Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2022 Mar 14;88(7):e00097-22. doi: 10.1128/aem.00097-22

An Intrinsically Disordered Peptide Tag that Confers an Unusual Solubility to Aggregation-Prone Proteins

Byung Hoon Jo a,✉
Editor: Haruyuki Atomib
PMCID: PMC9004385  PMID: 35285717

ABSTRACT

There is a high demand for the production of recombinant proteins in Escherichia coli for biotechnological applications, but their production is still limited by their insolubility. Fusion tags have been successfully used to enhance the solubility of aggregation-prone proteins; however, smaller and more powerful tags are desired for increasing the yield and quality of target proteins. Here, the NEXT tag, a 53-amino-acid-long solubility enhancer, is described. The NEXT tag showed outstanding ability to improve both in vivo and in vitro solubilities, with minimal effect on passenger proteins. The C-terminal region of the tag was mostly responsible for in vitro solubility, while the N-terminal region was essential for in vivo soluble expression. The NEXT tag appeared to be intrinsically disordered and seemed to exclude neighboring molecules and prevent protein aggregation by acting as an entropic bristle. This novel peptide tag should have general use as a fusion partner to increase the yield and quality of difficult-to-express proteins.

IMPORTANCE Production of recombinant proteins in Escherichia coli still suffers from the insolubility problem. Conventional solubility enhancers with large sizes, represented by maltose-binding protein (MBP), have remained the first-choice tags; however, the success of the soluble expression of tagged proteins is largely unpredictable. In addition, the large tags can negatively affect the function of target proteins. In this work, the NEXT tag, an intrinsically disordered peptide, was introduced as a small but powerful alternative to MBP. The NEXT tag could significantly improve both the expression level and the solubility of target proteins, including a thermostable carbonic anhydrase and a polyethylene terephthalate (PET)-degrading enzyme that are remarkable enzymes for environmental bioremediation.

KEYWORDS: NEXT tag, PETase, carbonic anhydrase, entropic bristle, intrinsically disordered, soluble expression

INTRODUCTION

Recombinant protein expression underpins protein engineering and metabolic pathway engineering for the production of biotherapeutics, bioreporters, biocatalysts, and various industrial chemicals, as well as biochemical studies of proteins. Bacterial hosts such as Escherichia coli have remained the preferred hosts for recombinant protein expression due to their high growth rate to high cell densities, ease of genetic manipulation, and scale-up simplicity (1). However, the high rate of protein synthesis/folding and the high-level accumulation of heterologous protein in E. coli often lead to the formation of inclusion bodies, which are intracellular aggregates of misfolded, partially folded, or even fully folded proteins, limiting the yield of recombinant protein (1–3).

Fusion protein tags have been widely used as effective solubility enhancers for aggregation-prone proteins. When fused to the N termini of target proteins, these solubility tags not only improve the solubility of passenger proteins but also increase their expression level by providing sequence contexts for more efficient translation initiation (4). Despite numerous examples of their applications, the successful selection of effective tags for a given target protein still relies heavily on a trial-and-error approach. Although maltose-binding protein (MBP) and N-utilization substance A (NusA) are the best working tags (4, 5), they are relatively large proteins (>40 kDa) that can impart a greater metabolic burden than smaller tags and increase the chance of full-length proteins undergoing incomplete synthesis (6), potentially leading to a lower yield of target protein. In addition, while fusion tags are generally removed by chemical or enzymatic cleavage after soluble expression and purification, proteins that have intrinsically poor solubilities need to be used in their tagged forms since they precipitate after the solubility tags are removed (1, 5, 7). In this case, smaller tags are more desirable, to minimize the effect of fusion tags on the inherent properties of passenger proteins (7, 8). Collectively, there is still considerable demand to expand the repertoire of solubility tags that are more powerful but smaller than conventional tags.

The carbonic anhydrase (CA) of the marine bacterium Hydrogenovibrio marinus (hmCA) is a highly soluble protein (9). hmCA contains an unusual N-terminal extension that is not essential for its catalytic function. When the N-terminal sequence was truncated, the solubility of recombinant hmCA was drastically reduced and it was expressed mostly in an insoluble form. Inspired by this observation, it was hypothesized that the 53-amino-acid-long N-terminal extension sequence (designated NEXT) could be used as a fusion tag to improve solubility. In this study, it was demonstrated that the small NEXT tag is an intrinsically disordered peptide that is exceptionally powerful for improving the solubility and expression level of passenger proteins, with minimal influence on the target protein.

RESULTS AND DISCUSSION

Effect of the NEXT tag on the in vivo solubility of recombinant proteins.

By convention, there are two types of protein solubilities, namely, in vivo solubility and in vitro solubility (10). Low in vivo protein solubility is often observed when a recombinant protein is overexpressed in a bacterial host, generally resulting in the formation of inclusion bodies (1, 2). When a protein has low in vitro solubility, aggregates can be formed even with a folded, isolated protein (10, 11). In this case, the protein can remain soluble only at low concentrations.

To evaluate the efficiency of the NEXT tag in improving in vivo solubility, the tag was fused to the N termini of several difficult-to-express proteins via a flexible linker (Fig. 1a). The passenger proteins were selected based on their potential applications, i.e., human epidermal growth factor (hEGF) (6.4 kDa) as a therapeutic protein, green fluorescent protein (GFP) (26.9 kDa) as a bioreporter, and CA from Thermovibrio ammonificans (taCA) (25.9 kDa) and polyethylene terephthalate (PET)-hydrolyzing enzyme from Ideonella sakaiensis (isPETase) (27.7 kDa) as biocatalysts for bioremediation. The passenger proteins were expressed without any fusion partner, with the fusion of the flexible (GGGGS)2 linker sequence, or with the fusion of the NEXT tag along with the linker. Their expression patterns were analyzed after soluble/insoluble fractionation.

FIG 1.

FIG 1

Open in a new tab

In vivo solubility of recombinant proteins fused with the NEXT tag. (a) Expression cassettes of recombinant proteins. Protein expression is under the control of the IPTG-inducible T7lac promoter. The passenger proteins are expressed without any fusion partner [(−)], with the N-terminal fusion of the flexible (GGGGS)2 linker sequence (Linker), or with the N-terminal fusion of the NEXT tag via the linker (NEXT). All of the constructs have a C-terminal His6 tag. (b to e) Coomassie blue-stained SDS-PAGE gel (upper) and Western blot result using an anti‐His6 antibody (lower) for analysis of the expression of hEGF (b), GFP (c), taCA (d), and isPETase (e) at 37°C. The arrows indicate the band position of each recombinant protein. The question mark shows the band position putatively corresponding to hEGF. Lane MW, molecular mass marker; lane S, soluble fraction; lane IS, insoluble fraction.

hEGF is a protein hormone that can be used as a wound-healing agent by stimulating epidermal regeneration (12). Although the production of hEGF in bacterial cells has been reported, high-level soluble expression of hEGF in E. coli is still challenging. The expression of untagged hEGF was not successful, as shown in the Western blot analysis, in which no His6-tagged protein was detected, although a weak band putatively corresponding to hEGF was observed in the insoluble fraction on the Coomassie blue-stained gel (Fig. 1b). A recent study also reported the failure of the expression of detectable amounts of hEGF (13). In contrast, the high-level soluble expression of NEXT-hEGF was remarkable (Fig. 1b). The percentage of the soluble fraction was 83.5 ± 8.7%, even at 37°C, which was one of the highest values ever reported (13–16). GFP is the most popular fluorescent protein for bioimaging and sensing applications (17). While the untagged GFP was expressed almost entirely in insoluble forms in spite of its high-level expression, the fusion of the NEXT tag significantly enhanced the soluble expression of GFP (Fig. 1c). taCA is one of the most thermostable CAs and has potential applications in bioinspired CO2 capture and utilization (18–20). Despite its soluble expression, the relatively low protein yield and the low in vitro solubility (see below) have hampered intensive engineering and application of taCA. Both the untagged and NEXT-tagged taCA enzymes were produced in soluble forms and, notably, the expression level of NEXT-taCA was 8-fold higher than that of the untagged taCA (Fig. 1d). Recently, isPETase has been extensively studied as a green biocatalyst that can degrade PET plastic under moderate temperature conditions (21–23). However, isPETase exhibits a low level of soluble expression in E. coli even at low temperatures, and its high-level expression has been demonstrated by using an 18-kDa fusion partner only at 18°C (13). As reported previously, the untagged isPETase was expressed almost exclusively in an insoluble form at 37°C (Fig. 1e). In contrast, surprisingly, NEXT-isPETase was expressed almost entirely in a soluble form at 37°C (Fig. 1e). The ratio of the soluble fraction to the total for each recombinant protein, as well as the fold increase in soluble expression, with the fusion of the NEXT tag is summarized in Table S1 in the supplemental material. In all of the experiments described above, no noticeable improvement was observed when the passengers were fused solely to the flexible linker; they showed either a level of soluble expression similar to that of the untagged counterpart (for GFP and taCA) or no expression at all (for hEGF and isPETase) (Fig. 1). Thus, the improved soluble expression of the NEXT-tagged proteins could be attributed to the tag itself and not to the linker region.

Comparison of the NEXT tag with conventional tags for the in vivo solubility of recombinant proteins.

Other commonly used solubility tags, including MBP (24), glutathione S-transferase (GST) (25), and an 8-kDa protein from Fasciola hepatica (Fh8) (4), were tested for comparison (Table 1 and Fig. 2a). The expression level of soluble NEXT-hEGF was the highest among the tested constructs (Fig. 2b). When GFP was fused to the other solubility tags, a notable amount of soluble expression was not observed at 37°C with any of the tested fusion proteins except for NEXT-GFP (Fig. 2c). At 25°C, however, all of the constructs showed high in vivo solubility, and again the most remarkable soluble expression was that of NEXT-GFP, as its fluorescence was the brightest (Fig. 2c). Although taCA was expressed mostly in soluble forms regardless of the fusion tags, the highest expression level was attained when the NEXT tag was used (Fig. 2d). The MBP or Fh8 tagging showed no distinct effect for the soluble expression of isPETase at 37°C, which was in sharp contrast to the NEXT-tagged form (Fig. 2e). Collectively, these results demonstrate that the NEXT tag is an exceptionally powerful enhancer not only for in vivo solubility but also for the production yield of passenger protein.

TABLE 1.

Properties of solubility tags used in this study

Tag Length (amino acids) Mol wt (kDa) No. of phosphorylation sitesa pI Net charge Mean hydropathy index
MBP 367 40.4 26 5.1 −10 0.465
GST 220 25.7 12 5.9 −4 0.460
Fh8 69 7.7 3 5.6 −2 0.426
NEXT 53 5.5 0 8.1 +1 0.397
Open in a new tab
a

Predicted number of potential phosphorylation sites.

FIG 2.

FIG 2

Open in a new tab

In vivo solubility of recombinant proteins fused with different solubility tags. (a) Expression cassettes of fusion proteins. Protein expression is under the control of the IPTG-inducible T7lac promoter. The passenger proteins are fused with the N-terminal solubility tags via the flexible (GGGGS)2 linker and with the C-terminal His6 tag. (b to e) Coomassie blue-stained SDS-PAGE gel for analysis of the expression of hEGF (b), GFP (c), taCA (d), and isPETase (e) fused with the different solubility tags at 37°C or 25°C (only for GFP). The fluorescence image in panel c is for GFP at 25°C. The arrows indicate the band position of each recombinant protein. Lane MW, molecular mass marker; lane S, soluble fraction; lane IS, insoluble fraction.

Effects of the fusion tags on the in vitro solubility of purified proteins.

To test the ability of solubility tags to promote the in vitro solubility of passenger proteins, taCA and isPETase were further utilized for the test, because these enzymes have low in vitro solubility and are susceptible to aggregation under low salt conditions (18, 23). The purified taCA enzymes with different solubility tags were exposed to buffer solutions with or without salt supplementation, and any protein precipitates were separated from the supernatant by centrifugation and analyzed by SDS-PAGE. When the buffer was supplemented with 300 mM NaCl, only GST-taCA showed a significant amount of precipitates, and the other proteins, including the untagged counterpart, remained soluble (Fig. 3a). After the enzymes were placed under low-salt conditions, GST-taCA became completely insoluble, which was more severe than in the case of untagged taCA (Fig. 3b). Combined with the in vivo solubility results (Fig. 2), this confirms that GST is not an effective tag for improving protein solubility (1). On the other hand, almost all taCA enzymes were still in soluble forms when the other tags (MBP, Fh8, and NEXT) were used, which demonstrates their effectiveness in improving the in vitro solubility of passenger proteins (Fig. 3b). The precipitation pattern of taCA fused only with the flexible linker was essentially the same as that of untagged taCA, confirming that the linker itself is not effective in promoting in vitro protein solubility (Fig. 3b). Interestingly, after undergoing changes in the composition and pH of the buffer under low-salt conditions, only MBP- and NEXT-tagged taCA showed resistance to aggregation induced by changes in environmental conditions, indicating that both the MBP and NEXT tags are superior to the Fh8 tag for enhancing in vitro solubility even in dynamic chemical environments (Fig. 3c). Similar to taCA, the poor in vitro solubility of isPETase under low-salt conditions was successfully circumvented by fusion with the NEXT tag (Fig. 3d).

FIG 3.

FIG 3

Open in a new tab

In vitro solubility of purified enzymes fused with different solubility tags. (a to d) Coomassie blue-stained SDS-PAGE gel for analysis of the precipitation of taCA dialyzed against 20 mM phosphate buffer (pH 7.5) supplemented with 300 mM NaCl (a), taCA dialyzed against 20 mM phosphate buffer (pH 7.5) (b), taCA after buffer exchange from 20 mM phosphate buffer (pH 7.5) to 20 mM Tris buffer (pH 8.3) (c), and isPETase dialyzed against 20 mM phosphate buffer (pH 7.5) (d). Lane Sup, supernatant after centrifugation; lane Ppt, precipitated protein pellet.

Effects of the fusion tags on protein quality.

Using the purified taCA enzyme fused with the MBP, Fh8, or NEXT tag, the effect of the fusion tag on protein quality was investigated by examining the enzyme activity and stability, the two most important enzyme properties. The activity changes of taCA caused by the fusion of Fh8 (27%) and NEXT (14%) were relatively marginal, compared with that of MBP-taCA, which showed an abnormally large increase in activity (115%) (Fig. 4a). The bulky MBP tag might alter the function of taCA more than the small tags can. Similarly, the solubility tags affected the thermal stability of taCA corresponding to their sizes, and no apparent decrease in stability was seen when the NEXT tag was used (Fig. 4b). These results show that the smallest NEXT tag can be used as a noncleavable solubility tag that exerts only minimal influences on passenger proteins.

FIG 4.

FIG 4

Open in a new tab

Activity and stability of purified taCA fused with different tags. (a) Relative CO2 hydration activity of solubility tag-fused taCA, compared to the activity of taCA without a tag. (b) Thermal stability of taCA with or without a fusion tag. The enzyme activity was measured after incubation for 1 h at 90°C, and the relative residual activity was obtained, compared to the enzyme activity without heat treatment. Enzymes were prepared in 20 mM phosphate buffer (pH 7.5). Error bars represent standard deviations from two or three independent experiments. Asterisks indicate statistical significance of the tagged taCA, compared with the untagged enzyme, determined by t test; *, P < 0.05; **, P < 0.01.

From a different standpoint, biochemical studies of proteins can also benefit from the small size of the NEXT tag. Larger solubility tags are expected to have more sites for posttranslational modification, such as phosphorylation (Table 1). For example, a candidate substrate for a mammalian protein kinase can be expressed and purified in a recombinant expression system with the fusion of MBP for in vitro protein kinase assays. Even if the fusion protein is phosphorylated by the kinase, it cannot be concluded that the candidate protein is an actual substrate for the kinase, because MBP has many potential phosphorylation sites and the phosphorylation might have occurred within the MBP portion and not within the candidate substrate portion in the fusion protein. In this situation, the NEXT tag, with no potential phosphorylation site, can be alternatively used.

N-terminal truncation of the NEXT tag.

To identify the part of the NEXT tag that is most responsible for solubility enhancement, the tag was roughly divided into three regions with similar sizes, and the sequential N-terminal truncation of the regions was studied (Fig. 5a). First, hmCA, from which the NEXT tag originated, was expressed with the partial or full deletion of the N-terminal extension (Fig. 5b). Full-length hmCA and the two partial deletion variants (ΔN19 and ΔN36) were expressed in soluble forms despite the different expression levels. However, when the N-terminal extension of hmCA was fully truncated, the protein was expressed in a form that was almost insoluble, as reported previously (9). This result clearly indicates that the C-terminal part of the NEXT tag (NEXTC16 peptide) is the part most responsible for the soluble expression of hmCA.

FIG 5.

FIG 5

Open in a new tab

Effect of truncating the NEXT tag on the solubility of the target protein. (a) Design of truncation constructs. The sequence of the NEXT tag is presented along with the selected residue numbers. The first methionine was excluded from residue numbering. (b) In vivo solubility of N-terminal truncated hmCA variants. wt, wild-type. (c) In vivo solubility of the recombinant proteins (GFP, hEGF, and taCA) fused with the NEXT or NEXTC16 tag. Proteins were expressed at 37°C with 1 mM IPTG. (d) In vitro solubility of purified taCA with the NEXT or NEXTC16 tag prepared in 20 mM phosphate buffer with or without 300 mM NaCl. (e) Activity and stability of taCA fused with the NEXT or NEXTC16 tag. taCA enzymes were prepared in 20 mM phosphate buffer (pH 7.5). For the stability test, enzymes were incubated for 1 h at 90°C. Error bars represent standard deviations from two independent experiments. Lane MW, molecular mass marker; lane S, soluble fraction; lane IS, insoluble fraction; lane Sup, supernatant after centrifugation; lane Ppt, precipitated protein pellet.

To test whether the 16-amino-acid-long NEXTC16 can substitute for the full-length NEXT tag, the expression patterns of hEGF, GFP, and taCA fused to NEXTC16 were evaluated. Unfortunately, the soluble expressions of both hEGF and GFP were significantly hampered by the replacement of the NEXT tag with the NEXTC16 tag, suggesting that the N-terminal region of the NEXT tag is crucial for improving the in vivo solubility of the passenger protein (Fig. 5c). In the case of taCA, soluble expression of NEXTC16-taCA was observed as expected, although the production yield appeared to be reduced, compared to that of NEXT-taCA (Fig. 5c). Intriguingly, when the in vitro solubility of purified NEXTC16-taCA was tested, no apparent protein precipitation was observed regardless of NaCl supplementation (Fig. 5d). Additionally, the activity and stability of NEXTC16-taCA were identical to those of NEXT-taCA (Fig. 5e). These results show that, in contrast to the in vivo solubility results, the high in vitro solubility of passenger proteins can be retained by using the NEXTC16 region alone instead of the full-length NEXT tag. The use of a very short NEXTC16 tag might be beneficial, e.g., for immobilization of the target enzyme onto a solid matrix with a limited surface area, to maximize the immobilization yield and overall catalytic efficiency of biocatalysts (26).

Intrinsic disorder of the NEXT tag.

The mechanisms of solubility enhancement by various solubility tags are still not clear, and there seem to be multiple routes for the promoted solubility (4). The in vivo solubility results (Fig. 2) did not fit into the solubility predicted by the modified Wilkinson-Harrison model (see Table S2) (27). Although machine-learning-based SOLpro (28) predicted the solubility patterns of fusion proteins more accurately, it still could not discriminate the NEXT tag from the others, especially for isPETase fusions (Fig. 2e; also see Table S2). Protein acidity is known to be one of the determinants of solubility (29, 30), which cannot explain the remarkable enhancement of solubility by the NEXT tag, which possesses a net positive charge (Table 1).

The classic structure-function paradigm of proteins has been challenged by the concept of intrinsically disordered proteins (IDPs). IDPs exist as highly dynamic structural ensembles with undefined three-dimensional structures (31). It has been proposed that an IDP region within a protein can act as an intramolecular entropic bristle (EB) (32, 33). The EB domain is expected to have an extended conformation and, by thermally driven random motion, it can occupy a significantly large space around the protein molecule (34). By entropically excluding neighboring molecules, EB can prevent protein aggregation, thus leading to improved protein solubility.

Sequence-based prediction showed that the NEXT tag is highly disordered, whereas the MBP, GST, and Fh8 tags possess low disorder propensities (Fig. 6a). Its low hydrophobicity index, a measure that is correlated with protein disorder (35), also distinguishes the NEXT tag from the other tags (Table 1). The C-terminal region of the NEXT tag was predicted to be the most disordered (Fig. 6a), which corresponds to the NEXTC16 region being crucial for improving solubility (Fig. 5). The NEXT tag was separately expressed and purified (Fig. 6b). The circular dichroism (CD) spectrum of the purified NEXT tag coincided with that of a random coil without any secondary structural element (Fig. 6c) (36). These results strongly suggest that the NEXT tag is an IDP that can improve the solubility of passenger proteins as a function of EB.

FIG 6.

FIG 6

Open in a new tab

Intrinsic disorder propensities of solubility tags. (a) Position-dependent prediction of disordered regions by three different methods (IUPred2A, PONDR, and DISpro). The region corresponding to NEXTC16 is highlighted in a yellow box. (b) Purified NEXT tag with a C-terminal His6 tag (6.5 kDa) analyzed by SDS-PAGE. Lane MW, molecular mass marker; lane P, purified protein. (c) CD spectrum of purified NEXT tag in the far-UV region.

As demonstrated previously, the fusion of the NEXT tag can prevent protein aggregation both in vitro and in vivo (Fig. 7). A fully folded protein with low in vitro solubility is prone to aggregation (Fig. 7a), which can be circumvented by the fusion of EB (Fig. 7b). The accumulation of overexpressed, fully folded protein with low in vitro solubility can result in protein aggregation in the cytosol (Fig. 7c). This apparently low in vivo solubility can also be overcome by the utilization of EB (Fig. 7d). The accumulation and subsequent aggregation of partially folded proteins before the completion of folding is another cause of low in vivo solubility (Fig. 7e). The interaction between the folding intermediates can be reduced with N-terminal fusion of EB, facilitating correct protein folding (Fig. 7f).

FIG 7.

FIG 7

Open in a new tab

Solubility enhancement by the fusion of EB. (a and b) A protein with low in vitro solubility aggregates in its folded state (a) and, after the fusion of EB, the protein can remain soluble (b). (c and d) The accumulation of fully folded protein with low in vitro solubility can lead to protein aggregation in the cytosol, leading to protein expression that seems to be insoluble (c). This situation can also be circumvented by the fusion of EB (d). (e and f) Low in vivo solubility during recombinant protein overexpression can occur by the aggregation of partially folded proteins (e), which can be overcome by the N-terminal fusion of EB, preventing the interaction between the folding intermediates and thus allowing protein folding to complete (f).

In conclusion, the successful use of a small NEXT tag was demonstrated to improve both the in vivo and in vitro solubilities of the selected recombinant proteins. Because the degree of solubility enhancement by EB fusion appeared to depend on the length of the tag (32), a more powerful IDP-based solubility tag should be artificially engineered by optimizing not only the amino acid sequence but also the length of the tag. Further experimental analyses using a variety of potential EB proteins, including the NEXT tag, will provide insight into the engineering principles for the de novo design of IDP-based solubility tags customized for each passenger protein.

MATERIALS AND METHODS

Construction of expression vectors.

The strains, plasmids, and primers used in this study are listed in Table 2. The E. coli TOP10 strain (Thermo Fisher Scientific, USA) was used for gene cloning. E. coli was routinely cultured at 37°C in Luria-Bertani (LB) medium supplemented with appropriate antibiotics (10 μg/mL streptomycin or 50 μg/mL ampicillin) in a shaking incubator (Jeiotech, South Korea). The genes for MBP, GST, NEXT, GFP, and taCA were cloned by PCR using pMAL-c5X (New England Biolabs, USA), pGEX-4T-1 (GE Healthcare, USA), pET-hmCA (9), pTH-GFP (37), and pET-taCA (18) as the templates. The primers for the solubility tags contain the sequence for the flexible linker (GGGGS)2 along with NdeI and NcoI restriction sites. The PCR fragments were cloned into the pGEM-T Easy vector (Promega, USA), and the amplified sequences were confirmed by direct sequencing. The genes for the Fh8 tag, hEGF, and isPETase were chemically synthesized along with the linker sequence (only for Fh8) and the restriction sites (Genotech, South Korea). The genes were subcloned into pET-22b(+) (Novagen, USA). All of the recombinant genes have a His6-tag-encoding sequence at their 3′ termini, provided by the parent vector.

TABLE 2.

Strains, plasmids, and primers used in this study

Strain, plasmid, or primer Genotype, relevant characteristics, or sequencea Source or reference
Strains
 E. coli TOP10 F− mcrA Δ(mrr-hsdRMS-mcrBC) Ф80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL(Strr) endA1 nupG Thermo Fisher Scientific
 E. coli BL21(DE3) F− ompT hsdSB(rB− mB−) gal dcm lon λ(DE3), carrying T7 RNA polymerase gene Novagen
Plasmids
 pGEM-T Easy pUC ori, Ampr, TA cloning vector Promega
 pET-22b(+) T7lac promoter, pBR322 ori, Ampr, parental expression vector Novagen
 pMAL-c5X Template plasmid carrying MBP gene New England Biolabs
 pGEX-4T-1 Template plasmid carrying GST gene GE Healthcare
 pET-hmCA Template plasmid carrying hmCA gene 9
 pTH-GFP Template plasmid carrying GFP gene 37
 pET-taCA Template plasmid as well as expression plasmid carrying taCA gene 18
 pTOP-Fh8 Template plasmid carrying synthetic Fh8 gene This study
 pTOP-hEGF Template plasmid carrying synthetic hEGF gene This study
 pTOP-PETase Template plasmid carrying synthetic isPETase gene This study
 pET-hEGF Expression plasmid carrying hEGF gene This study
 pET-Linker-hEGF Expression plasmid carrying (GGGGS)2 linker-hEGF gene This study
 pET-MBP-hEGF Expression plasmid carrying MBP-hEGF fusion gene This study
 pET-GST-hEGF Expression plasmid carrying GST-hEGF fusion gene This study
 pET-Fh8-hEGF Expression plasmid carrying Fh8-hEGF fusion gene This study
 pET-NEXT-hEGF Expression plasmid carrying NEXT-hEGF fusion gene This study
 pET-GFP Expression plasmid carrying GFP gene This study
 pET-Linker-GFP Expression plasmid carrying (GGGGS)2 linker-GFP gene This study
 pET-MBP-GFP Expression plasmid carrying MBP-GFP fusion gene This study
 pET-GST-GFP Expression plasmid carrying GST-GFP fusion gene This study
 pET-Fh8-GFP Expression plasmid carrying Fh8-GFP fusion gene This study
 pET-NEXT-GFP Expression plasmid carrying NEXT-GFP fusion gene This study
 pET-Linker-taCA Expression plasmid carrying (GGGGS)2 linker-taCA gene This study
 pET-MBP-taCA Expression plasmid carrying MBP-taCA fusion gene This study
 pET-GST-taCA Expression plasmid carrying GST-taCA fusion gene This study
 pET-Fh8-taCA Expression plasmid carrying Fh8-taCA fusion gene This study
 pET-NEXT-taCA Expression plasmid carrying NEXT-taCA fusion gene This study
 pET-PETase Expression plasmid carrying isPETase gene This study
 pET-Linker-PETase Expression plasmid carrying (GGGGS)2 linker-isPETase gene This study
 pET-MBP-PETase Expression plasmid carrying MBP-isPETase fusion gene This study
 pET-Fh8-PETase Expression plasmid carrying Fh8-isPETase fusion gene This study
 pET-NEXT-PETase Expression plasmid carrying NEXT-isPETase fusion gene This study
 pET-ΔN19-hmCA Expression plasmid carrying hmCA gene with N-terminal truncation (ΔN19) This study
 pET-ΔN36-hmCA Expression plasmid carrying hmCA gene with N-terminal truncation (ΔN36) This study
 pET-ΔN52-hmCA Expression plasmid carrying hmCA gene with N-terminal truncation (ΔN52) This study
 pET-NEXTC16-GFP Expression plasmid carrying NEXTC16-GFP fusion gene This study
 pET-NEXTC16-hEGF Expression plasmid carrying NEXTC16-hEGF fusion gene This study
 pET-NEXTC16-taCA Expression plasmid carrying NEXTC16-taCA fusion gene This study
 pET-NEXT-only Expression plasmid carrying NEXT tag gene This study
Primer
 MBP Forward, CATATGAAAATCGAAGAAGGTAAACTGG; reverse, CCATGGAGCCTCCACCGCCGCTGCCACCTCCGCCAGTCTGCGCGTCTTTC This study
 GST Forward, CATATGTCCCCTATACTAGGTTATTGG; reverse, CCATGGAGCCTCCACCGCCGCTGCCACCTCCGCCATCCGATTTTGGAGGATGG This study
 NEXT Forward, CATATGGCTGTTCAACATAGCAATGCCCC; reverse (fusion tag), CCATGGAGCCTCCACCGCCGCTGCCACCTCCGCCCACAACGGGTTTTGGTTTAG; reverse (NEXT only), CTCGAGCACAACGGGTTTTGGTTTAGG This study
 hEGF Forward (no fusion), CATATGAACTCTGACTCCGAATGC; forward (linker fusion), CATATGGGCGGAGGTGGCAGCGGCGGTGGAGGCTCCATGGGCAACTCTGACTCCGAATG; reverse, CTCGAGACGCAGTTCC This study
 GFP Forward (no fusion), CATATGAGTAAAGGAGAAGAACTTTTCAC; forward (linker fusion), CATATGGGCGGAGGTGGCAGCGGCGGTGGAGGCTCCATGGGCAGTAAAGGAGAAGAACTTTTCACTG; forward (tag fusion), CCATGGGCAGTAAAGGAGAAGAACTTTTCACTG; reverse, CTCGAGTTTGTAGAGCTCATCCATGC This study
 taCA Forward (linker fusion), CATATGGGCGGAGGTGGCAGCGGCGGTGGAGGCTCCATGGGTGGTGGCGCTCATTG; forward (tag fusion), CCATGGGTGGTGGCG; reverse, CTCGAGCTTCATCACTTTAC This study
 isPETase Forward (no fusion), CATATGCAGACCAATCCGTATGCG; forward (linker fusion), CATATGGGCGGAGGTGGCAGCGGCGGTGGAGGCTCCATGGGCCAGACCAATCCGTATGCG; reverse, CTCGAGGGAACAGTTCGC This study
 Truncated hmCA Forward (ΔN19, NEXTC33), CATATGCACAAGGAGGCAGCTCCC; forward (ΔN36, NEXTC16), CATATGGCCGCGGAAGCCAAA; forward (ΔN52), CATATGCATAACCCACATTGGTCTTATT; reverse, CTCGAGGTAATATTGATAGTAACGGTGATC This study
Open in a new tab
a

Strr, streptomycin resistance; Ampr, ampicillin resistance. In primer sequences, restriction sites are underlined and the (GGGGS)2 linker regions are italicized.

Expression of recombinant proteins.

Recombinant E. coli BL21(DE3) strains transformed with the constructed vectors were incubated at 37°C in LB medium with 50 μg/mL ampicillin in the shaking incubator. Protein expression was induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) (Duchefa Biochemie, Netherlands) to a final concentration of 1 mM (at 37°C) or 10 μM (at 25°C) when the optical density at 600 nm (OD600) reached 0.6 to 0.8. For the expression of taCA variants, 0.1 mM ZnSO4 (Junsei, Japan) was also added to the culture medium. After cultivation for 10 h at 37°C or for 20 h at 25°C, the cells were collected by centrifugation at 4,000 × g at 4°C for 10 min. The cells were resuspended in lysis buffer (50 mM sodium phosphate, 300 mM NaCl, and 10 mM imidazole [pH 8.0]) and disrupted with an ultrasonic dismembrator (Sonics and Materials, USA) in ice water. After centrifugation of the lysate at 10,000 × g at 4°C for 10 min, the supernatant was removed, and the soluble fraction was designated; the remaining debris was designated the insoluble fraction.

Purification of recombinant proteins.

The soluble fraction of the cell lysate was mixed with Ni2+-nitrilotriacetic acid agarose beads (Qiagen, USA), and the His6-tagged recombinant proteins were purified by immobilized metal affinity chromatography (IMAC) according to the manufacturer’s instructions. The enzymes were eluted using elution buffer (50 mM sodium phosphate, 300 mM NaCl, and 250 mM imidazole [pH 8.0]). The eluates were thoroughly dialyzed against 20 mM sodium phosphate buffer (pH 7.5) with or without 300 mM NaCl. After dialysis was completed, the protein precipitates were removed by centrifugation at 10,000 × g at 4°C for 10 min. The supernatants were used for subsequent activity and stability tests. In some cases, the enzyme buffer was further exchanged with 20 mM Tris-sulfate buffer (pH 8.3).

Protein analyses.

For protein quantification, the purified enzyme was denatured in denaturing buffer (6 M guanidine hydrochloride-20 mM sodium phosphate buffer [pH 7.5]), and the absorbance of the denatured protein was measured at 280 nm. The protein concentration was determined using the measured absorbance and the molar extinction coefficient at 280 nm for each protein calculated by ProtParam (http://web.expasy.org/protparam) (38). Proteins were separated and visualized by SDS-PAGE followed by Coomassie brilliant blue R-250 (Bio-Rad, USA) staining. For Western blotting, the proteins were blotted onto a nitrocellulose membrane (Whatman, UK), and sequential treatment with anti-His6 monoclonal antibody (ABM, Canada) and alkaline phosphatase-conjugated anti-mouse IgG (Bethyl Laboratories, USA) was performed. The His6-tagged recombinant proteins were visualized on the membrane by the alkaline phosphatase-mediated chromogenic reaction using the substrate nitroblue tetrazolium (NBT)-5‐bromo‐4‐chloro‐3‐indolyl phosphate (BCIP) (Sigma‐Aldrich, USA). The percentage of soluble expression was estimated by densitometric analysis of the band intensities of soluble and insoluble fractions on the protein gel performed using ImageJ.

Activity and stability tests for taCA variants.

CA activity was measured by a colorimetric CO2 hydration assay (39, 40). The purified enzyme in 20 mM phosphate buffer (pH 7.5) was diluted to a concentration of 1 μM, and 10 μL of sample was added to a disposable cuvette containing 600 μL of 20 mM Tris buffer (pH 8.3) supplemented with 100 μM phenol red. The reaction was performed at 4°C inside the spectrometer by adding 400 μL of CO2-saturated deionized water prepared in ice-cold water. The absorbance change was monitored at 570 nm. The time (t) required for the absorbance to drop from 1.2 (corresponding to pH 7.5) to 0.18 (corresponding to pH 6.5) was measured. The time (t0) for the uncatalyzed reaction was also measured by adding a corresponding blank buffer sample instead of an enzyme sample. The Wilbur-Anderson unit was calculated as (t0 − t)/t. For the stability test, the enzyme sample was incubated for 1 h at 90°C and the residual enzyme activity was measured. Relative residual activity was calculated based on the activity of the untreated sample.

CD spectroscopy.

The CD spectrum was recorded on a CD spectropolarimeter (Jasco, Japan). The purified solution of the NEXT tag in 20 mM phosphate buffer (pH 7.5) was scanned at 25°C in a quartz crystal cuvette with a 2-mm path length (Hellma Analytics, Germany) for the far-UV region (190 to 250 nm). Based on the CD spectrum, secondary structural elements were analyzed using BeStSel (41).

In silico calculations.

Protein parameters, including amino acid length, molecular weight, net charge, and pI, were calculated by ProtParam (38). Phosphorylation sites were predicted by NetPhos v3.1 (https://services.healthtech.dtu.dk/service.php?NetPhos-3.1) (42). The Kyte-Doolittle hydropathy index was calculated by ProtScale (https://web.expasy.org/protscale) using a window size of 5, and the values were averaged to obtain a mean hydropathy index (38, 43). Sequence-based prediction of protein solubility was performed by the modified Wilkinson-Harrison method (27) and SOLpro (http://scratch.proteomics.ics.uci.edu) (28). Disordered protein regions were predicted by IUPred2A (https://iupred2a.elte.hu) (44), PONDR (http://www.pondr.com) (45), and DISpro (http://scratch.proteomics.ics.uci.edu) (46).

Data availability.

The nucleotide sequences are available in the GenBank database under the accession numbers MZ337388 (MBP), MT364377 (GST), AF213970 (Fh8), BBN60101 (hmCA), M15672 (hEGF), KX980038 (GFP), and MH636009 (taCA). The protein sequence of isPETase is available in the PDB under the accession code 7OSB. All data generated during this study will be made available on request.

ACKNOWLEDGMENTS

This work was supported by the Korea Institute of Energy Technology Evaluation and Planning (KETEP) grant 20182010600430, funded by the Ministry of Trade, Industry, and Energy, South Korea, and by National Research Foundation grants NRF-2020M3A9I5037642, NRF-2021R1F1A1057310, and NRF-2021R1A5A8029490, funded by the Ministry of Science and ICT, South Korea.

The author declares no conflict of interest.

Footnotes

Supplemental material is available online only.

Supplemental file 1
Tables S1 and S2. Download aem.00097-22-s0001.pdf, PDF file, 0.1 MB (107.4KB, pdf)

Contributor Information

Byung Hoon Jo, Email: jobh@gnu.ac.kr.

Haruyuki Atomi, Kyoto University.

REFERENCES

  • 1.Rosano GL, Ceccarelli EA. 2014. Recombinant protein expression in Escherichia coli: advances and challenges. Front Microbiol 5:172. 10.3389/fmicb.2014.00172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Sorensen HP, Mortensen KK. 2005. Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli. Microb Cell Fact 4:1. 10.1186/1475-2859-4-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Singh A, Upadhyay V, Upadhyay AK, Singh SM, Panda AK. 2015. Protein recovery from inclusion bodies of Escherichia coli using mild solubilization process. Microb Cell Fact 14:41. 10.1186/s12934-015-0222-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Costa S, Almeida A, Castro A, Domingues L. 2014. Fusion tags for protein solubility, purification, and immunogenicity in Escherichia coli: the novel Fh8 system. Front Microbiol 5:63. 10.3389/fmicb.2014.00063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Esposito D, Chatterjee DK. 2006. Enhancement of soluble protein expression through the use of fusion tags. Curr Opin Biotechnol 17:353–358. 10.1016/j.copbio.2006.06.003. [DOI] [PubMed] [Google Scholar]
  • 6.Yang J, Han YH, Im J, Seo SW. 2021. Synthetic protein quality control to enhance full-length translation in bacteria. Nat Chem Biol 17:421–427. 10.1038/s41589-021-00736-3. [DOI] [PubMed] [Google Scholar]
  • 7.Zhou P, Wagner G. 2010. Overcoming the solubility limit with solubility-enhancement tags: successful applications in biomolecular NMR studies. J Biomol NMR 46:23–31. 10.1007/s10858-009-9371-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Seijsing J, Lindborg M, Hoiden-Guthenberg I, Bonisch H, Guneriusson E, Frejd FY, Abrahmsen L, Ekblad C, Lofblom J, Uhlen M, Graslund T. 2014. An engineered affibody molecule with pH-dependent binding to FcRn mediates extended circulatory half-life of a fusion protein. Proc Natl Acad Sci USA 111:17110–17115. 10.1073/pnas.1417717111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Jo BH, Im SK, Cha HJ. 2018. Halotolerant carbonic anhydrase with unusual N-terminal extension from marine Hydrogenovibrio marinus as novel biocatalyst for carbon sequestration under high-salt environments. J CO2 Util 26:415–424. 10.1016/j.jcou.2018.05.030. [DOI] [Google Scholar]
  • 10.Trevino SR, Scholtz JM, Pace CN. 2008. Measuring and increasing protein solubility. J Pharm Sci 97:4155–4166. 10.1002/jps.21327. [DOI] [PubMed] [Google Scholar]
  • 11.Golovanov AP, Hautbergue GM, Wilson SA, Lian LY. 2004. A simple method for improving protein solubility and long-term stability. J Am Chem Soc 126:8933–8939. 10.1021/ja049297h. [DOI] [PubMed] [Google Scholar]
  • 12.Choi JS, Leong KW, Yoo HS. 2008. In vivo wound healing of diabetic ulcers using electrospun nanofibers immobilized with human epidermal growth factor (EGF). Biomaterials 29:587–596. 10.1016/j.biomaterials.2007.10.012. [DOI] [PubMed] [Google Scholar]
  • 13.Ko H, Kang M, Kim MJ, Yi J, Kang J, Bae JH, Sohn JH, Sung BH. 2021. A novel protein fusion partner, carbohydrate-binding module family 66, to enhance heterologous protein expression in Escherichia coli. Microb Cell Fact 20:232. 10.1186/s12934-021-01725-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kang YS, Song JA, Han KY, Lee J. 2015. Escherichia coli EDA is a novel fusion expression partner to improve solubility of aggregation-prone heterologous proteins. J Biotechnol 194:39–47. 10.1016/j.jbiotec.2014.11.025. [DOI] [PubMed] [Google Scholar]
  • 15.Zheng XM, Wu X, Fu XL, Dai DP, Wang FH. 2016. Expression and purification of human epidermal growth factor (hEGF) fused with GB1. Biotechnol Biotechnol Equip 30:813–818. 10.1080/13102818.2016.1166984. [DOI] [Google Scholar]
  • 16.Kim YS, Lee HJ, Han MH, Yoon NK, Kim YC, Ahn J. 2021. Effective production of human growth factors in Escherichia coli by fusing with small protein 6HFh8. Microb Cell Fact 20:9. 10.1186/s12934-020-01502-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tsien RY. 1998. The green fluorescent protein. Annu Rev Biochem 67:509–544. 10.1146/annurev.biochem.67.1.509. [DOI] [PubMed] [Google Scholar]
  • 18.Jo BH, Seo JH, Cha HJ. 2014. Bacterial extremo-α-carbonic anhydrases from deep-sea hydrothermal vents as potential biocatalysts for CO2 sequestration. J Mol Catal B-Enzym 109:31–39. 10.1016/j.molcatb.2014.08.002. [DOI] [Google Scholar]
  • 19.Parra-Cruz R, Lau PL, Loh HS, Pordea A. 2020. Engineering of Thermovibrio ammonificans carbonic anhydrase mutants with increased thermostability. J CO2 Util 37:1–8. 10.1016/j.jcou.2019.11.015. [DOI] [Google Scholar]
  • 20.Nguyen TKM, Ki MR, Son RG, Pack SP. 2019. The NT11, a novel fusion tag for enhancing protein expression in Escherichia coli. Appl Microbiol Biotechnol 103:2205–2216. 10.1007/s00253-018-09595-w. [DOI] [PubMed] [Google Scholar]
  • 21.Yoshida S, Hiraga K, Takehana T, Taniguchi I, Yamaji H, Maeda Y, Toyohara K, Miyamoto K, Kimura Y, Oda K. 2016. A bacterium that degrades and assimilates poly(ethylene terephthalate). Science 351:1196–1199. 10.1126/science.aad6359. [DOI] [PubMed] [Google Scholar]
  • 22.Son HF, Cho IJ, Joo S, Seo H, Sagong HY, Choi SY, Lee SY, Kim KJ. 2019. Rational protein engineering of thermo-stable PETase from Ideonella sakaiensis for highly efficient PET degradation. ACS Catal 9:3519–3526. 10.1021/acscatal.9b00568. [DOI] [Google Scholar]
  • 23.Taniguchi I, Yoshida S, Hiraga K, Miyamoto K, Kimura Y, Oda K. 2019. Biodegradation of PET: current status and application aspects. ACS Catal 9:4089–4105. 10.1021/acscatal.8b05171. [DOI] [Google Scholar]
  • 24.Kapust RB, Waugh DS. 1999. Escherichia coli maltose-binding protein is uncommonly effective at promoting the solubility of polypeptides to which it is fused. Protein Sci 8:1668–1674. 10.1110/ps.8.8.1668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Harper S, Speicher DW. 2008. Expression and purification of GST fusion proteins. Curr Protoc Protein Sci 52:6.6.1–6.6.28. 10.1002/0471140864.ps0606s52. [DOI] [PubMed] [Google Scholar]
  • 26.Sheldon RA, van Pelt S. 2013. Enzyme immobilisation in biocatalysis: why, what and how. Chem Soc Rev 42:6223–6235. 10.1039/c3cs60075k. [DOI] [PubMed] [Google Scholar]
  • 27.Davis GD, Elisee C, Newham DM, Harrison RG. 1999. New fusion protein systems designed to give soluble expression in Escherichia coli. Biotechnol Bioeng 65:382–388. 10.1002/(SICI)1097-0290(19991120)65:4<382::AID-BIT2>3.0.CO;2-I. [DOI] [PubMed] [Google Scholar]
  • 28.Magnan CN, Randall A, Baldi P. 2009. SOLpro: accurate sequence-based prediction of protein solubility. Bioinformatics 25:2200–2207. 10.1093/bioinformatics/btp386. [DOI] [PubMed] [Google Scholar]
  • 29.Su Y, Zou Z, Feng S, Zhou P, Cao L. 2007. The acidity of protein fusion partners predominantly determines the efficacy to improve the solubility of the target proteins expressed in Escherichia coli. J Biotechnol 129:373–382. 10.1016/j.jbiotec.2007.01.015. [DOI] [PubMed] [Google Scholar]
  • 30.Kramer RM, Shende VR, Motl N, Pace CN, Scholtz JM. 2012. Toward a molecular understanding of protein solubility: increased negative surface charge correlates with increased solubility. Biophys J 102:1907–1915. 10.1016/j.bpj.2012.01.060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Uversky VN. 2019. Intrinsically disordered proteins and their “mysterious” (meta)physics. Front Phys 7:10. 10.3389/fphy.2019.00010. [DOI] [Google Scholar]
  • 32.Santner AA, Croy CH, Vasanwala FH, Uversky VN, Van YY, Dunker AK. 2012. Sweeping away protein aggregation with entropic bristles: intrinsically disordered protein fusions enhance soluble expression. Biochemistry 51:7250–7262. 10.1021/bi300653m. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Grana-Montes R, Marinelli P, Reverter D, Ventura S. 2014. N-terminal protein tails act as aggregation protective entropic bristles: the SUMO case. Biomacromolecules 15:1194–1203. 10.1021/bm401776z. [DOI] [PubMed] [Google Scholar]
  • 34.Hoh JH. 1998. Functional protein domains from the thermally driven motion of polypeptide chains: a proposal. Proteins 32:223–228. 10.1002/(SICI)1097-0134(19980801)32:2<223::AID-PROT8>3.0.CO;2-L. [DOI] [PubMed] [Google Scholar]
  • 35.Uversky VN, Gillespie JR, Fink AL. 2000. Why are “natively unfolded” proteins unstructured under physiologic conditions? Proteins 41:415–427. 10.1002/1097-0134(20001115)41:3<415::AID-PROT130>3.0.CO;2-7. [DOI] [PubMed] [Google Scholar]
  • 36.Srinivasan N, Bhagawati M, Ananthanarayanan B, Kumar S. 2014. Stimuli-sensitive intrinsically disordered protein brushes. Nat Commun 5:5145. 10.1038/ncomms6145. [DOI] [PubMed] [Google Scholar]
  • 37.Cha HJ, Wu CF, Valdes JJ, Rao G, Bentley WE. 2000. Observations of green fluorescent protein as a fusion partner in genetically engineered Escherichia coli: monitoring protein expression and solubility. Biotechnol Bioeng 67:565–574. 10.1002/(SICI)1097-0290(20000305)67:5<565::AID-BIT7>3.0.CO;2-P. [DOI] [PubMed] [Google Scholar]
  • 38.Wilkins MR, Gasteiger E, Bairoch A, Sanchez JC, Williams KL, Appel RD, Hochstrasser DF. 1999. Protein identification and analysis tools in the ExPASy server. Methods Mol Biol 112:531–552. 10.1385/1-59259-584-7:531. [DOI] [PubMed] [Google Scholar]
  • 39.Jo BH, Moon H, Cha HJ. 2020. Engineering the genetic components of a whole-cell catalyst for improved enzymatic CO2 capture and utilization. Biotechnol Bioeng 117:39–48. 10.1002/bit.27175. [DOI] [PubMed] [Google Scholar]
  • 40.Wilbur KM, Anderson NG. 1948. Electrometric and colorimetric determination of carbonic anhydrase. J Biol Chem 176:147–154. 10.1016/S0021-9258(18)51011-5. [DOI] [PubMed] [Google Scholar]
  • 41.Micsonai A, Wien F, Bulyaki E, Kun J, Moussong E, Lee YH, Goto Y, Refregiers M, Kardos J. 2018. BeStSel: a web server for accurate protein secondary structure prediction and fold recognition from the circular dichroism spectra. Nucleic Acids Res 46:W315–W322. 10.1093/nar/gky497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Blom N, Gammeltoft S, Brunak S. 1999. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol 294:1351–1362. 10.1006/jmbi.1999.3310. [DOI] [PubMed] [Google Scholar]
  • 43.Kyte J, Doolittle RF. 1982. A simple method for displaying the hydropathic character of a protein. J Mol Biol 157:105–132. 10.1016/0022-2836(82)90515-0. [DOI] [PubMed] [Google Scholar]
  • 44.Meszaros B, Erdos G, Dosztanyi Z. 2018. IUPred2A: context-dependent prediction of protein disorder as a function of redox state and protein binding. Nucleic Acids Res 46:W329–W337. 10.1093/nar/gky384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Romero P, Obradovic Z, Li X, Garner EC, Brown CJ, Dunker AK. 2001. Sequence complexity of disordered protein. Proteins 42:38–48. 10.1002/1097-0134(20010101)42:1<38::AID-PROT50>3.0.CO;2-3. [DOI] [PubMed] [Google Scholar]
  • 46.Cheng J, Sweredoski MJ, Baldi P. 2005. Accurate prediction of protein disordered regions by mining protein structure data. Data Min Knowl Discov 11:213–222. 10.1007/s10618-005-0001-y. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Tables S1 and S2. Download aem.00097-22-s0001.pdf, PDF file, 0.1 MB (107.4KB, pdf)

Data Availability Statement

The nucleotide sequences are available in the GenBank database under the accession numbers MZ337388 (MBP), MT364377 (GST), AF213970 (Fh8), BBN60101 (hmCA), M15672 (hEGF), KX980038 (GFP), and MH636009 (taCA). The protein sequence of isPETase is available in the PDB under the accession code 7OSB. All data generated during this study will be made available on request.

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES