Mechanistic Insight into the Fragmentation of Type I Collagen Fibers into Peptides and Amino Acids by a Vibrio Collagenase

ABSTRACT

Vibrio collagenases of the M9A subfamily are closely related to Vibrio pathogenesis for their role in collagen degradation during host invasion. Although some Vibrio collagenases have been characterized, the collagen degradation mechanism of Vibrio collagenase is still largely unknown. Here, an M9A collagenase, VP397, from marine Vibrio pomeroyi strain 12613 was characterized, and its fragmentation pattern on insoluble type I collagen fibers was studied. VP397 is a typical Vibrio collagenase composed of a catalytic module featuring a peptidase M9N domain and a peptidase M9 domain and two accessory bacterial prepeptidase C-terminal domains (PPC domains). It can hydrolyze various collagenous substrates, including fish collagen, mammalian collagens of types I to V, triple-helical peptide [(POG)₁₀]₃, gelatin, and 4-phenylazobenzyloxycarbonyl-Pro-Leu-Gly-Pro-o-Arg (Pz-peptide). Atomic force microscopy (AFM) observation and biochemical analyses revealed that VP397 first assaults the C-telopeptide region to dismantle the compact structure of collagen and dissociate tropocollagen fragments, which are further digested into peptides and amino acids by VP397 mainly at the Y-Gly bonds in the repeating Gly-X-Y triplets. In addition, domain deletion mutagenesis showed that the catalytic module of VP397 alone is capable of hydrolyzing type I collagen fibers and that its C-terminal PPC2 domain functions as a collagen-binding domain during collagenolysis. Based on our results, a model for the collagenolytic mechanism of VP397 is proposed. This study sheds light on the mechanism of collagen degradation by Vibrio collagenase, offering a better understanding of the pathogenesis of Vibrio and helping in developing the potential applications of Vibrio collagenase in industrial and medical areas.

IMPORTANCE Many Vibrio species are pathogens and cause serious diseases in humans and aquatic animals. The collagenases produced by pathogenic Vibrio species have been regarded as important virulence factors, which occasionally exhibit direct pathogenicity to the infected host or facilitate other toxins’ diffusion through the digestion of host collagen. However, our knowledge concerning the collagen degradation mechanism of Vibrio collagenase is still limited. This study reveals the degradation strategy of Vibrio collagenase VP397 on type I collagen. VP397 binds on collagen fibrils via its C-terminal PPC2 domain, and its catalytic module first assaults the C-telopeptide region and then attacks the Y-Gly bonds in the dissociated tropocollagen fragments to release peptides and amino acids. This study offers new knowledge regarding the collagenolytic mechanism of Vibrio collagenase, which is helpful for better understanding the role of collagenase in Vibrio pathogenesis and for developing its industrial and medical applications.

INTRODUCTION

Collagen comprises ∼30% of the total protein mass of mammals and is the major protein of the extracellular matrix (ECM) (1). Among the 28 types of collagens (2), the most predominant is type I collagen, which forms the structural basis of many connective tissues such as skin, bone, and tendon (3). Type I collagen has a hierarchical structure, and its smallest unit is tropocollagen, which is composed of three intertwined α-chains (two α1 and one α2 chains). Each chain contains repeating Gly-X-Y triplets, where X and Y are frequently proline and hydroxyproline, respectively. The N and C termini of the triple-helical region of tropocollagen are nonhelical, where the N- and C-telopeptides are formed, respectively (1). Microfibrils are composed of five tropocollagens (4, 5), which are regularly interdigitated with each other and assembled into fibrils by covalent cross-links (6). Collagen fibrils further organize to form collagen fibers or higher-order structures by interdigitation with proteoglycans in the ECM (7, 8).

Due to its complex and compact structure and its insolubility in water, native collagen can be degraded by only a few proteases under physiological conditions, mainly found in animals or microorganisms (9). Studies have proposed diverse mechanisms for collagenases. Collagenases of animals reported so far are some members of the M10A, C1, and S1 families in the MEROPS database (10). Mammalian matrix metalloproteinases (MMPs) from the M10A family have been widely studied for their importance in maintaining normal collagen homeostasis in tissues (11). Among them, MMP-1, MMP-8, and MMP-13 split native triple-helical collagen into 1/4- and 3/4-length fragments at a single peptide bond with a glycine at P1 and a leucine or isoleucine at P1′ (12, 13). Bacterial collagenolytic proteases are distributed in the M9, S1, and S8 families. These proteases are usually prone to attacking the collagen chain at multiple sites and eventually digest it into small peptides, thus providing nutrients for bacterial survival and facilitating host colonization (9, 14). Most well-known bacterial collagenases belong to the M9 family, including Vibrio collagenases belonging to the M9A subfamily and Hathewaya (previously Clostridium) collagenases belonging to the M9B subfamily (14, 15). Among them, the most studied is the Hathewaya collagenase ColG. However, although a “chew-and-digest” model for ColG to degrade triple-helical collagen molecules or collagen microfibrils has been proposed (16), how collagen fibers are degraded by Hathewaya collagenases is still largely unknown.

The Vibrio genus contains more than 110 species, of which at least 12 species are pathogens that cause infections in animals and humans (17, 18). For example, Vibrio cholerae is the etiological agent of the severe diarrheal disease cholera (19). Vibrio parahaemolyticus and Vibrio vulnificus are the main causes of seafood-associated infections of humans, which can rapidly lead to gastroenteritis, wound infections, and septicemia (20–22). Pathogenic Vibrio species produce various extracellular virulence factors, including enterotoxin, hemolysin, cytotoxin, protease, collagenase, phospholipase, siderophores, and hemagglutinin (17). Among them, the extracellular collagenases can directly digest host collagen-containing tissues or indirectly assist in the diffusion of other toxic factors (17). However, our knowledge regarding Vibrio collagenase’s collagenolysis is still rather limited. Vibrio collagenase is usually a multidomain protein consisting of a catalytic module containing a peptidase M9N domain and a peptidase M9 domain, up to one polycystic kidney disease-like domain (PKD-like domain), and up to two bacterial prepeptidase C-terminal domains (PPC domains) (9). Collagenase V from Vibrio alginolyticus (23) initially hydrolyzes triple-helical collagen at the Y-Gly bond and generates 3/4 (N-terminal) and 1/4 fragments (24), just like MMP-1/MMP-8/MMP-13. The collagenase VPM from Vibrio parahaemolyticus not only is capable of digesting insoluble type I collagen but also exhibits cytotoxicity and fish pathogenicity, which indicates its direct role in Vibrio pathogenesis (25). The collagenase VMC from Vibrio mimicus contains only a catalytic module, whose C-terminal repeated FAXWXXT motif has been demonstrated to be involved in collagen binding and unwinding (26–29). In addition, the PPC domain of the collagenase Ghcol from Grimontia (Vibrio) hollisae (30) has been shown to function as a collagen-binding domain (CBD) (31). Despite these studies, it is still largely unknown how Vibrio collagenases degrade the insoluble and structurally complex collagen fibers into peptides and amino acids.

Marine Vibrio pomeroyi strain 12613 is a protease-secreting bacterium isolated from Atlantic surface seawater, which has been reported to secrete an M4 metalloprotease, VP9, that has the collagen-swelling ability (32). In this study, a gene encoding an M9A collagenase, vp397, was cloned from the genome of strain 12613 and expressed in Escherichia coli. Mature VP397 is composed of a catalytic module and two accessory PPC domains. We characterized protease VP397 and further investigated its mechanism of insoluble type I collagen fiber fragmentation by atomic force microscopy (AFM) observation and biochemical assays. Finally, a model for the fragmentation pattern of VP397 on insoluble type I collagen fibers is proposed.

RESULTS

Sequence analysis of VP397.

Based on genome analysis, a gene (GenBank accession no. MZ773560) encoding a putative M9A collagenase was found in Vibrio pomeroyi strain 12613, a protease-secreting bacterium isolated from Atlantic surface seawater (32), which was named vp397 in this study. Gene vp397 is 2,457 bp in length and encodes a protein (VP397) of 818 amino acid residues with a calculated molecular mass of 91.60 kDa. The amino acid sequence of VP397 shows identity to several representative members in the MEROPS M9A subfamily: 67.47% to VMC (type M09.004; GenBank accession no. AAC23708.1) from Vibrio mimicus (26) and 29.89% to collagenase V (type M09.001; accession no. CAA44501.1) from Vibrio alginolyticus (23). Sequence analysis against the Conserved Domain Database and signal peptide prediction by SignalP 5.0 showed that the precursor of VP397 comprises a predicted signal peptide (Met1 to Ala27), a peptidase M9N domain (Gln28 to Glu298), a peptidase M9 domain (Gly299 to Pro567), and two PPC domains (PPC1 domain, Thr568 to Gln702; PPC2 domain, Gln703 to His818) (Fig. 1A). The peptidase M9N domain and the peptidase M9 domain form the catalytic module of VP397 (Fig. 1A). Thus, VP397 has the typical architecture of a Vibrio collagenase.

FIG 1.

Architecture of the VP397 precursor and biochemical characterization of VP397 using gelatin as the substrate. (A) Schematic diagram of the domain structure of the VP397 precursor. (B) SDS-PAGE analysis of purified VP397. Lane M, protein molecular mass markers. Purified VP397 is indicated by an arrow. (C) Effect of temperature on VP397 activity. Enzyme activity was measured in buffer A from 0°C to 80°C. The specific activity of VP397 at 40°C was taken as 100%. (D) Effect of temperature on VP397 stability. VP397 was incubated at 40°C, 45°C, and 50°C for different times, and the residual activity was measured at 40°C at pH 8.0. The specific activity of VP397 incubated for 0 min was taken as 100%. (E) Effect of pH on VP397 activity. Enzyme activity was measured at 40°C in Britton-Robinson buffer from pH 3.0 to 12.0. The specific activity of VP397 at pH 8.0 was taken as 100%. (F) Effect of NaCl on VP397 activity. Enzyme activity was measured at 40°C at pH 8.0 in 0 to 4.0 M NaCl. The specific activity of VP397 in 0 M NaCl was taken as 100%. The graphs show data from triplicate experiments (means ± standard deviations [SD]).

Expression and characterization of VP397.

Recombinant VP397 was expressed in E. coli BL21(DE3) cells and purified. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis showed that purified VP397 displayed an apparent molecular mass of approximately 89 kDa (Fig. 1B). The N-terminal sequence of purified VP397 was determined to be 28-QSQCEVLD-35, which indicates that the predicted signal peptide of 27 residues (Met1 to Ala27) is cleaved off during enzyme maturation. Thus, the mature form of VP397 consists of 791 amino acid residues (Gln28 to His818), including the catalytic module and two PPC domains, and a calculated molecular mass of 88.70 kDa.

With gelatin as the substrate, VP397 showed the highest activity at 40°C (Fig. 1C) and was stable at this temperature in 60 min (Fig. 1D). However, VP397 retained <40% of its maximal activity after 20 min of incubation at 45°C and completely lost its activity after 10 min of incubation at 50°C (Fig. 1D). VP397 displayed the highest enzyme activity at pH 8.0 (Fig. 1E) and showed low tolerance to NaCl, losing almost 60% activity in 2 M NaCl (Fig. 1F). The effects of metal ions and inhibitors on VP397 activity were also investigated (Table 1). VP397 activity was severely inhibited by more than 95% by 2 mM Fe²⁺, Cu²⁺, and Zn²⁺, and 2 mM Co²⁺, Mn²⁺, Sn²⁺, and Ni²⁺ significantly inhibited the enzyme activity by 70% or more (Table 1). VP397 activity was also strongly inhibited by metal ion chelators such as o-phenanthroline (o-P), EDTA, and EGTA, supporting that VP397 is a metalloprotease (Table 1). Various types of collagenous substrates were used to determine the substrate specificity of VP397 (Table 2). VP397 showed noticeable activity on several types of collagens, including fish collagen and mammalian collagens of types I to V. In addition, VP397 could hydrolyze triple-helical peptide [(POG)₁₀]₃, gelatin (the degenerated form of collagen), and the synthetic collagenase substrate 4-phenylazobenzyloxycarbonyl-Pro-Leu-Gly-Pro-o-Arg (Pz-peptide). However, VP397 showed no activity toward casein. These results showed that VP397 has broad specificity for various collagenous substrates.

TABLE 1.

Effects of metal ions and inhibitors on VP397 activity^a

Metal ion or inhibitorb	Mean relative activity (%) ± SD
Control	100.00 ± 3.30
Metal ions
Ca2+	89.08 ± 2.01
Sr2+	69.14 ± 8.17
Li+	66.05 ± 8.34
Ba2+	65.98 ± 3.56
K+	63.92 ± 10.70
Mg2+	59.88 ± 9.09
Co2+	30.23 ± 2.65
Mn2+	28.31 ± 6.54
Sn2+	28.14 ± 1.30
Ni2+	18.57 ± 0.65
Fe2+	4.83 ± 0.89
Cu2+	2.52 ± 0.44
Zn2+	1.72 ± 0.44
Inhibitors
PMSF	63.60 ± 4.08
o-P	0.88 ± 0.29
EGTA	0.19 ± 0.06
EDTA	0.07 ± 0.20

^aThe gelatinolytic activity of VP397 without any metal ion or inhibitor in the reaction system was taken as a control (100%). The data shown are from triplicate experiments (means ± SD).

^bPMSF, p-amidinophenylmethylsulfonyl fluoride; o-P, o-phenanthroline.

TABLE 2.

Substrate specificity of VP397

Substrate	Mean sp acta (U/mg) ± SD
Fish collagen	133.34 ± 14.36
Bovine type I collagen from Achilles’ tendon	11.94 ± 0.44
Bovine type II collagen from nasal septum	99.32 ± 13.25
Human type III collagen from placenta	41.97 ± 8.26
Human type IV collagen from placenta	111.82 ± 16.19
Human type V collagen from placenta	14.37 ± 3.57
Triple-helical peptide [(POG)10]3	143.82 ± 15.23
Gelatin	50.31 ± 8.17
Pz-peptide	325.32 ± 5.62
Casein	ND

^aThe specific activity of VP397 toward each substrate was measured in buffer A at 37°C for fish or mammalian collagens, 25°C for triple-helical peptide [(POG)₁₀]₃, and 40°C for gelatin, Pz-peptide, or casein. The data shown are from triplicate experiments (means ± SD). One unit of enzyme activity was defined as the amount of enzyme that released 1 μmol leucine from collagens (fish or mammalian collagens) or [(POG)₁₀]₃ in 1 h or from gelatin in 1 min. For Pz-peptide, 1 U of enzyme activity was defined as the enzyme amount that increased 0.1 U of the absorbance at 320 nm per min. One unit of caseinolytic activity was defined as the amount of enzyme that released 1 μg tyrosine equivalents from casein in 1 min. ND, the enzyme activity was not detectable.

Observation and biochemical analysis of type I collagen degradation by VP397.

When insoluble type I collagen fibers (5 mg) were incubated with 5 μM VP397 at 30°C for 24 h with continuous stirring, it was clearly observed that the insoluble collagen fibers gradually reduced and finally disappeared (Fig. 2A), indicating the decomposition of the insoluble collagen fibers by VP397. We further observed collagen fibers treated with 5 μM VP397 at 30°C for 12 h by AFM. Compared to the compact structure of collagen fibers treated with buffer A (50 mM Tris-HCl [pH 8.0]) (Fig. 2B), the collagen fibers treated with VP397 for 12 h were devastated and dissociated into broken collagen fibrils (Fig. 2C), which were further digested into small pieces of tropocollagen fragments (Fig. 2D and E).

FIG 2.

Observation of type I collagen degradation by VP397. (A) Time-dependent degradation of collagen fibers by VP397. Insoluble type I collagen fibers (5 mg) were incubated with 5 μM VP397 at 30°C for 24 h with continuous stirring. Collagen incubated with buffer A was used as a control. (B to E) AFM observation of the collagen fibers treated with buffer A (B) or 5 μM VP397 for 12 h (C to E). Broken collagen fibrils were dissociated from collagen fibers (C) and degraded into small pieces of tropocollagen fragments (D and E) after treatment with VP397 at 30°C with continuous stirring. Bars, 1 μm. Panels B and C are peak force error images, and panels D and E are height images. The inset in panel D is the corresponding peak force error image of panel D.

The mechanism for collagen fiber decomposition by VP397 was further probed by biochemical assays. Because proteoglycans, which consist of core proteins and glycosaminoglycans (GAGs), are responsible for the stabilization of the interfibrillar organization in collagen fibers (8, 33), we first investigated whether VP397 is capable of degrading proteoglycans to dissociate collagen fibrils from the fibers. SDS-PAGE analysis showed that decorin, the typical and most abundant proteoglycan in collagen fibers (8, 33), could not be digested by VP397 (Fig. 3A). However, increasing numbers of GAGs with increasing treatment times were found in the supernatant of the reaction mixture when collagen fibers were treated with VP397 (Fig. 3B), suggesting that the disintegration of collagen fibers by VP397 led to the release of proteoglycans from the fibers into the supernatant, rather than GAGs being released via the degradation of the core proteins of proteoglycans by VP397. In addition to proteoglycans, covalent cross-links within fibrils are also involved in maintaining the strength and stability of collagen fibrils (6). The major cross-links are believed to occur in the overlap position between the telopeptides and the triple-helical regions of adjacent collagen molecules, where hydroxylysyl pyridinoline and lysyl pyridinoline are formed (6, 34). Trypsin is not capable of digesting the triple-helix structure of tropocollagen but specifically degrades the nonhelical telopeptides and releases hydroxylysyl pyridinoline and lysyl pyridinoline (35, 36), which can produce a specific fluorescence emission peak at around 400 nm under excitation at 325 nm (37). Figure 3C shows that the products from VP397-treated type I collagen fibers produce a fluorescence emission peak similar to that produced by the products from trypsin-treated collagen fibers at around 400 nm, indicating that hydroxylysyl pyridinoline and lysyl pyridinoline were released from VP397-treated collagen fibers. This suggested that the covalent cross-links between telopeptides and adjacent triple-helical molecules were destroyed by VP397. The destruction of covalent cross-links within collagen fibrils led to the dissociation of tropocollagen fragments, as observed in Fig. 2D and E.

FIG 3.

Enzymatic degradation of the cross-links in collagen fibers by VP397. (A) SDS-PAGE analysis of decorin degradation by VP397 at 37°C. Lane M, protein molecular mass marker; lanes 0, 0.5, and 1, decorin treated with 1 μM trypsin, VP397, or buffer A for 0 h, 0.5 h, and 1 h. The graph shows data that are representative of results from triplicate experiments. (B) Contents of GAGs released from collagen fibers treated with VP397 at 30°C for 24 h. Collagen fibers treated with buffer A were used as the control. The graph shows data from triplicate experiments (means ± SD). (C) Fluorescence spectrum analysis of hydroxylysyl pyridinoline and lysyl pyridinoline released from collagen fibers. Collagen fibers (5 mg) were incubated with 1 μM VP397, trypsin, or buffer A at 30°C for 36 h. Hydroxylysyl pyridinoline and lysyl pyridinoline in the supernatant of the digested mixture were detected by fluorescence spectra with an excitation wavelength of 325 nm. The graph shows data that are representative of results from triplicate experiments.

Several experiments were then carried out to investigate the further degradation of triple-helical tropocollagen by VP397. The triple-helical structure of collagen displays a typical spectrum with a positive peak at approximately 221 nm when detected by circular dichroism (CD) spectroscopy (28). As a control, the acid-soluble collagen treated with trypsin that has no activity on triple-helical collagen exhibited a small decrease in the positive peak of the triple-helical structure similar to that of the collagen treated with buffer A (Fig. 4A). In contrast, the collagen treated with VP397 exhibited a noticeably larger decrease in the peak (Fig. 4A). This suggested that VP397 could hydrolyze tropocollagen molecules to destroy their triple-helical structure. Consistently, SDS-PAGE analysis showed that VP397 could digest the α1 and α2 chains of tropocollagen molecules in the acid-soluble collagen solution into peptides, but trypsin could not (Fig. 4B). Moreover, the number of amino acids/peptides in the supernatant of the reaction mixture increased with increasing treatment times when collagen fibers were treated with VP397 based on ninhydrin chromogenic detection (Fig. 4C), and a variety of free amino acids, especially the unique hydroxyproline and hydroxylysine of collagen, were detected in the supernatant of the reaction mixture by an automatic amino acid analyzer (Table 3). Taken together, these results indicate that VP397 is capable of hydrolyzing triple-helical tropocollagen into peptides and amino acids, which is consistent with its evident activity against collagenous triple-helical peptide [(POG)₁₀]₃ (Table 2).

FIG 4.

Degradation of triple-helical tropocollagen molecules by VP397. (A) Effect of VP397 on the triple-helical structure of tropocollagen molecules detected by CD spectroscopy. Acid-soluble collagen dialyzed against 10 mM Tris-HCl (pH 8.0) was incubated with buffer A (control), 0.5 μM trypsin, or 0.5 μM VP397 at 25°C for 60 min. (B) SDS-PAGE analysis of the degradation of tropocollagen α1 and α2 chains by VP397. Acid-soluble collagen dialyzed against 10 mM Tris-HCl (pH 8.0) was incubated with 0.5 μM VP397 or 0.5 μM trypsin at 25°C for 60 min. The data shown in panels A and B are representative of results from triplicate experiments. (C) Contents of amino acids/peptides released from collagen fibers treated with VP397 at 30°C for 24 h. Collagen fibers treated with buffer A were used as the control. The graphs show data from triplicate experiments (means ± SD).

TABLE 3.

Free amino acids released from collagen fibers by VP397

Amino acidb	Mean concn (ng/μL) ± SDa
	Control	VP397
Ala	0.64 ± 0.06	39.92 ± 1.61
Arg	0.50 ± 0.05	16.49 ± 9.44
Gly	0.73 ± 0.20	28.05 ± 3.45
His	ND	5.72 ± 0.77
Leu	0.97 ± 0.17	2.35 ± 0.32
Lys	0.15 ± 0.13	6.83 ± 2.53
Met	ND	160.85 ± 13.44
Phe	ND	9.14 ± 0.87
Tyr	ND	116.85 ± 9.66
Val	2.13 ± 0.19	15.37 ± 10.59
Hyp	ND	3.23 ± 1.13
Hyl	ND	10.31 ± 0.72

^aCollagen fibers (10 mg) were treated with 5 μM VP397 at 30°C for 12 h with continuous stirring. Concentrations of free amino acids in the supernatant of the digested mixture were determined by an automatic amino acid analyzer. Collagen fibers incubated with buffer A served as the control. ND, the amino acid concentration was not detectable.

^bHyp, hydroxyproline; Hyl, hydroxylysine.

Analysis of the cleavage sites of VP397 on type I tropocollagen.

To further analyze the cleavage sites of VP397 on type I tropocollagen, we used nano-liquid chromatography-mass spectrometry (LC-MS) to separate and identify the peptides released from insoluble type I collagen fibers by VP397. Finally, 83 peptides released from the N- and C-terminal nonhelical telopeptides (see Table S1 in the supplemental material) and 58 peptides released from the triple-helical region (see Table S2 in the supplemental material) of tropocollagen were obtained. Based on the sequences of these released peptides, 64 cleavage sites on the α1 chain (Fig. 5A) and 66 cleavage sites on the α2 chain (Fig. 5B) of tropocollagen were determined. Intriguingly, ∼70% of the released peptides are from the C-telopeptide, suggesting that the frequency of cleavage sites on this region is high. The C-telopeptide region is nonhelical and exposed on the surface of collagen fibrils (4, 5). The high frequency of cleavage sites on the C-telopeptide indicates that VP397 likely initiates an attack on this region, leading to the efficient dissociation of tropocollagen fragments. Based on the determined cleavage sites on the triple-helical region of tropocollagen, the residue frequencies at the P1 and P1′ sites were analyzed (Table 4). VP397 showed an almost strict preference for Gly at the P1′ position and a clear preference for Pro, Ala, Arg, Lys, Ser, and Val at the P1 position, indicating that VP397 prefers to cleave the Y-Gly bonds in the repeating Gly-X-Y triplets in the peptide chains of tropocollagen.

FIG 5.

The cleavage sites of VP397 in tropocollagen α1 (A) and α2 (B) chains. The N- and C-telopeptides are underlined. The cleavage sites are indicated by arrows.

TABLE 4.

Residue frequency of VP397 at the P1 and P1′ sites in type I tropocollagen triple-helical-region degradation

Amino acid	Frequency of residues
	P1			P1′
	α1	α2	Total	α1	α2	Total
Pro	32	28	60	3	2	5
Ala	16	35	51	5	2	7
Arg	16	13	29
Lys	21	3	24		1	1
Ser		22	22		2	2
Val	10	10	20
Gly	9	1	10	101	118	219
Gln	6	3	9	1		1
Met		5	5
Glu	2	1	3		1	1
Asn	2		2
Thr	2		2
Asp		2	2
Phe		2	2
Leu		1	1	2		2
Ile				4		4

Collagen-binding ability of the PPC2 domain.

To study the function of the PPC domains in VP397 collagenolysis, a PPC-truncated mutant, ΔPPCs (Met1 to Pro567, lacking both the PPC1 domain and the PPC2 domain), was constructed. Compared to VP397, ΔPPCs retained >97% activity toward Pz-peptide but only ∼60% activity toward type I collagen fibers (Fig. 6A), suggesting that the PPC domains play a role in the degradation of collagen fibers but not in Pz-peptide degradation.

FIG 6.

Analysis of the collagen-binding abilities of the two PPC domains. (A) Activities of VP397 and ΔPPCs toward type I collagen fibers and Pz-peptide. The specific activities of VP397 toward collagen fibers (1,059.10 ± 39.15 U/μmol) and Pz-peptide (28,855.56 ± 498.78 U/μmol) were taken as 100%. (B) Observation of the binding abilities of EGFP, EGFP-PPC1, EGFP-PPC2, and EGFP-PPC1-PPC2 on collagen fibers. Twelve milligrams of type I collagen fibers was incubated with 12.5 μM EGFP, EGFP-PPC1, EGFP-PPC2, or EGFP-PPC1-PPC2 at 30°C for 2 h with continuous stirring. After centrifugation, the samples were washed with distilled water three times. (C) Fluorescence analysis of the collagen-binding abilities of the PPC1 and PPC2 domains. EGFP, EGFP-PPC1, EGFP-PPC2, or EGFP-PPC1-PPC2 was mixed with different amounts of collagen fibers at 30°C for 2 h with continuous stirring, and the fluorescence intensity changes in the reaction supernatant were quantified. The graphs show data from triplicate experiments (means ± SD).

It has been reported that the PPC domains from the M4 and S8 peptidases have collagen-binding and collagen-swelling abilities (38), and those from the M9 collagenases have been identified as CBDs (39, 40). Therefore, we expressed the two PPC domains of VP397 in E. coli and investigated their ability to bind and swell collagen fibers. However, neither the PPC1 nor the PPC2 domain showed collagen-swelling ability. The binding ability of the PPC1 and PPC2 domains on insoluble collagen fibers was investigated by fluorescence analysis. The two PPC domains were expressed as enhanced green fluorescent protein (EGFP)-fused proteins, and EGFP, EGFP-PPC1, EGFP-PPC2, and EGFP-PPC1-PPC2 were then incubated with 12 mg type I collagen fibers at 30°C for 2 h with continuous stirring. Compared with the white collagen fibers treated with EGFP or EGFP-PPC1, the collagen fibers treated with EGFP-PPC2 and EGFP-PPC1-PPC2 showed significant yellowing (Fig. 6B), suggesting that the ability of the PPC1 domain to bind to collagen fibers is negligible and that the binding ability of the PPC2 domain is strong. Consistently, after incubation of the EGFP-fused proteins with different amounts (0 to 12 mg) of collagen fibers for 2 h, the fluorescence intensity in the supernatant of the reaction mixture containing EGFP or EGFP-PPC1 showed no significant change, but that of the reaction mixture containing EGFP-PPC2 or EGFP-PPC1-PPC2 decreased with increasing collagen fiber amounts in the mixture (Fig. 6C), indicating that the amounts of EGFP-PPC2 and EGFP-PPC1-PPC2 bound to collagen fibers increased with the amount of collagen fibers in the reaction mixtures. Taken together, these results indicated that the C-terminal PPC2 domain of VP397 is likely to function as a CBD during collagen degradation by VP397. The PPC domain of Hathewaya collagenase ColG, a homologue of VP397-PPC2, has been shown to target the undertwisted region of triple-helical collagen as the binding site (41, 42). Thus, VP397-PPC2 may have a binding preference similar to ColG-PPC on the collagen nonhelical region to facilitate the initial attack of VP397 on the nonhelical C-telopeptide, which warrants further confirmation. The intermediate PPC1 domain of VP397 that shows low identity (23%; 37% coverage) to the PPC2 domain and has no collagen-swelling or -binding ability may function as a linker between the catalytic module and the PPC2 domain in VP397 collagenolysis, which, however, needs further confirmation.

A model for the fragmentation pattern of VP397 on insoluble type I collagen fibers.

Based on the above-described results, a model for the fragmentation pattern of VP397 on insoluble type I collagen fibers is proposed in three steps (Fig. 7): (i) VP397 molecules first bind on collagen fibrils via their PPC2 domains; (ii) the nonhelical C-telopeptide exposed on the surface of collagen fibrils is initially broken down by VP397, resulting in the disassembly of collagen fibrils and the dissociation of tropocollagen fragments; and (iii) tropocollagen fragments are further hydrolyzed into small peptides and amino acids due to the attack of VP397 on the Y-Gly sites in the repeating Gly-X-Y triplets.

FIG 7.

Schematic model of type I collagen fiber degradation by VP397. VP397 molecules bind on collagen fibrils via their PPC2 domains and initiate the enzymatic hydrolysis of the nonhelical C-telopeptide exposed on the fibril surface, leading to the dissociation of tropocollagen fragments. Subsequently, VP397 molecules hydrolyze the dissociated tropocollagen fragments into small peptides and amino acids by attacking the Y-Gly peptide bonds.

DISCUSSION

Vibrio collagenases have been attracting broad attention because those of pathogenic Vibrio species, which directly digest collagen components in the host ECM to assist in bacterial colonization and the diffusion of other toxic factors, are regarded as important virulence factors (17). However, although a number of Vibrio collagenases have been characterized, it remains largely unknown how the structurally complex collagen is degraded by Vibrio collagenases. In this study, we characterized a Vibrio collagenase, VP397, from Vibrio pomeroyi strain 12613 and further investigated the fragmentation pattern of VP397 on insoluble type I collagen, the most widely occurring collagen in mammalian bodies (3).

Collagenolytic proteases that possess the ability to cleave the triple-helical region of collagen molecules in a physiological context are widely distributed in different peptidase families, and their collagen degradation mechanisms are diverse. MMP-1 of the M10A family, which is composed of a catalytic domain with a catalytic cleft of ∼5 Å, a hinge region, and a C-terminal hemopexin (HPX)-like domain, hydrolyzes the nonhelical C-telopeptide at the outer edge of the fibril to expose the cleavage site of the adjacent collagen monomer in the initial fibrillar collagenolysis (5). The subsequent collagenolysis of the triple-helical collagen monomer (∼15 Å in diameter) by MMP-1 relies on the recognition and unwinding of the triple helix with the help of the hinge region and the HPX domain, thus allowing a single peptide chain to fit into the narrow catalytic cleft and be hydrolyzed by the catalytic domain (43–45). For S8 serine collagenolytic proteases such as MCP-01 and myroicolsin, the enzyme first digests proteoglycans in collagen fibers to release fibrils and then digests telopeptide to release collagen monomers, which are further hydrolyzed by the catalytic domain into peptides and amino acids (36, 46). Different from that of MMP-1, the catalytic cavity of MCP-01 is large enough to accommodate a triple-helical collagen monomer, and its catalytic domain alone can hydrolyze triple-helical collagen (46). Correspondingly, the C-terminal PKD-like domain following the catalytic domain of MCP-01 has only collagen-binding ability but no collagen-unwinding ability (47, 48). For the Hathewaya collagenase ColG of the M9B subfamily, based on the chew-and-digest model (16), the collagenase module of ColG consisting of the activator and peptidase domains can switch between the open and closed states. Initial collagen docking is accomplished by the peptidase domain in the open state. Followed by a closing movement, the triple-helical molecule interacts with both the activator and peptidase domains and is consequently unwound and progressively cleaved. In this study, based on AFM observations and biochemical analyses, it was found that Vibrio collagenase VP397 of the M9A subfamily that has no activity on proteoglycans is likely to initially attack the C-telopeptide of type I collagen fibers to release tropocollagen fragments, which are further progressively cleaved into peptides and amino acids by VP397 in a manner of cleaving the Y-Gly bonds in the repeating Gly-X-Y triplets. The PPC2 domain has collagen-binding ability and is likely to function as a CBD during VP397 collagenolysis. However, neither the PPC1 nor the PPC2 domain has collagen-swelling ability, which suggests that the catalytic module of VP397 alone has the ability to degrade triple-helical collagen. Indeed, the catalytic module of VP397 has 60% collagenolytic activity compared to the intact enzyme. However, due to the lack of structural information on Vibrio collagenase, how triple-helical tropocollagen is unwound and hydrolyzed by the catalytic module of VP397 awaits further study.

In conclusion, this study reveals the collagen degradation mechanism of Vibrio collagenase VP397, providing new insights into Vibrio collagenases of the M9A subfamily. The mechanism of M9A collagenase-mediated collagen degradation has significant implications for understanding the role of Vibrio collagenase as a virulence factor in the pathogenesis of Vibrio. In addition, while Hathewaya collagenases of the M9B subfamily have been widely used in industrial and medical applications, such as in the food (49) and tannery (50, 51) industries, the debridement of wounds (52), the treatment of Dupuytren’s disease (53, 54), and the isolation of islet cell (55, 56), the current industrial and medical applications of Vibrio collagenases are still limited. It has been reported that Vibrio collagenase Ghcol has the potential to isolate primary cells (57). Vibrio collagenase VMC and its repeated FAXWXXT motif show potential for safe pharmacological vitreolysis (28, 29). Compared with Hathewaya collagenase, the wound debridement agent prepared with Vibrio collagenase V is mild in local wound treatment (58, 59). The results of this study will be helpful in further developing the applications of Vibrio collagenases.

MATERIALS AND METHODS

Materials and strains.

Vibrio pomeroyi strain 12613 was originally isolated from Atlantic surface seawater and cultivated at 15°C in medium containing 1% (wt/vol) peptone, 0.5% (wt/vol) yeast extract, and artificial seawater (pH 8.0). E. coli strains DH5α and BL21(DE3) were purchased from Vazyme (China) and cultivated at 37°C in lysogeny broth (LB) medium. pET-22b(+) (Novagen, Germany) was used for the construction of expression vectors. Type I collagen from bovine Achilles’ tendon was purchased from Worthington (USA). Type II collagen from bovine nasal septum, collagens of types III to V from human placenta, gelatin, casein, Pz-peptide, and decorin were purchased from Sigma (USA). Collagenous triple-helical peptide [(POG)₁₀]₃ was purchased from the Peptide Institute, Inc. (Japan). Fish collagen was extracted from codfish skin using a method described previously by Chen et al. (60). Acid-soluble collagen was prepared using a method described previously by Wang et al. (48), with minor modifications. Briefly, insoluble bovine type I collagen fibers were dissolved in 0.5 M acetic acid by adding an appropriate amount of pepsin (Solarbio, China). Next, the acid-soluble collagen was dialyzed against 10 mM Tris-HCl (pH 8.0) at 4°C for 12 h for further biochemical experiments.

Gene cloning and protein expression and purification.

Genomic DNA of strain 12613 was extracted using a bacterial genomic DNA extraction kit (BioTeke, China). The vp397 gene (GenBank accession no. MZ773560) encoding a putative M9A collagenase was cloned from the genomic DNA of strain 12613 via PCR. The obtained fragment was inserted into the pET-22b(+) vector to construct the expression plasmid pET-22b-vp397. The DNA fragment encoding mutant ΔPPCs (the PPC1 and PPC2 domain-truncated mutant [Met1 to Pro567]) of VP397 was conducted with the plasmid pET-22b-vp397 as the template by PCR amplification. The EGFP gene (egfp) amplified from the plasmid pEGFP-N1 (Novagen, Germany) and DNA fragments encoding the PPC1 (Thr568 to Gln702), PPC2 (Gln703 to His818), and PPC1-PPC2 (Thr568 to His818) domains of VP397 were overlapped by overlap extension PCR (61). The chimeric genes were subcloned into pET-22b(+) for the expression of the fusion proteins EGFP-PPC1, EGFP-PPC2, and EGFP-PPC1-PPC2. The primers used in this study are listed in Table 5.

TABLE 5.

Primers used in this study

Gene product	Primer	Sequence (5′–3′)
VP397	VP397-F	AAGAAGGAGATATACATATGTCTCATAACCGTTTATTTC
	VP397-R	TGGTGGTGGTGGTGCTCGAGGTGAAAATACACCAACATCT
ΔPPCs	ΔPPCs-F	AAGAAGGAGATATACATATGTCTCATAACCGTTTATTTC
	ΔPPCs-R	TGGTGGTGGTGGTGCTCGAGAGGCTCTGTGGGTTCACTTG
EGFP	EGFP-F	AAGAAGGAGATATACATATGGTGAGCAAGGGCGAGGAG
	EGFP-R	TGGTGGTGGTGGTGCTCGAGCTTGTACAGCTCGTCCATGC
EGFP-PPC1	Up-EGFP-PPC1-F	AAGAAGGAGATATACATATGGTGAGCAAGGGCGAGGAG
	Up-EGFP-PPC1-R	GTTGGTTCTGTAGGCTCTGTCTTGTACAGCTCGTCCATGC
	Down-EGFP-PPC1-F	GCATGGACGAGCTGTACAAGACAGAGCCTACAGAACCAAC
	Down-EGFP-PPC1-R	TGGTGGTGGTGGTGCTCGAGTTGAGTTGGAGGCGTTGGCG
EGFP-PPC2	Up-EGFP-PPC2-F	AAGAAGGAGATATACATATGGTGAGCAAGGGCGAGGAG
	Up-EGFP-PPC2-R	GGTGTTAAGTCATCTTGCTGCTTGTACAGCTCGTCCATGC
	Down-EGFP-PPC2-F	GCATGGACGAGCTGTACAAGCAGCAAGATGACTTAACACC
	Down-EGFP-PPC2-R	TGGTGGTGGTGGTGCTCGAGGTGAAAATACACCAACATCT
EGFP-PPC1-PPC2	Up-EGFP-PPC1-PPC2-F	AAGAAGGAGATATACATATGGTGAGCAAGGGCGAGGAG
	Up-EGFP-PPC1-PPC2- R	GTTGGTTCTGTAGGCTCTGTCTTGTACAGCTCGTCCATGC
	Down-EGFP-PPC1-PPC2-F	GCATGGACGAGCTGTACAAGACAGAGCCTACAGAACCAAC
	Down-EGFP-PPC1-PPC2-R	TGGTGGTGGTGGTGCTCGAGGTGAAAATACACCAACATCT

All expression plasmids were transferred into E. coli BL21(DE3), and the recombinant strains were cultured at 37°C in LB medium. When the optical density of the cells at 600 nm reached 0.8, the cells were induced at 15°C for 16 h by the addition of 0.35 mM isopropyl β-d-1-thiogalactopyranoside (IPTG). The E. coli cells were then collected and disrupted by a high-pressure cell cracker (JNBio, China). All recombinant proteins in the cell extracts were first purified by affinity chromatography with Ni²⁺-nitrilotriacetic acid (NTA) resin (GE Healthcare, USA), followed by anion exchange chromatography using a Source 15Q column (GE Healthcare, USA) and gel filtration using a Superdex G200 column (GE Healthcare, USA) equilibrated with a buffer containing 10 mM Tris-HCl (pH 8.0) and 100 mM NaCl. The protein purity was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the protein concentration was determined by using the bicinchoninic acid (BCA) protein assay kit (Thermo Scientific, USA) with bovine serum albumin (BSA) as the standard. N-terminal amino acid sequencing of purified VP397 was performed on the Procise491 sequencer (Applied Biosystems, USA) by the method of Edman degradation.

Enzyme assay.

The activity of VP397 was measured using the colorimetric ninhydrin method described previously by Li et al. (62), with gelatin as the substrate. The optimum temperature for VP397 activity was determined in a range from 0°C to 80°C in buffer A. To study the thermal stability of the enzyme, VP397 was preincubated at 40°C, 45°C, and 50°C for different periods from 0 to 60 min, and the residual activity was measured at 40°C at pH 8.0. The optimum pH for VP397 activity was determined at 40°C in Britton-Robinson buffer ranging from pH 3.0 to 12.0. The effect of NaCl on VP397 activity was determined at NaCl concentrations ranging from 0 to 4.0 M at 40°C at pH 8.0. The effects of metal ions and inhibitors on VP397 activity were measured at 40°C at pH 8.0 after the enzyme solution was preincubated with each inhibitor or metal ion at a concentration of 2 mM at 4°C for 1 h. The substrate specificity of VP397 was determined with fish collagen, bovine collagens of types I and II, human collagens of types III to V, triple-helical peptide [(POG)₁₀]₃, gelatin, casein, and Pz-peptide. For type I collagen or fish collagen, a mixture of 5 mg of the substrate and 1 mL of the enzyme solution was incubated at 37°C in buffer A for 5 h with continuous stirring. For type II to V collagens, a mixture of 0.25 mg of the substrate and 0.05 mL of the enzyme solution was incubated at 37°C in buffer A for 1 h with continuous stirring. Triple-helical peptide [(POG)₁₀]₃ was dissolved in buffer A to reach a concentration of 8 mg/mL and then stored at 4°C for 24 h (41). Afterward, 5 μL of the enzyme solution was mixed with 5 μL of the substrate solution, and the mixture was incubated at 25°C for 0.5 h. The reaction was stopped by the addition of 10 μL of 1.25 M trichloroacetic acid. The released amino acids/peptides were quantified using the colorimetric ninhydrin method with l-leucine as the standard (63). One unit is defined as the release of 1 μmol leucine equivalents from collagens (fish or mammalian collagens) or [(POG)₁₀]₃ in 1 h or from gelatin in 1 min. The proteolytic activity on casein was measured at 40°C in buffer A with the Folin-Ciocalteu method as described previously by He et al. (64). One unit of caseinolytic activity was defined as the amount of enzyme that released 1 μg tyrosine equivalents from casein in 1 min. The proteolytic activity on Pz-peptide was measured according to the methods of Wuensch and Heidrich (65) and Miyake et al. (66). One unit of enzyme activity is defined as the enzyme amount that increased 0.1 U of the absorbance at 320 nm per min.

Observation of the process of collagen degradation by VP397.

Insoluble type I collagen fibers (5 mg) were incubated with 5 μM VP397 or buffer A (control) at 30°C for 24 h with continuous stirring, and the samples were photographed at different times. Collagen fibers treated with 5 μM VP397 or buffer A at 30°C for 12 h with continuous stirring were further observed by AFM. The sample was rinsed with distilled water, spread onto freshly cleaved mica, and dried in the air for 30 min. All imaging was carried out in ScanAsyst mode using a multimode Nanoscope VIII AFM instrument (Bruker AXS, Germany) with a J-type scanner.

Biochemical analysis of collagen degradation by VP397.

Five milligrams of insoluble type I collagen fibers was treated with 5 μM VP397 at 30°C for 24 h with continuous stirring. Collagen fibers incubated with buffer A were used as the control. The amino acids/peptides in the supernatant released from collagen fibers were quantitatively detected by the colorimetric ninhydrin method (63) with l-leucine as the standard. The GAGs in the supernatant of the digested mixture were quantitatively detected by the dimethylmethylene blue assay (67). To test whether VP397 could degrade proteoglycans, decorin (0.5 mg), a typical proteoglycan in collagen fibers, was incubated with 1 μM VP397 at 37°C for 0, 0.5, and 1 h, and the digested product was analyzed by SDS-PAGE. Decorin incubated with 1 μM trypsin or buffer A was used as the control. To detect the release of hydroxylysyl pyridinoline and lysyl pyridinoline from covalent cross-links within collagen fibrils, collagen fibers (5 mg) were incubated with 1 μM VP397 at 30°C for 36 h, and the fluorescence spectrum in the supernatant of the digested mixture was detected on an FP-6500 spectrometer (Jasco, Japan) at an excitation wavelength of 325 nm, as described previously by Fujimoto (37). Collagen fibers incubated with 1 μM trypsin or buffer A were used as the controls. To detect the release of amino acids from collagen fibers by VP397, 10 mg of collagen fibers was treated with 5 μM VP397 at 30°C for 12 h with continuous stirring, and the concentrations of free amino acids in the supernatant were analyzed using the L-8900 automatic amino acid analyzer (Hitachi, Japan). The destruction of the triple-helical structure of collagen by VP397 was detected by CD spectroscopy according to a method described previously (36). Briefly, acid-soluble collagen (1 mg/mL) after dialysis with 10 mM Tris-HCl (pH 8.0) was incubated with 0.5 μM VP397 at 25°C for 0, 15, 30, and 60 min. Collagen solutions incubated with 0.5 μM trypsin and with buffer A without any enzyme were used as the controls. After incubation, the CD spectra of the samples were detected using a J1500 spectropolarimeter (Jasco, Japan) at 25°C, which were recorded from 250 nm to 210 nm at a scan rate of 200 nm/min with a bandwidth of 1 nm. Baselines were recorded with 10 mM Tris-HCl (pH 8.0) containing the corresponding concentrations of the enzyme and were subtracted from the respective sample spectra. To detect the hydrolysis of the α1 and α2 chains of tropocollagen by VP397, acid-soluble collagen (0.5 mg/mL) after dialysis with 10 mM Tris-HCl (pH 8.0) was incubated with 0.5 μM VP397 at 25°C for 0, 15, 30, or 60 min, and the hydrolytic products were analyzed by SDS-PAGE. A collagen solution treated with 0.5 μM trypsin under the same conditions was used as the control.

Analysis of the cleavage sites of VP397 on type I tropocollagen.

Insoluble type I collagen fibers (5 mg) were incubated with 5 μM VP397 in buffer A at 30°C for 12 h with continuous stirring, and the reaction was stopped by the addition of 1% trifluoroacetic acid. The molecular masses of the released peptides in the reaction mixture were determined by using a nano-LC system (Easy-nLC; Thermo Scientific, USA) equipped with a 1,000,000-FWHM (full width at half-maximum) high-resolution Nano Orbitrap Fusion Lumos Tribrid mass spectrometer system (Thermo Scientific, USA). The sequences of these released peptides were identified using Proteome Discoverer software 2.3 (Thermo Scientific, USA) with the Sequest HT search engine. The amino acid sequence database includes the sequences of Bos taurus type I collagen α1 (UniProtKB accession no. P02453) and α2 (UniProtKB accession no. P02465) chains, with the N- and C-terminal propeptides being removed.

Collagen-swelling and collagen-binding assays.

Insoluble type I collagen fibers (5 mg) were incubated with 12.5 μM EGFP-PPC1 or EGFP-PPC2 in 1 mL buffer A at 30°C for 2 h with continuous stirring. The collagen-swelling effect of the two PPC domains is based on visual inspection. As for the collagen-binding assay, 12 mg insoluble type I collagen fibers was incubated with 0.5 mL EGFP, EGFP-PPC1, EGFP-PPC2, or EGFP-PPC1-PPC2 (12.5 μM) in buffer A at 30°C for 2 h with continuous stirring. After centrifugation, the precipitated collagen was rinsed with distilled water three times. To further analyze the binding ability of the PPC1 and the PPC2 domains toward collagen, 12.5 μM EGFP and fusion proteins (EGFP-PPC1, EGFP-PPC2, and EGFP-PPC1-PPC2) were incubated with various amounts of insoluble type I collagen fibers (0, 4, 8, and 12 mg) in buffer A at 30°C for 2 h with continuous stirring. After incubation, the free fluorescence intensity in the supernatant was determined on an FP-6500 spectrofluorometer (Jasco, Japan) at an excitation wavelength of 489 nm and an emission wavelength of 510 nm.

Accession number(s).

The nucleotide sequence encoding VP397 has been deposited in the GenBank database under accession no. MZ773560.