiomyocytes. HG- and PA-treated cardiomyocytes developed significant structural alterations. All these effects of HG and PA were attenuated by CANA and DAPA. In conclusion, our study demonstrates upregulation of SGLT1 induces oxidative stress and apoptosis in cultured cardiomyocytes. Thus, inhibition of SGLT1 may be used as a possible approach for the treatment of CVD in diabetic patients.

Keywords: SGLT1, canagliflozin, dapagliflozin, cardiomyocytes, apoptosis, ROS

Diabetes and associated cardiovascular (CV) complications are health problems of epidemic proportion worldwide. Diabetic individuals manifest a 2- to 3-fold greater risk of CV events compared with counterparts without diabetes.1−4 In the majority of the cases of diabetes and heart diseases, the defects lie in glucose and energy homeostasis.5 Sodium-glucose cotransporter 1 (SGLT1) is a member of the sodium-dependent glucose cotransporter protein family, joined by SGLT-2, -3, -4, and -5 respectively.6,7. The two most well-known members of the SGLT family are SGLT1 and SGLT2, which are members of the SLC5A gene family.6,7 Lately, considerable attention has been focused on SGLT2, which is responsible for most of the glucose reabsorption in the kidney. Likewise, SGLT1 expression has been reported in the heart of many species, and increased expression of SGLT1 is reported in diabetes mellitus and myocardial ischemia.8,9 SGLT1 transporter plays a key role in the translocation of sugar across epithelial cells in the small intestine and the renal proximal tubule.10,11 Apart from the intestine, notable SGLT-1 expression has been detected in liver and lung tissues, and a lesser expression is detected in the trachea and bronchi.10 Recent studies have reported expression of SGLT1 in the human heart mainly localized to the sarcolemma of the cardiac myocyte as well as heart capillaries and increased expression of SGLT1 is reported under diabetic conditions.13,14 It has also been reported recently that chronic pressure overload induces cardiac hypertrophy and fibrosis in mice via increased SGLT1 and interleukin-18 gene expression. Chronic pressure overload also increased the cardiac gene expression of atrial natriuretic peptide, B-type natriuretic peptide, and collagen type 1.15 Subsequently, overexpression of SGLT-2 has been observed in prostate, pancreas, and brain tumors, leaving SGLT-2 inhibitors as possible therapeutic agents to treat these cancers.16 SGLT2 inhibitors are the recently approved drugs canagliflozin (CANA, Invocana), being the first approved drug in 2013 for the treatment of diabetes mellitus, and dapagliflozin (DAPA), approved in 2021 by the US FDA for use in chronic kidney disease patients to reduce the risk of adverse kidney and CVD outcomes (Figure 1). SGLT2 inhibitors function by increasing urinary excretion of glucose and have very less risk of induction of hypoglycemia.17

Figure 1.

Figure 1

Open in a new tab

Chemical structures of CANA (a) and DAPA (b).

Some of the recent studies have reported the cardioprotective effect of SGLT2 inhibitors in preclinical as well as clinical studies.18,19 CANA and DAPA, two recently approved SGLT2 inhibitors for the treatment of type 2 diabetes, have shown beneficial effects on the heart and reduction in the occurrence of CVD in patients in clinical trials, suggesting the cardiovascular-protective effect of SGLT2 inhibitors.20,21 Recently, Lim et al. reported that CANA attenuates myocardial infarction in the Zucker diabetic fatty rat and nondiabetic Zucker lean rat by upregulation of cardiac pro-survival pathway.22 DAPA is reported to reduce intracellular calcium overload thereby reducing ROS production in the diabetic model of cardiomyopathy.23 However, to the best of our knowledge, the direct effect of CANA and DAPA in cultured cardiomyocytes which predominantly express SGLT1 and the comparison between the effects of two SGLT2 inhibitors has not been explored until now. The present study aimed to investigate the effect of CANA and DAPA in cultured cardiomyocytes under glucolipotoxic conditions and the underlying molecular mechanism.

Materials and Methods

Chemicals

CANA and DAPA were purchased from Sigma-Aldrich (Sigma-Aldrich, St. Louis, MO). Primary antibodies for SGLT1 were procured from Novus Biologicals (Centennial, CO), while caspase-3 and B-actin antibodies as well as secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). DMEM (AL219A), BSA (TC348), trypsin (TCL007), and MTT (TC191) were purchased from Himedia. FBS (10270–106) was purchased from Gibco. Sodium Palmitate (P9767), 2′,7′-dichlorofluorescin diacetate (D6883), 4′,6-diamidino-2-phenylindole (DAPI), and N-acetyl cysteine (NAC) (A9165) were purchased from Sigma-Aldrich. TB Green Premix Ex TaqII (RR820A), PrimeScript RT reagent (RR037A), and RNAiso plus (9109) were purchased from Takara. 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG, N13195) was purchased from Invitrogen (Thermo Fischer Scientific, USA). TACS Annexin V-FITC Apoptosis Detection Kit (4830-250-K) was purchased from R&D Systems.

Cell Culture

H9C2 cells (rat cardiomyocyte cell line) were obtained from NCCS (Pune, India) and were cultured on T25 flasks and coverslips using Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin antibiotic solution. Cultures were maintained in a humidified atmosphere of 95% air and 5% CO2 at 37 °C. In vitro studies were done in rat H9C2 cardiomyocytes; glucolipotoxicity (GLP) was induced by exposing the cardiomyocytes with high glucose (HG, 25 mM) and palmitic acid (PA, 500 μM) in the presence or absence of CANA and DAPA.22 The concentrations of glucose and palmitic acid used were based on our previous studies with the same molecules.23−25

Preparation of Sodium Palmitate Solution by Saponification and Complexation with 2% BSA

PA was dissolved in a small volume of ethanol, and then saponification was carried out to convert it into a sodium salt of palmitate solution by addition of 10 mM NaOH. The sodium palmitate solution was conjugated with 2% BSA in incomplete DMEM media in a ratio of 2:1 at 55 °C in a shaking water bath for overnight incubation. The palmitate solution was stored at −20 C for further use.24

Treatment

Cultured H9C2 cardiomyocytes were treated with palmitate (500 μM) and HG (25 mM) and SGLT2 inhibitors, CANA and DAPA (10 μM) for 0, 3, 6, 12, 24, 48, and 72 h, respectively. The selected concentrations used are based on our previous studies with sample molecules and MTT assay.24,25

MTT Assay

H9C2 cells grown in complete DMEM were trypsinized, and 1 × 106 cells were seeded in a 96-well plate. After 24 h, these cells were fasted with 1% FBS overnight and treated with HG (25 mM), sodium palmitate (500 μM) with or without 10 μM CANA and DAPA for 24 h in 2% FBS media. After the treatment schedule, the supernatant was removed, and cells were incubated with 100 μL of MTT (0.5 mg/mL) solution in PBS for 4 h. The resultant formazan crystals were solubilized in DMSO and absorbance was read at 570 nm against blank.26

Immunofluorescence and Confocal Microscopy

Briefly, H9C2 cardiomyocytes were grown in confocal dishes, after treatment cultured cells were fixed with 4% paraformaldehyde at room temperature for 15 min, and permeabilized with 0.1% Triton X-100 for 5 min, then followed by blocking with 3% bovine serum albumin (BSA) for 1 h. Thereafter, cells were incubated overnight with primary antibody (1:200) at 4°c followed by incubation with Texas red conjugated secondary antibody (1:500) for 1 h at room temperature and counterstained with 6-diamidino-2-phenylindole (DAPI). Cells were observed under confocal laser-scanning microscopy (Leica DMi8 confocal microscope, Germany).24

Quantitative Polymerase Chain Reaction (qPCR)

Briefly, H9C2 cells were cultured in a 6-well plate, and after reaching subconfluence and fasting overnight, treatments were given. After the treatment schedule RNA was isolated and converted to cDNA according to the manufacturer’s protocol (Biorad, USA). A real-time polymerase chain reaction (PCR) was carried out as mentioned previously.24 The forward and reverse primer sequences were as follows:

SGLT-1 Forward: GTGTACGGATCAGGTCATTGT, SGLT1: Reverse CCATGAGGAACATAGGCAGTAG

SGLT-2: Forward GTAGAGGAAGGCTCTGAACTTG, SGLT2: Reverse ACCAATGACCAGCAGGAAATA

Catalase Forward: CATGGATCTGCTTAGGACTTCTG, Catalase Reverse: CCAGGCTGTGAGGTAACATAA.

Measurement of Reactive Oxygen Species (ROS)

Accumulation of intracellular peroxynitrite, hydrogen peroxide, and free radicals were determined by flow cytometry. Briefly, after treatment cells were incubated with nonfluorescent probe 2,7′-dichlorofluorescein diacetate (CM-H2DCFDA) (5 μmol/L) and kept in the incubator for 30 min maintained at 37 °C. The cells were trypsinized, washed twice with PBS, and resuspended in PBS. The fluorescent intensity of DCF was measured using flow cytometer ((BD FACSAria III).24

Annexin V/fluorescein Isothiocyanate (FITC)/Propidium Iodide (PI) Staining

Annexin V and PI double staining was carried out to differentiate the normal cells from apoptotic cells. Cultured H9C2 cells were incubated alone or in combination with different treatment groups for 24 h, cells were trypsinized and harvested under cool conditions. The pellet was resuspended in 95 μL of annexin binding buffer. Five μL of FITC annexin V and 10 μL of the 100 μg/mL PI working solution were added to each 95 μL of cell suspension and incubated them at room temperature for 30 min. The final sample mixtures were immediately transferred onto the ice. Apoptotic cell percentage was analyzed by using BD imaging flow cytometer ((BD FACSAria III).24

Glucose Uptake Assay

Briefly, treated H9C2 cardiomyocytes were incubated with 100 μM 2-NBDG for 1 h and stimulated with or without 100 nm insulin for 10 min. Furthermore, cells were washed with PBS, and the glucose uptake was measured by the relative fluorescent intensity of live cell images captured by fluorescent microscope (Leica DMi8 Germany) using 488 nm laser.27

Hematoxylin and Eosin (H&E) Staining

After the treatment schedule, cells were fixed with ice-cold methanol for 10 min and stained with Mayer’s hematoxylin for 5 min followed by a quick acid alcohol wash to remove excess stain and a PBS wash, as a bluing step, then stained with eosin for 30 s. Later cells were washed with 2 changes of 95% alcohol and observed for changes in the shape of the nucleus and cytoplasm under a microscope.24,25

Crystal Violet Staining

Treated cardiomyocytes were fixed with ice-cold methanol for 10 min and stained with 0.2% crystal violet solution (in 20–25% methanol) for 10 min. Furthermore, cells were washed with 4–5 changes of double-distilled H2O and dried. Images were captured using OLYMPUS IX53 microscope.28

Statistical Analysis

Data obtained from separate experiments are expressed as mean ± SEM. Statistical analysis was performed using ANOVA followed by post hoc Bonferroni’s test. A P-value of less than 0.05 was considered to be statistically significant.

Results

Glucolipotoxicity associated with diabetes is one of the leading causes of CV complications. We have also reported previously high glucose as well as high lipid mediated oxidative stress and apoptosis under in vitro as well as in vivo conditions.24,25 SGLT1 is the main sodium-dependent glucose transporter expressed in the heart. Increased expression of SGLT1 has been reported in various CVDs.8,13,14 Although the therapeutic efficacy of SGLT2 inhibitors as antidiabetic agents is well-established,29,30 very limited information is available about their cardioprotective effect and the possible molecular mechanism. In the present study, the effect of glucolipotoxicity in vitro in cultured H9C2 cardiomyocytes was investigated using two SGLT2 inhibitors, CANA and DAPA.

Concentration and Time-Dependent Effect of CANA and DAPA on Cell Viability in Cultured H9C2 Cardiomyocytes

To investigate the effect of CANA and DAPA on the viability of cardiomyocytes, H9C2 cardiomyocytes were treated with different concentrations of CANA and DAPA. At a 10 μM concentration of CANA and DAPA, 80% of the cells were viable. However, at 30 μM, only 55% of the cells were viable with CANA, and 75% of cells were viable with DAPA. Since 10 μM concentration was clinically relevant, as the peak plasma concentration of canagliflozin and DAPA is ≈1–10 μM after administration in patients as well as in healthy individuals.31 We chose 10 μM concentrations of CANA and DAPA for all other experiments (Figure 2)

Figure 2.

Figure 2

Open in a new tab

Concentration-dependent effect of CANA and DAPA on the viability of cultured cardiomyocytes. Cultured rat cardiomyocyte H9C2 cells were incubated with normal culture medium (control, Con) or medium containing high glucose (25 mM) for 24 h. CANA (0.3, 1, 3, 10, and 30 μM) and DAPA (0.3, 1, 3, 10, and 30 μM) were incubated alone or with HG for 24 h. Cytotoxicity (A) and cell viability (B) were measured by the MTT assay kit. n = 5 for each treatment. *, P < 0.05 vs respective control (Con) group.

Time-Dependent Effect of Glucotoxicity on SGLT1 Expression in H9C2 Cultured Cardiomyocytes

Glucolipotoxicity induces SGLT1 expression in cultured rat H9C2 cardiomyocytes: We checked whether glucolipotoxicity was able to activate SGLT1 in rat H9C2 cardiomyocytes. H9C2 cells were incubated with HG (25 mM) and PA (500 μM) for 3, 6, 12, and 24 h. The group which received HG and PA together showed a significant increase in SGLT1 expression compared to the control as well as HG and PA alone group (Figure 3A,B). Significant increase in mRNA expression was also observed in HG+PA-treated cells at 24, 48, and 72 h time points (Figure 3C). Moreover, when the cultured H9C2 cells were coincubated with either CANA or DAPA in the presence of HG and PA, there was a significant decrease in mRNA (Figure 3C) as well as SGLT1 immunofluorescence expression (Figure 4A,B). SGLT2 expression was quantified in cultured cardiomyocytes after incubation with HG (25 mM) and PA (500 μM) for different time points (Figure 3D). However, no SGLT2 expression was detected in control as well as cells incubated with HG + PA and in the presence of CANA and DAPA (Figure 3D).

Figure 3.

Figure 3

Open in a new tab

Time-dependent expression of SGLT1 and SGLT2 in cultured H9C2 cardiomyocytes: Cultured rat H9C2 cardiomyocyte cells were incubated with normal culture medium (control, Con) or medium containing HG (25 mM) or PA (500 μM) (A) for 3, 6, 12, and 24 h. SGLT1 expression was measured by immunofluorescence staining. n = 5 for each treatment. (B) $$, P < 0.01 vs respective control (Con) at 3 h; #, P < 0.05 vs respective control at 6 h; %, P < 0.05 vs respective control at 12 h; *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs respective control at 24 h. Cultured rat H9C2 cardiomyocyte cells were incubated with normal culture medium (control, Con) or medium containing HG (25 mM) and PA (500 μM) (C) for 24, 48, and 72 h. SGLT1 and SGLT2 expression was measured by RT-PCR. n = 5 for each treatment. (C, D) *, P < 0.05 vs respective control (Con); $, P < 0.05; #, P < 0.05 vs respective HG+PA at 24, 48, and 72 h time point.

Figure 4.

Figure 4

Open in a new tab

Glucolipotoxicity induces SGLT1 expression in rat H9C2: Cultured H9C2 cardiomyocytes were treated with HG (25 mM) and PA (500 μM) (A) for 24 h. CANA and DAPA (10 μM) were incubated alone or with HG and PA for 24 h. SGLT1 expression was determined by immunofluorescence staining (A, B). n = 5 for each treatment. **, P < 0.01 vs respective control. $, P < 0.05; #, P < 0.05 vs HG+PA group.

Effect of SGLT1 Inhibition on Reactive Oxygen Species Production

We investigated the effect of glucolipotoxicity on ROS generation using FACS analysis. Treatment of cultured H9C2 cells with PA (500 μM) and HG (25 mM) for 24 h significantly increased reactive oxygen species generation, which was significantly attenuated by CANA (10 μM), DAPA (10 μM), and NAC (600 μM) coincubated with HG and PA (Figure 5A,B). Additionally, we measured the mRNA expression of catalase where CANA and DAPA treatments significantly increased the expression of antioxidant enzyme which alleviates the ROS. (Figure 5C).

Figure 5.

Figure 5

Open in a new tab

Effect of SGLT1 inhibition on oxidative stress: Cultured H9C2 cardiomyocytes were treated with HG (25 mM) and PA (500 μM) (A, B) for 24 h. CANA, DAPA (10 μM), and NAC (600 μM) were incubated alone or with HG and PA for3 h. ROS production was measured by FACS analysis using DCFDA (A, B), *, P < 0.05 vs respective control. $$, P < 0.01; #,P < 0.05 vs HG+PA group. (C) mRNA expression of catalase was measured in cultured cardiomyocytes incubated with HG+PA along with CANA, DAPA (10 μM) where * denotes P < 0.05 vs respective HG+PA. Data is expressed as the mean ± SD of at least three separate experiments.

SGLT1 Inhibition Protects the Glucolipotoxicity Induced Apoptosis and Morphological Changes in Rat H9C2 Cardiomyocytes

We examined by FACS analysis whether the inhibition of SGLT1 protects cells from the HG- and PA-induced apoptosis. In our findings, in the HG (25 mM) and PA (500 μM) group, the percentage of live cells were significantly decreased (40%), apoptotic and necrotic cells significantly increased compared to the control group, while the percentage of live cells were increased and apoptotic/necrotic cells significantly decreased in HG+PA-treated cells coincubated with CANA, DAPA (10 μM), and NAC (600 μM) (Figure 6A,B). We also checked caspase-3 expression (Figure 7) using immunofluorescence staining, which was significantly increased in HG+PA-treated group compared to the control, whereas this decreased HG+PA cells coincubated with CANA and DAPA. We also examined structural changes in H9C2 cardiomyocytes in HG+PA-treated cells. Histology of H9C2 cardiomyocytes was observed by H and E and crystal violet staining (Figure 8). In the control group we observed that there was well-established morphology and well-defined nucleus whereas, in HG+PA, we observed the cells with morphological change and polymorphous nucleus. In HG+PA-treated cells coincubated with CANA and DAPA, morphology was preserved.

Figure 6.

Figure 6

Open in a new tab

SGLT1 inhibition protects glucolipotoxicity induced apoptosis in rat H9C2 cardiomyocytes: Cultured H9C2 cardiomyocytes were treated with HG (25 mM) and PA (500 μM) (A, B) for 24 h. CANA, DAPA (10 μM), and NAC (600 μM) were incubated alone or with HG and PA for 24 h. Apoptosis was measured by FACS analysis using Annexin-IV assay kit (A, B). n = 4 for each group. **, P < 0.01; $, P < 0.05; #, P < 0.05; %, P < 0.05 vs respective control (Con). +++, P < 0.001; +2, P < 0.01; +, P < 0.05; @, P < 0.05 vs HG+PA group.

Figure 7.

Figure 7

Open in a new tab

SGLT1 inhibition protects glucolipotoxicity induced apoptosis in rat H9C2 cardiomyocytes: Cultured H9C2 cardiomyocytes were treated with HG (25 mM) and PA (500 μM) (A, B) for 24 h. CANA and DAPA (10 μM) were incubated alone or with HG and PA for 24 h. Caspase-3 expression was determined by immunofluorescence staining (A,B). **, P < 0.01 vs respective control; $, P < 0.05; #, P < 0.05 vs HG+PA group. Data is expressed as mean ± SD of at least three separate experiments.

Figure 8.

Figure 8

Open in a new tab

SGLT1 inhibition protects glucolipotoxicity-induced structural changes in rat H9C2 cardiomyocytes: Hematoxylin and eosin and crystal violet staining was performed for assessment of cellular hypertrophy. Cellular hypertrophy/growth has been observed in cultured cardiomyocytes incubated with HG and PA for 24 h. Both CANA and DAPA (A, B) were able to reverse the structural changes induced by HG and PA (A, B).

Effect of SGLT1 inhibition on insulin-stimulated glucose uptake in H9C2 cells

Impaired glucose uptake was observed in HG- and PA-treated H9C2 cultured cardiomyocytes. HG (25 mM) and PA (500 μM) treatment for 24 h caused a significant reduction in insulin-stimulated glucose uptake in H9C2 cultured cardiomyocyte cells (Figure 9). Both CANA and DAPA cotreatment with HG+PA caused a further reduction in insulin-stimulated glucose uptake.

Figure 9.

Figure 9

Open in a new tab

Effect of SGLT1 inhibition on glucose uptake: Cultured H9C2 cardiomyocytes were treated with HG (25 mM) and PA (500 μM) (A, B) for 24 h. Cells were stimulated with insulin (100 nM) for 10 min. CANA and DAPA (10 μM) were incubated alone or with HG and PA for 24 h. Glucose uptake was measured by immunofluorescence staining. (A, B) **, P < 0.05 vs respective control. $, P < 0.05; #, P < 0.05 vs HG+PA group. Data is expressed as mean ± SD of at least three separate experiments.

Discussion and Conclusion

Diabetes-associated CVDs are major health problems globally. Understanding the fundamental cellular mechanisms may contribute to the discovery and development of novel drug molecules for the treatment of metabolic disorders. SGLT2 inhibitors are novel antihyperglycemic agents approved for diabetes treatment.29−33 Their protective effect concerning CVD and the underlying molecular mechanism is still under investigation.34−36 The susceptibility of SGLT1- and SGLT2-expressing cells to glucose have consequences for many SGLT-expressing cell types, including cardiomyocytes, endothelial cells, and pancreatic β-cells.10,13,37 Although several studies are exploring the effect of high glucose and high lipids in cardiomyocytes,24,25 not much information is available under the conditions of glucolipotoxicity. In the present study, we have investigated the therapeutic efficacy of two SGLT2 inhibitors, CANA and DAPA in glucolipotoxicity-induced increased SGLT1 expression, oxidative damage, and apoptosis in cultured H9C2 cardiomyocytes. SGLT1 transporter plays a key role in the translocation of sugar across epithelial cells in the small intestine and the renal proximal tubule.10,13,14 Recent studies have reported expression of SGLT1 in the human heart mainly localized to the cardiac myocyte sarcolemma as well as heart capillaries, and increased expression is observed under diabetic conditions.15,16 SGLT1 expression is reported to be upregulated 2- to 3-fold in type 2 diabetes mellitus and myocardial ischemia.8 Second, knockdown of SGLT1 in the heart has been reported to prevent glycogen storage cardiomyopathy associated with mutation of gene gamma2 subunit of AMPK in a mouse model.9 Furthermore, epidermal growth factor (EGF) that is involved in cell growth, proliferation, and differentiation is reported to be implicated in blood pressure regulation, endothelial dysfunction, neo-intimal hyperplasia, atherogenesis, and cardiac remodeling as well as cardiac hypertrophy. EGF is reported to cause upregulation of glucose absorption via increased SGLT-1 in rabbit jejunal brush-border membrane and differentiated Caco-2 cells.38 First, we determined the concentration-dependent effect of CANA and DAPA on cell proliferation in normal cardiomyocytes (Figure 2), and on the basis of the cell viability at different concentrations of DAPA and CANA, a 10 μM concentration was chosen for further experiments. In the present study, we report increased SGLT1 expression in cultured cardiomyocytes (Figure 3) after exposure to HG and PA in a time-dependent manner with a significant increase at 24, 48, and 72 h. SGLT1 expression was attenuated by both CANA and DAPA (Figure 3C and 4) with CANA showing slightly more inhibitory effect compared to DAPA (Figure 3C). We also measured SGLT2 mRNA expression in cultured cardiomyocytes. However, no expression of SGLT2 was detected in control as well as in HG and PA and inhibitor treated cultured cardiomyocytes (Figure 3D). On the basis of these findings, effect of CANA and DAPA is mainly via inhibition of SGLT1 in cardiomyocytes.

In FACS analysis, we found that inhibition of SGLT1 significantly reduced the increased generation of ROS in HG- and PA-treated cultured cardiomyocytes, which was comparable with the known antioxidant NAC. Similarly, the mRNA expression of antioxidant enzyme catalase also significantly increased, revealing that the protective effect of CANA and DAPA was greatly through the antioxidant effect (Figure 5). Numerous studies have shown that high glucose and high fat are known inducers of oxidative stress. Oxidative stress is a contributing factor for numerous diabetes-associated CVD complications.39,40 In PA-treated pancreatic beta-cells inhibition of ROS is associated with reduced ER stress and apoptosis.41 Oxidative stress can also induce inflammatory responses by activation MAP as well as of NF-κB signaling pathways,42,43 and increased inducible nitric oxide synthase expression has been reported in diabetic rat heart.44 Hence by inhibiting ROS, CANA and DAPA might be protecting the diabetic heart.

Previous studies including ours have shown that saturated fatty acids and high glucose induce apoptosis in different cells and are associated with the development of various diseases, such as hypertension, diabetes, and atherosclerosis.45,46 Cardiomyocyte apoptosis and death are important factors that lead to patient morbidity and mortality, thus targeting the apoptotic signaling pathway can be one of the possible strategies which can be explored for therapeutic drug targeting.47,48 To know whether SGLT1 inhibition prevents HG- and PA-induced apoptosis, we determined apoptosis by FACS analysis (Figure 6) and caspase-3 expression by immunofluorescence (Figure 7), we observed that inhibition of SGLT1 prevents apoptosis. It has also been reported recently that SGLT1 inhibition can attenuate apoptosis by suppressing DCM development via the JNK and p38 pathway.49 We also observed significant necrosis in HG- and PA-treated cells, and this was attenuated by CANA, DAPA, and NAC. By these findings, it is evident that the antiapoptotic effect of CANA and DAPA is mainly through the antioxidant pathway. Furthermore, we detected inhibition of SGLT1 preserves the morphology of cardiomyocytes (Figure 8). In the control group, we detected well-established cell morphology and well-defined nucleus, whereas in HG+PA-treated groups, we observed the cells had structural changes and polymorphous nuclei. In HG+PA-treated cells coincubated with CANA and DAPA, good morphology was observed. Several studies have reported insulin resistance is associated with pro-atherogenic changes in the vasculature as well as endothelial cells. Thus, cellular hypertrophy in cardiomyocytes could be related to insulin resistance and overexpression of IGF1 in response to HG and PA. Since increased glycogen deposition in the heart can lead to cardiomyopathy due to increased cardiac glucose uptake, chronic inhibition of SGLT1 would thus decrease this glycogen deposition associated with CVD.8

To determine whether SGLT1 was associated with the change in cardiac glucose uptake and since SGLT1 is the main SGLT isoform localized in the heart and transports glucose by a secondary active transport mechanism which uses the sodium concentration gradient established by the Na+/K+-ATPase pump, we wanted to observe the effect of CANA and DAPA on basal and insulin-stimulated glucose uptake in cardiomyocytes. We observed impaired glucose uptake in HG- and PA-treated cardiomyocytes under basal and insulin-stimulated conditions (Figure 9). Interestingly both CANA and DAPA reduced the basal and insulin-stimulated glucose uptake further in HG+PA-treated cultured cardiomyocytes. There is no head to head comparison of CANA and DAPA done so far; however, previous studies have reported both CANA and DAPA are equally effective in reducing uncontrolled hyperglycemia, fasting blood glucose, postprandial glucose, HBIAc, body weight, and systolic blood pressure.50 In healthy volunteers, CANA provided greater 24 h urinary glucose excretion, renal threshold for glucose excretion, and postprandial glucose excursion compared to DAPA.51 Recently clinical trials on DAPA-heart failure (assessing DAPA) and EMPEROR-Reduced (assessing empagliflozin) showed SGLT2 inhibition reduced the combined risk of CV death or hospitalization for heart failure in patients with heart failure with reduced ejection fraction with or without diabetes.52 In meta-analysis, SGLT2 inhibitors were associated with a reduced risk of major adverse CV events. Also, the benefit across the class was for an associated reduction in risk for hospitalization due to heart failure and kidney outcomes.53

So far clinical studies have shown that CANA and DAPA have few risks and side effects but not so severe as to discontinue the drug. The most common side effects are genital tract infections, lower limb amputations, bone fractures, electrolyte imbalance, and risk of cancer. Anyhow, additional studies with a larger sample size are required to identify the long-term adverse effects.54

In conclusion, our study reports glucolipotoxicity activates oxidative stress and apoptosis/necrosis via up-regulation of SGLT1. Thus, SGLT1 mediates glucolipotoxicity-induced cardiomyocyte damage. Thus, inhibition of SGLT1 may be one of the possible strategies to inhibit cardiomyocyte damage, however further studies are needed to investigate its potential in different disease models.

Acknowledgments

This work was supported by grant from the Department of Science and Technology (DST)-SERB under core research grant and Indian Council of Medical Research (ICMR), and, Govt. of India to A.D.; D.D. is supported by an Inspire fellowship from DST, Govt. of India.

Author Contributions

D.D., S.M., T.G., and G.P.L. conducted experiments. A.D. conceived the idea and wrote the manuscript. A.D., A.B., D.D., and D.S. designed the experiments.

The authors declare no competing financial interest.

References

  1. Wang J.; Song Y.; Wang Q.; Kralik P. M.; Epstein P. N. Causes and characteristics of diabetic cardiomyopathy. Review of Diabetic Studies. 2006, 3 (3), 108. 10.1900/RDS.2006.3.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Kalra J.; Mangali S. B.; Dasari D.; Bhat A.; Goyal S.; Dhar I.; Sriram D.; Dhar A. SGLT1 inhibition boon or bane for diabetes-associated cardiomyopathy. Fundam. Clin. Pharmacol. 2020, 34 (2), 173–88. 10.1111/fcp.12516. [DOI] [PubMed] [Google Scholar]
  3. Marsh S. A.; Dell'Italia L. J.; Chatham J. C. Interaction of diet and diabetes on cardiovascular function in rats. Am. J. Physiol.: Heart Circ. Physiol. 2009, 296 (2), H282–H292. 10.1152/ajpheart.00421.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. GH R. P.; Goff D. C. Jr.; Bigger J. T.; Buse J. B.; Cushman W. C.; Genuth S.; Ismail-Beigi F.; Grimm R. H. Jr; Probstfield J. L.; Simons-Morton D. G.; Friedewald W. T. Effects of intensive glucose lowering in type 2 diabetes. N. Engl. J. Med. 2008, 358 (24), 2545–2559. 10.1056/NEJMoa0802743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Duckworth W.; Abraira C.; Moritz T.; Reda D.; Emanuele N.; Reaven P. D.; Zieve F. J.; Marks J.; Davis S. N.; Hayward R.; et al. Glucose control and vascular complications in veterans with type 2 diabetes. N. Engl. J. Med. 2009, 360 (2), 129–139. 10.1056/NEJMoa0808431. [DOI] [PubMed] [Google Scholar]
  6. Wright E. M.; Loo D. D.; Hirayama B. A. Biology of human sodium glucose transporters. Physiol. Rev. 2011, 91 (2), 733–94. 10.1152/physrev.00055.2009. [DOI] [PubMed] [Google Scholar]
  7. Vallon V. The mechanisms and therapeutic potential of SGLT2 inhibitors in diabetes mellitus. Annu. Rev. Med. 2015, 66, 255–70. 10.1146/annurev-med-051013-110046. [DOI] [PubMed] [Google Scholar]
  8. Banerjee S. K.; McGaffin K. R.; Pastor-Soler N. M.; Ahmad F. SGLT1 is a novel cardiac glucose transporter that is perturbed in disease states. Cardiovasc. Res. 2009, 84 (1), 111–8. 10.1093/cvr/cvp190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ramratnam M.; Sharma R. K.; D’Auria S.; Lee S. J.; Wang D.; Huang X. Y.; Ahmad F. Transgenic knockdown of cardiac sodium/glucose cotransporter 1 (SGLT 1) attenuates PRKAG 2 cardiomyopathy, whereas transgenic overexpression of cardiac SGLT 1 causes pathologic hypertrophy and dysfunction in mice. J. Am. Heart Assoc. 2014, 3 (4), e000899 10.1161/JAHA.114.000899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Vrhovac I.; Balen Eror D.; Klessen D.; Burger C.; Breljak D.; Kraus O.; Radovic N.; Jadrijevic S.; Aleksic I.; Walles T.; et al. Localizations of Na+-D-glucose cotransporters SGLT1 and SGLT2 in human kidney and of SGLT1 in human small intestine, liver, lung, and heart. Pflügers Arch.-Eur. J. Physiol. 2015, 467 (9), 1881–1898. 10.1007/s00424-014-1619-7. [DOI] [PubMed] [Google Scholar]
  11. Sabino-Silva R.; Freitas H. S.; Lamers M. L.; Okamoto M. M.; Santos M. F.; Machado U. F. Na+-glucose cotransporter SGLT1 protein in salivary glands: potential involvement in the diabetes-induced decrease in salivary flow. J. Membr. Biol. 2009, 228 (2), 63–9. 10.1007/s00232-009-9159-3. [DOI] [PubMed] [Google Scholar]
  12. Kashiwagi Y.; Nagoshi T.; Yoshino T.; Tanaka T. D.; Ito K.; Harada T.; Takahashi H.; Ikegami M.; Anzawa R.; Yoshimura M. Expression of SGLT1 in human hearts and impairment of cardiac glucose uptake by phlorizin during ischemia-reperfusion injury in mice. PLoS One 2015, 10 (6), e0130605 10.1371/journal.pone.0130605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Zhou L.; Cryan E. V.; D’Andrea M. R.; Belkowski S.; Conway B. R.; Demarest K. T. Human cardiomyocytes express high level of Na+/glucose cotransporter 1 (SGLT1). J. Cell. Biochem. 2003, 90 (2), 339–46. 10.1002/jcb.10631. [DOI] [PubMed] [Google Scholar]
  14. Matsushita N.; Ishida N.; Ibi M.; Saito M.; Sanbe A.; Shimojo H.; Suzuki S.; Koepsell H.; Takeishi Y.; Morino Y.; et al. Chronic pressure overload induces cardiac hypertrophy and fibrosis via increases in SGLT1 and IL-18 gene expression in mice. Int. Heart J. 2018, 59, 1123–1133. 10.1536/ihj.17-565. [DOI] [PubMed] [Google Scholar]
  15. Wright E. M.; Ghezzi C.; Loo D. D. Novel and unexpected functions of SGLTs. Physiology 2017, 32 (6), 435–43. 10.1152/physiol.00021.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Novikov A.; Vallon V. SGLT2 inhibition in the diabetic kidney–an update. Curr. Opin. Nephrol. Hypertens. 2016, 25 (1), 50. 10.1097/MNH.0000000000000187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Tentolouris A.; Vlachakis P.; Tzeravini E.; Eleftheriadou I.; Tentolouris N. SGLT2 inhibitors: a review of their antidiabetic and cardioprotective effects. Int. J. Environ. Res. Public Health 2019, 16 (16), 2965. 10.3390/ijerph16162965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lopaschuk G. D.; Verma S. Mechanisms of cardiovascular benefits of sodium glucose co-transporter 2 (SGLT2) inhibitors: a state-of-the-art review. JACC: Basic Transl. Sci. 2020, 5 (6), 632–44. 10.1016/j.jacbts.2020.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lytvyn Y.; Bjornstad P.; Udell J. A.; Lovshin J. A.; Cherney D. Z. Sodium glucose cotransporter-2 inhibition in heart failure: potential mechanisms, clinical applications, and summary of clinical trials. Circulation 2017, 136 (17), 1643–58. 10.1161/CIRCULATIONAHA.117.030012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ghosh R. K.; Ghosh G. C.; Gupta M.; Bandyopadhyay D.; Akhtar T.; Deedwania P.; Lavie C. J.; Fonarow G. C.; Aneja A. Sodium glucose co-transporter 2 inhibitors and heart failure. Am. J. Cardiol. 2019, 124 (11), 1790–6. 10.1016/j.amjcard.2019.08.038. [DOI] [PubMed] [Google Scholar]
  21. Lim V. G.; Bell R. M.; Arjun S.; Kolatsi-Joannou M.; Long D. A.; Yellon D. M. SGLT2 inhibitor, canagliflozin, attenuates myocardial infarction in the diabetic and nondiabetic heart. JACC: Basic Transl. Sci. 2019, 4 (1), 15–26. 10.1016/j.jacbts.2018.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Arow M.; Waldman M.; Yadin D.; Nudelman V.; Shainberg A.; Abraham N. G.; Freimark D.; Kornowski R.; Aravot D.; Hochhauser E.; Arad M. Sodium–glucose cotransporter 2 inhibitor dapagliflozin attenuates diabetic cardiomyopathy. Cardiovasc. Diabetol. 2020, 19 (1), 1–2. 10.1186/s12933-019-0980-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mangali S.; Bhat A.; Udumula M. P.; Dhar I.; Sriram D.; Dhar A. Inhibition of protein kinase R protects against palmitic acid–induced inflammation, oxidative stress, and apoptosis through the JNK/NF-kB/NLRP3 pathway in cultured H9C2 cardiomyocytes. J. Cell. Biochem. 2019, 120 (3), 3651–63. 10.1002/jcb.27643. [DOI] [PubMed] [Google Scholar]
  24. Mangali S.; Bhat A.; Dasari D.; Sriram D.; Dhar A. Inhibition of double stranded RNA dependent protein kinase (PKR) abrogates isoproterenol induced myocardial ischemia in vitro in cultured cardiomyocytes and in vivo in wistar rats. Eur. J. Pharmacol. 2021, 906, 174223. 10.1016/j.ejphar.2021.174223. [DOI] [PubMed] [Google Scholar]
  25. Van Meerloo J.; Kaspers G. J.; Cloos J. Cell sensitivity assays: the MTT assay. Cancer Cell Culture 2011, 731, 237–245. 10.1007/978-1-61779-080-5_20. [DOI] [PubMed] [Google Scholar]
  26. Kim M.; Song K.; Kim Y. S. Alantolactone improves prolonged exposure of interleukin-6-induced skeletal muscle inflammation associated glucose intolerance and insulin resistance. Front. Pharmacol. 2017, 8, 405. 10.3389/fphar.2017.00405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jeong K.; Kwon H.; Min C.; Pak Y. Modulation of the caveolin-3 localization to caveolae and STAT3 to mitochondria by catecholamine-induced cardiac hypertrophy in H9c2 cardiomyoblasts. Exp. Mol. Med. 2009, 41 (4), 226–35. 10.3858/emm.2009.41.4.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Palmer S. C.; Tendal B.; Mustafa R. A.; Vandvik P. O.; Li S.; Hao Q.; Tunnicliffe D.; Ruospo M.; Natale P.; Saglimbene V.; et al. Sodium-glucose cotransporter protein-2 (SGLT-2) inhibitors and glucagon-like peptide-1 (GLP-1) receptor agonists for type 2 diabetes: systematic review and network meta-analysis of randomised controlled trials. BMJ [Br. Med. J.] 2021, m4573. 10.1136/bmj.m4573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Perry R. J.; Shulman G. I. Sodium-glucose cotransporter-2 inhibitors: Understanding the mechanisms for therapeutic promise and persisting risks. J. Biol. Chem. 2020, 295 (42), 14379–90. 10.1074/jbc.REV120.008387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mancini S. J.; Boyd D.; Katwan O. J.; Strembitska A.; Almabrouk T. A.; Kennedy S.; Palmer T. M.; Salt I. P. Canagliflozin inhibits interleukin-1β-stimulated cytokine and chemokine secretion in vascular endothelial cells by AMP-activated protein kinase-dependent and-independent mechanisms. Sci. Rep. 2018, 8 (1), 1–4. 10.1038/s41598-018-23420-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sands A. T.; Zambrowicz B. P.; Rosenstock J.; Lapuerta P.; Bode B. W.; Garg S. K.; Buse J. B.; Banks P.; Heptulla R.; Rendell M.; et al. Sotagliflozin, a dual SGLT1 and SGLT2 inhibitor, as adjunct therapy to insulin in type 1 diabetes. Diabetes Care 2015, 38 (7), 1181. 10.2337/dc14-2806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Novikov A.; Vallon V. SGLT2 inhibition in the diabetic kidney–an update. Curr. Opin. Nephrol. Hypertens. 2016, 25 (1), 50. 10.1097/MNH.0000000000000187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Hirose M.; Matsushita N.; Ishida N.; Ibi M.; Saito M. Roles of sodium-glucose cotransporter 1 (SGLT1) in the induction of cardiac remodeling. Yakugaku Zasshi 2018, 138 (7), 939–43. 10.1248/yakushi.17-00223-2. [DOI] [PubMed] [Google Scholar]; (in Japanese).
  34. Kanwal A.; Nizami H. L.; Mallapudi S.; Putcha U. K.; Mohan G. K.; Banerjee S. K. Inhibition of SGLT1 abrogates preconditioning-induced cardioprotection against ischemia-reperfusion injury. Biochem. Biophys. Res. Commun. 2016, 472 (2), 392–8. 10.1016/j.bbrc.2016.02.016. [DOI] [PubMed] [Google Scholar]
  35. Filippatos T. D.; Liontos A.; Papakitsou I.; Elisaf M. S. SGLT2 inhibitors and cardioprotection: a matter of debate and multiple hypotheses. Postgrad. Med. 2019, 131 (2), 82–8. 10.1080/00325481.2019.1581971. [DOI] [PubMed] [Google Scholar]
  36. Lambert R.; Srodulski S.; Peng X.; Margulies K. B.; Despa F.; Despa S. Intracellular Na+ concentration ([Na+] i) is elevated in diabetic hearts due to enhanced Na+–glucose cotransport. J. Am. Heart Assoc. 2015, 4 (9), e002183 10.1161/JAHA.115.002183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wang C. W.; Chang W. L.; Huang Y. C.; Chou F. C.; Chan F. N.; Su S. C.; Huang S. F.; Ko H. H.; Ko Y. L.; Lin H. C.; Chang T. C. An essential role of cAMP response element-binding protein in epidermal growth factor-mediated induction of sodium/glucose cotransporter 1 gene expression and intestinal glucose uptake. Int. J. Biochem. Cell Biol. 2015, 64, 239–51. 10.1016/j.biocel.2015.04.006. [DOI] [PubMed] [Google Scholar]
  38. Udumula M. P.; Medapi B.; Dhar I.; Bhat A.; Desai K.; Sriram D.; Dhar A. The small molecule indirubin-3′-oxime inhibits protein kinase R: Antiapoptotic and antioxidant effect in rat cardiac myocytes. Pharmacology 2016, 97 (1–2), 25–30. 10.1159/000441727. [DOI] [PubMed] [Google Scholar]
  39. Yida Z.; Imam M. U.; Ismail M.; Ismail N.; Ideris A.; Abdullah M. A. High fat diet-induced inflammation and oxidative stress are attenuated by N-acetylneuraminic acid in rats. J. Biomed. Sci. 2015, 22 (1), 1–0. 10.1186/s12929-015-0211-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Lin N.; Chen H.; Zhang H.; Wan X.; Su Q. Mitochondrial reactive oxygen species (ROS) inhibition ameliorates palmitate-induced INS-1 beta cell death. Endocrine 2012, 42 (1), 107–17. 10.1007/s12020-012-9633-z. [DOI] [PubMed] [Google Scholar]
  41. Maloney E.; Sweet I. R.; Hockenbery D. M.; Pham M.; Rizzo N. O.; Tateya S.; Handa P.; Schwartz M. W.; Kim F. Activation of NF-κB by palmitate in endothelial cells: a key role for NADPH oxidase-derived superoxide in response to TLR4 activation. Arterioscler., Thromb., Vasc. Biol. 2009, 29 (9), 1370–5. 10.1161/ATVBAHA.109.188813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Park G. B.; Choi Y.; Kim Y. S.; Lee H. K.; Kim D.; Hur D. Y. ROS-mediated JNK/p38-MAPK activation regulates Bax translocation in Sorafenib-induced apoptosis of EBV-transformed B cells. Int. J. Oncol. 2014, 44 (3), 977–85. 10.3892/ijo.2014.2252. [DOI] [PubMed] [Google Scholar]
  43. Rajesh M.; Mukhopadhyay P.; Bátkai S.; Patel V.; Saito K.; Matsumoto S.; Kashiwaya Y.; Horváth B.; Mukhopadhyay B.; Becker L.; et al. Cannabidiol attenuates cardiac dysfunction, oxidative stress, fibrosis, and inflammatory and cell death signaling pathways in diabetic cardiomyopathy. J. Am. Coll. Cardiol. 2010, 56 (25), 2115–2125. 10.1016/j.jacc.2010.07.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. de Vries J. E.; Vork M. M.; Roemen T. H.; de Jong Y. F.; Cleutjens J. P.; Van der Vusse G. J.; Van Bilsen M. Saturated but not mono-unsaturated fatty acids induce apoptotic cell death in neonatal rat ventricular myocytes. J. Lipid Res. 1997, 38 (7), 1384–94. 10.1016/S0022-2275(20)37421-6. [DOI] [PubMed] [Google Scholar]
  45. Drosatos K.; Schulze P. C. Cardiac lipotoxicity: molecular pathways and therapeutic implications. Curr. Heart Failure Rep. 2013, 10 (2), 109–121. 10.1007/s11897-013-0133-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. van Empel V. P.; Bertrand A. T.; Hofstra L.; Crijns H. J.; Doevendans P. A.; De Windt L. J. Myocyte apoptosis in heart failure. Cardiovasc. Res. 2005, 67 (1), 21–9. 10.1016/j.cardiores.2005.04.012. [DOI] [PubMed] [Google Scholar]
  47. Krijnen P. A.; Nijmeijer R.; Meijer C. J.; Visser C. A.; Hack C. E.; Niessen H. W. Apoptosis in myocardial ischaemia and infarction. J. Clin. Pathol. 2002, 55 (11), 801–811. 10.1136/jcp.55.11.801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Lin N.; Lin H.; Yang Q.; Lu W.; Sun Z.; Sun S.; Meng L.; Chi J.; Guo H. SGLT1 Inhibition Attenuates Apoptosis in Diabetic Cardiomyopathy via the JNK and p38 Pathway. Front. Pharmacol. 2021, 11, 2247. 10.3389/fphar.2020.598353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Johnston R.; Uthman O.; Cummins E.; Clar C.; Royle P.; Colquitt J.; Tan B. K.; Clegg A.; Shantikumar S.; Court R.; O’Hare J. P.; McGrane D.; Holt T.; Waugh N. Canagliflozin, dapagliflozin and empagliflozin monotherapy for treating type 2 diabetes: systematic review and economic evaluation. Health Technol. Assess. 2017, 21 (2), 1–218. 10.3310/hta21020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Sha S.; Polidori D.; Farrell K.; Ghosh A.; Natarajan J.; Vaccaro N.; Pinheiro J.; Rothenberg P.; Plum-Mörschel L. Pharmacodynamic differences between canagliflozin and dapagliflozin: results of a randomized, double-blind, crossover study. Diabetes Obes. Metab. 2015, 17 (2), 188–197. 10.1111/dom.12418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zannad F.; Ferreira J. P.; Pocock S. J.; Anker S. D.; Butler J.; Filippatos G.; Brueckmann M.; Ofstad A. P.; Pfarr E.; Jamal W.; Packer M. SGLT2 inhibitors in patients with heart failure with reduced ejection fraction: a meta-analysis of the EMPEROR-Reduced and DAPA-HF trials. Lancet 2020, 396 (10254), 819–829. 10.1016/S0140-6736(20)31824-9. [DOI] [PubMed] [Google Scholar]
  52. McGuire D. K.; Shih W. J.; Cosentino F.; Charbonnel B.; Cherney D. Z. I.; Dagogo-Jack S.; Pratley R.; Greenberg M.; Wang S.; Huyck S.; Gantz I.; Terra S. G.; Masiukiewicz U.; Cannon C. P. Association of SGLT2 Inhibitors With Cardiovascular and Kidney Outcomes in Patients With Type 2 Diabetes: A Meta-analysis. JAMA Cardiol. 2021, 6 (2), 148–158. 10.1001/jamacardio.2020.4511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Simes B. C; MacGregor G. G Sodium-glucose cotransporter-2 (SGLT2) inhibitors: a clinician’s guide. Diabetes, Metab. Syndr. Obes.: Targets Ther. 2019, 12, 2125. 10.2147/DMSO.S212003. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from ACS Pharmacology & Translational Science are provided here courtesy of American Chemical Society

RESOURCES