Abstract
To improve the outcome of gastric cancer, novel markers that predict postoperative prognosis are required. For this purpose, the function of cellular retinoic acid binding protein 1 (CRABP1) in gastric cancer cells was investigated and it was determined whether it serves as a novel biomarker for gastric cancer. Reverse transcription-quantitative (RT-q) PCR and a PCR-array method were used to determine whether the expression of CRABP1 mRNA in gastric cancer cell lines correlated with the expression of cancer-related genes. The correlations of CRABP1 mRNA expression in tissues with clinicopathological factors of 230 patients who underwent radical gastrectomy were further evaluated. CRABP1 mRNA levels varied among gastric cancer cell lines and showed significant positive correlations with numerous epithelial-mesenchymal transition factors. Additionally, CRABP1 knockdown significantly suppressed the proliferation, migration and invasion of gastric cancer cell lines. In a mouse xenograft model of peritoneal metastasis of gastric cancer, it was found that the total weight of disseminated nodules was lower in the group, in which CRABP1 mRNA levels were knocked down compared with those of the untransfected group. Disease-free survival (DFS) was significantly shorter in patients with high expression of CRABP1, and multivariate analysis of DFS revealed that high expression of CRABP1 in the tumor area and lymph node metastasis served as an independent factor associated with poor prognosis. High expression of CRABP1 in cancer tissues was associated with a greater incidence of peritoneal recurrences after curative gastrectomy. These findings indicated that CRABP1 contributes to the malignant phenotype of gastric cancer cells and may serve as a biomarker for prognosing recurrence after curative resection, particularly peritoneal dissemination.
Keywords: gastric cancer, cellular retinoic acid binding protein 1, peritoneal recurrence, biomarker, expression
Introduction
The poor prognosis of gastric cancer contributes to its ignominious standing as the second-leading worldwide cause of cancer-related death with an 8.2% mortality rate in 2018 (1). Gastric cancer, which is clinically and molecularly heterogeneous (2,3), is characterized by the pathways of recurrent metastasis as follows: peritoneal dissemination, hematogenous metastasis and lymph node metastasis. Unfortunately, specific biomarkers for these metastatic pathways are unavailable, hindering the prediction of recurrence when patients undergo standardized adjuvant chemotherapy and postoperative surveillance. Furthermore, the particularly poor prognosis of gastric cancer with peritoneal dissemination may prevent administration of effective treatment.
Efforts to develop effective therapeutic strategies to improve the prognosis of gastric cancer require detailed analyses of the molecular biological mechanisms that determine the malignant phenotypes of gastric cancer cells. In addition, novel markers that predict postoperative prognosis, particularly recurrence, are urgently required. In the present study, genes specifically expressed in association with the metastatic potential of gastric cancer were searched. To this end, comprehensive analyses of genes expressed in tissues of patients with simultaneous distant metastasis were conducted. It was found that cellular retinoic acid-binding protein 1 (CRABP1) may serve as a new candidate biomarker. CRABP1, a member of the family of fatty acid-binding proteins, modulates the activity of retinoic acid (4). However, the expression of CRABP1 in gastric cancer or its involvement in oncogenesis and tumor progression is unknown.
In the present study, the function of CRABP1 was investigated by regulating its expression in gastric cancer cell lines and by evaluating the correlation of the expression of CRABP1 in primary gastric cancer tissues with long-term outcomes and the type of recurrence after curative resection.
Materials and methods
Ethics
The present study was approved (approval no. 2014-0043) by the Institutional Review Board of Nagoya University (Nagoya, Japan) and conformed to the ethical guidelines of the World Medical Association Declaration of Helsinki (2013) Ethical Principles for Medical Research Involving Human Subjects. Written informed consent for use of clinical samples and data, as required by the Institutional Review Board, was obtained from all patients.
Transcriptome analysis
Surgically resected gastric tissues from four patients with liver metastasis were subjected to transcriptome analysis. Global expression profiling was conducted using the HiSeq platform (Illumina, Inc.) to compare the expression levels of 57,749 genes in primary gastric cancer tissues with those of the corresponding noncancerous adjacent gastric mucosa as previously described (5).
Sample collection
A total of 14 gastric cancer cell lines (AGS, GCIY, IM95, KATO III, MKN1, MKN7, MKN45, MKN74, NUGC2, NUGC3, NUGC4, N87, OCUM1 and SC-6-JCK) were obtained from the American Type Culture Collection (ATCC) or the Japanese Collection of Research Bioresources Cell Bank. Cells were cultured at 37°C in RPMI-1640 medium (FUJIFILM Wako Pure Chemical Corporation) supplemented with 10% fetal bovine serum (Corning, Inc.) in an atmosphere containing 5% CO2. The non-tumorigenic epithelial cell line FHs74 (ATCC) was used as a control. Primary gastric cancer tissues and corresponding normal adjacent tissues were collected from 300 patients who underwent gastric resection for gastric cancer without neoadjuvant therapy at Nagoya University Hospital (Nagoya, Japan) between January 2001 and December 2020. Tissue samples were immediately flash-frozen in liquid nitrogen and stored at −80°C. Tissue comprising >80% tumor components (H&E staining) without grossly visible necrotic regions (~5 mm2) was extracted from each tumor sample. Corresponding normal adjacent gastric mucosa samples were obtained from the same patient and were collected >5 cm from the tumor edge.
Specimens were histologically classified according to the guidelines of the Union for International Cancer Control (UICC), 8th edition (6). To determine whether the expression of CRABP1 differed according to tumor histology, patients were categorized into the histological subtypes of their tumors as follows: differentiated (papillary, well differentiated, and moderately differentiated adenocarcinoma) and undifferentiated (poorly differentiated adenocarcinoma, signet ring cell, and mucinous carcinoma). Since 2006, adjuvant chemotherapy using S-1 (an oral fluorinated pyrimidine) has been administered to all patients with gastric cancer with UICC stages II-III, unless contraindicated by the condition of the patient (7,8).
CRABP1 mRNA levels in primary gastric cancer tissues and corresponding normal adjacent tissues from 300 patients with gastric cancer were evaluated using the reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Patients included 84 women and 216 men, ranging in age from 26-96 years (mean, 70 years). Patients included those with pathologically diagnosed undifferentiated (n=181) or differentiated gastric cancer (n=119). Patients were diagnosed with stage I (n=50), stage II (n=71), stage III (n=109), or stage IV (n=70) gastric cancer and 230 patients with stages I-III under- went R0 resection. Patients classified with UICC stage IV (n=56 of 70) were assigned this diagnosis due to positive peritoneal lavage cytology, localized peritoneal metastasis, or distant lymph node metastasis. Among patients with stage IV disease, 12 had synchronous liver metastasis and 2 had lung metastasis. These patients underwent gastrectomy to control bleeding or allow ingestion of food.
Expression of CRABP1 mRNA
CRABP1 mRNA levels in cell lines and clinical samples (n=300) were analyzed using RT-qPCR with an ABI StepOnePlus Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). Total RNA (10 µg per sample) was purified using RNeasy Plus Mini kit (cat. no. 74136; Qiagen GmbH) according to the manufacturer's protocol. Complementary DNAs were generated using the M-MLV Reverse Transcriptase (cat. no. 28025013; Thermo Fisher Scientific, Inc.), dNTPs Mix (cat. no. U1511; Promega Corporation), the Primer Random pd(N)6 (11034731001, Roche Diagnostics) and RNase inhibitor (cat. no. 3335399001; Roche Diagnostics) according to the manufacturer's protocol, and amplified using primers specific for CRABP1 (Table I). RT-qPCR was performed using the SYBR-Green PCR Core reagents kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) and absolute quantification was performed using the standard curve method. The following thermocycling conditions were used for qPCR: one cycle at 95°C for 10 min, 40 cycles at 95°C for 5 sec, and 60°C for 60 sec. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA served as an internal standard, and the expression level of each sample was determined in triplicate and calculated as the value of CRABP1 mRNA divided by that of GAPDH mRNA (9).
Table I.
Sequences of primers and siRNAs.
| Primer name | Experiment | Primer sequence (5′→3′) | Product size (base pairs) | Annealing temperature (°C) |
|---|---|---|---|---|
| CRABP1 | RT-qPCR | F: CAAAACCTACTGGACCCGTG | 91 | 60 |
| R: CCGGACATAAATTCTGGTGC | ||||
| siRNA | siCRABP1-1: AGUUUAAUGACUUCGAAACCG | |||
| siCRABP1-2: UUGAAGUUGAUCUCAGUGGTT | ||||
| GAPDH | RT-qPCR | F: GAAGGTGAAGGTCGGAGTC | 221 | 60 |
| Probe: CAAGCTTCCCGTTCTCAGCC | ||||
| R: GAAGATGGTGATGGGATTTC |
CRABP1, cellular retinoic acid-binding protein 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-qPCR, quantitative real-time reverse-transcription polymerase chain reaction; siRNA, small interfering RNA; F, forward; R, reverse.
Expression of genes encoding proteins that potentially interact with CRABP1
To identify genes coordinately expressed with CRABP1 in gastric cancer cell lines, PCR array analysis was performed using the Human Epithelial to Mesenchymal Transition (EMT) RT2 Profiler PCR Array (Qiagen GmbH). This array profiles the expression of 84 key genes including those that encode transcription factors, ECM proteins as well as proteins involved in the EMT, cell differentiation, morphogenesis, growth, proliferation, migration, cytoskeleton and major signaling pathways (10).
siRNA-mediated knockdown of CRABP1 mRNA
A total of two siRNAs specific for CRABP1 were designed at online sites and were pooled to inhibit CRABP1 mRNA expression with the aim of obtaining stable knockdown as previously described (Table I) (11,12). siCRABP1-1 and siCRABP1-2 were designed by siDirect (http://sidirect2.rnai.jp/) and i-Score Designer (https://www.med.nagoya-u.ac.jp/neurogenetics/i_Score/i_score.html), respectively, and supplied from Hokkaido System Science Co., Ltd. MKN1, MKN45 and NUGC4 cells were added to the wells of a 24-well plate (5×104 cells/ml) and transiently transfected at 37°C the next day with 30 nM or CRABP1 siRNA or a control siRNA (siControl with sequence as follows: 5′-GCA AAC AUC CCA GAG GUA U-3′) combined with LipoTrust EX Oligo (Hokkaido System Science Co., Ltd.); total RNAs were extracted 72 h later. To evaluate the effect of siRNAs on CRABP1 mRNA expression, RT-qPCR analysis was performed as previously described (11,12). In addition, the knockdown efficacy of siCRABP1-1 or siCRABP1-2 alone in MKN1, MKN45 and NUGC4 cells was evaluated.
Cell proliferation, invasion, and migration assays
Cell proliferation was evaluated using the Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc.) as previously described (11). MKN1, MKN45 and NUGC4 cells (at a density of 1.5×103, 1.5×103 and 5×103 cells per well, respectively) were seeded into 96-well plates in RPMI-1640 medium supplemented with 2% FBS. Cell invasion was determined using BioCoat Matrigel invasion chambers (BD Biosciences,) according to the manufacturer's protocol as previously described (13). MKN1 and MKN45 cells (2.5×104 cells/well) were suspended in serum-free RPMI-1640 and seeded in the upper chamber. After an appropriate incubation time (24 and 72 h, respectively), cells present on the surface of the membrane were fixed, stained, and counted using a light microscope in eight randomly selected fields as previously described (13). Cell migration was evaluated using wound-healing assays as previously described (14). The width of the wound was measured at 100-µm intervals (20 measurements per well, ×400 magnification). The invasion and migration assays were performed in duplicate (n=2; two wells for each assay). For the invasion assay, 8 fields were randomly selected from each well and numbers of invasive cells were counted. Thus, statistical analysis was carried out using 16 values for the untransfected, siControl and siCRABP1 groups. For the migration assay, the width of the wound was measured at 20 points for each well, indicating that statistical analysis was carried out using 40 values for the untransfected, siControl and siCRABP1 groups.
Mouse xenograft models of peritoneal metastasis
Animal experiments were performed between October and December 2021 according to the ARRIVE guidelines (15) and were approved (approval no. M210414-001) by the Animal Research Committee of Nagoya University (Nagoya, Japan). A total of 10 six-week-old male NOD/SCID (weight, 24.7 g) and 2 BALBc nu/nu mice (weight, 20.4 g) were obtained from Japan SLC, Inc. and housed at least 1 week before experiments in temperature-controlled rooms at 20-22°C with free access to food and water supply and a light/dark cycle of 14/10 h. MKN1 and NUGC4 cells transfected with CRABP1 siRNA or untransfected were implanted into the abdominal cavity of six-week-old male mice (MKN1: n=5 each, NUGC4: n=1 each) to analyze the peritoneal dissemination of the xenografts. MKN1 and NUGC4 cells (4×106) in 500 µl of phosphate-buffered saline were injected into NOD/SCID and BALBc nu/nu mice, respectively. After 4 weeks of observations, these mice were euthanized after exposure to 100% CO2 for 5 min and were observed for 20 min after confirmation of respiration cease. The flow rate of CO2 was 50% of the chamber volume per min. After confirming euthanasia, the formation of peritoneal metastasis was observed under direct viewing.
Clinical significance of CRABP1 expression
The optimal cut-off value (0.0000325) of CRABP1 mRNA levels in primary gastric cancer tissues was determined using receiver operating characteristic curve analysis for evaluating the significance of the association of their levels with metastasis or recurrence. Patients were stratified according to the cut-off value of CRABP1 mRNA levels in gastric cancer tissues as follows: high CRABP1 expression (>cut-off value) and low CRABP1 expression (≤cut-off value). Correlations between the patterns of CRABP1 mRNA expression and clinicopathological parameters were evaluated. Correlation analysis of CRABP1 mRNA expression and recurrence patterns after curative surgery was applied to 230 patients who underwent curative surgery (i.e., stages I-III). Thus, the analysis of recurrence pattern specifically focused on initial recurrence after curative surgery. Outcome analyses of the overall survival and disease-free survival (DFS) rates and multivariate analysis were applied to 230 patients who underwent curative surgery. To validate the present data, an integrated microarray dataset comprising tissues of 1065 patients [Berlin, Bethesda, and Melbourne datasets (http://kmplot.com/analysis/)] was analyzed as previously described (16).
Statistical analysis
The significance of differences of the relative mRNA levels (CRABP1/GAPDH) between the two groups were analyzed using the Mann-Whitney test. The significance of a correlation between two variables was assessed using the Spearman's rank correlation coefficient. The χ2 test was used to analyze the associations between the expression levels of CRABP1 and clinicopathological parameters. DFS rates were calculated using the Kaplan-Meier method, and the differences in the slopes of the survival curves were analyzed using the log-rank test. Multivariable regression analysis was preformed to identify prognostic factors using the Cox proportional hazards model, and variables with P<0.05 were entered into the final model. All statistical analyses were performed using JMP 15 software (SAS Institute, Inc.). P<0.05 was considered to indicate a statistically significant difference.
Results
Identification of CRABP1 as a candidate gastric cancer-related gene
Transcriptome analysis of gastric tissues compared with corresponding noncancerous adjacent gastric mucosa from four patients with metastatic gastric cancer was first performed. Transcriptome analysis identified 26 candidate genes that were: i) Overexpressed in gastric cancer compared with the corresponding normal tissues and ii) Expressed at comparable expression levels in primary gastric cancer and metastatic tissues (Table II). A literature review of the functions of the identified genes was conducted and CRABP1 was selected for subsequent analyses for the following reasons: i) Insufficient evidence was available on the oncological roles of CRABP1; ii) CRABP1 mediates the activity of retinoid, which is involved in cancer progression; and iii) nucleotide sequence of CRABP1 is available from the United States National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).
Table II.
Genes overexpressed in primary cancerous tissues from patients with metastatic gastric cancer.
| Function | Symbol | Name | GC/Normal
|
Meta/GC
|
||
|---|---|---|---|---|---|---|
| Log2 | P-value | Log2 | P-value | |||
| Regulator of cell cycle | CRABP1 | Cellular retinoicacid- binding protein 1 | 3.66 | 0.0048 | 0.81 | 0.3022 |
| CCNE1 | Cyclin E1 | 3.41 | <0.0001 | −1.06 | 0.0709 | |
| CDC25B | Cell division cycle 25B | 3.17 | 0.0006 | −0.66 | 0.3947 | |
| Cell membrane receptor | GRB7 | Growth factor receptor bound protein 7 | 3.98 | <0.0001 | −0.03 | 0.9716 |
| UTS2R | Urotensin 2 receptor | 4.50 | <0.0001 | 0.50 | 0.5675 | |
| TNFRSF11B | TNF receptor superfamily member 11b | 4.57 | <0.0001 | 0.53 | 0.4265 | |
| Cell-surface glycoprotein | MELTF | Melanotransferrin | 3.27 | <0.0001 | −0.19 | 0.7380 |
| Cellular adhesin | CLDN1 | Claudin 1 | 3.27 | <0.0001 | 0.71 | 0.1568 |
| COMP | Cartilage oligomeric matrix protein | 3.15 | 0.0003 | 0.91 | 0.1072 | |
| THBS2 | Thrombospondin 2 | 3.76 | <0.0001 | 0.20 | 0.7759 | |
| THBS4 | Thrombospondin 4 | 4.01 | <0.0001 | 0.95 | 0.2787 | |
| Growth factor | INHBA | Inhibin beta A subunit | 3.76 | <0.0001 | −0.37 | 0.5028 |
| Mediator of neural transmission | CPLX2 | Complexin 2 | 4.36 | 0.0007 | 1.88 | 0.2436 |
| NPY | Neuropeptide Y | 4.86 | <0.0001 | 0.09 | 0.9008 | |
| VSNL1 | Visinin like 1 | 4.04 | <0.0001 | 1.09 | 0.1528 | |
| Metabolic enzyme | AKR1C4 | Aldo-keto reductase family 1-member C4 | 3.28 | 0.0009 | 0.59 | 0.4064 |
| KLK10 | Kallikrein related peptidase 10 | 3.26 | 0.0003 | −0.76 | 0.2984 | |
| PADI2 | Peptidyl arginine deiminase 2 | 3.01 | <0.0001 | −1.29 | 0.0758 | |
| PLA2G2A | Phospholipase A2 group IIA | 3.70 | <0.0001 | −0.43 | 0.4529 | |
| Trafficking protein | DNAJC12 | DnaJ heat shock protein family member C12 | 4.15 | <0.0001 | −1.16 | 0.1038 |
| RBP4 | Retinol binding protein 4 | 4.25 | <0.0001 | 1.51 | 0.0515 | |
| SYT7 | Synaptotagmin 7 | 4.29 | <0.0001 | 0.30 | 0.6281 | |
| Transcription factor | ELF5 | E74 like ETS transcription factor 5 | 5.00 | 0.0001 | −0.85 | 0.3319 |
| FNDC1 | Fibronectin type III domain containing 1 | 4.50 | <0.0001 | −0.89 | 0.1592 | |
| GNG4 | G protein subunit gamma 4 | 4.84 | <0.0001 | 0.29 | 0.7296 | |
| HOXC10 | Homeobox C10 | 6.49 | 0.0001 | 1.68 | 0.0752 | |
GC, primary gastric cancer tissue; Normal, corresponding adjacent normal gastric tissue; Meta, hepatic metastasis tissue; TNF, Tumor necrosis factor; ETS, erythroblast transformation-specific.
Expression of CRABP1 and genes encoding potential CRABP1-interacting proteins by gastric cancer cell lines
The relative levels of CRABP1 mRNA and those of mRNAs encoding potential CRABP1-interacting proteins in gastric cancer cell lines are presented in Fig. 1B. There were large differences in the levels of CRABP1 mRNA and those of other genes among gastric cancer cell lines. CRABP1 mRNA levels positively correlated with those encoding IGFBP4, MAP1B, ZEB2, STEAP1, VIM and TIMP1 and negatively with TFPI2 (Fig. 1C).
Figure 1.
Expression analysis of CRABP1 mRNA in cell lines. (A) CRABP1 mRNA expression in 14 gastric cancer cell lines and the nontumorigenic intestinal cell line FHs74. Error bars indicate standard deviation. (B) The relative levels of CRABP1 mRNA and those of mRNAs encoding potential CRABP1-interacting proteins in gastric cancer cell lines. (C) Cancer-related genes expressed in concert with CRABP1 expression were identified by PCR array analysis. CRABP1, cellular retinoic acid binding protein 1.
Analyses of CRABP1 mRNA levels in gastric cancer cell lines
To characterize CRABP1 in gastric cancer, the levels of CRABP1 mRNA in 12 gastric cancer cell lines were next compared with those of a nontumorigenic epithelial cell line. CRABP1 mRNA levels were >2-fold higher in MKN1, MKN7, N87, IM95, GCIY, MKN45, NUGC2 and OCUM1 cells compared with FHs74 cells (Fig. 1A). CRABP1 mRNA levels did not significantly differ according to the extent of differentiation of the gastric cancer cells. MKN1, MKN45 and NUGC4 cells were selected for subsequent analyses, since MKN1 and MKN45 cells expressed relatively high levels of CRABP1 mRNA, and these three cell lines were easy to use in functional analyses.
Effect of CRABP1 knockdown on the biological activities of gastric cancer cells
The efficiency of CRABP1 knockdown by transfection of siCRABP1-1 and siCRABP1-2 alone was evaluated in MKN1, NUGC4 and MKN45 cells (Fig. S1). These two siRNAs were pooled to constitute a CRABP1-specific siRNA. To evaluate the function of CRABP1 in gastric cancer cells, MKN1 and NUGC4 cells were transfected with a CRABP1-specific siRNA. It was first determined that the knockdown efficacy of the CRABP1 siRNA in MKN1, MKN45 and NUGC4 cells was sufficient for analysis (Figs. 2A and S2). The proliferation of siRNA-transfected MKN1, MKN45 and NUGC4 cells as well as the invasiveness and migration of MKN1 and MKN45 cells were then evaluated. The proliferation of MKN1, MKN45 and NUGC4 cells was decreased as a result of CRABP1 knockdown starting from 72 h after transfection compared with the siControl-transfected cells (Figs. 2B and S2). Furthermore, the invasiveness of MKN1 and MKN45 cells was reduced by inhibiting CRABP1 expression (Fig. 3). The migration of MKN1 and MKN45 cells was reduced by inhibiting CRABP1 expression (Fig. 4).
Figure 2.
CRABP1 knockdown and proliferation of gastric cancer cells. (A) Knockdown efficacy of the CRABP1 siRNA in MKN1 and NUGC4 cells. (B) Proliferation of MKN1 and NUGC4 cells subjected to siRNA-mediated knockdown of CRABP1. *P<0.05. Error bars indicate standard deviation. si-, small interfering; CRABP1, cellular retinoic acid binding protein 1.
Figure 3.
Effect of knockdown of CRABP1: Invasion assay of MKN1 and MKN45 cells. Top panels show representative images of stained cancer cells (magnification, ×200), and the bottom graph shows the mean numbers of invading cells in eight randomly selected fields. *P<0.05. Error bars indicate standard deviation. si-, small interfering; CRABP1, cellular retinoic acid binding protein 1.
Figure 4.
Effect of siRNA-mediated knockdown of CRABP1 expression: Wound-healing assays of MKN1 and MKN45 cells. Top panels show representative images from assays at the indicated times, and the bottom graph shows the mean length of migration at the indicated times. *P<0.05. Error bars indicate standard deviation. si-, small interfering; CRABP1, cellular retinoic acid binding protein 1.
Effect of CRABP1 knockdown on peritoneal metastasis in mouse xenograft models of gastric cancer
MKN1 and NUGC4 cells transfected with CRABP1 siRNA or untransfected were injected into mice to identify the function of CRABP1 in recurrence and metastasis of gastric cancer. Observations in the abdominal cavity of the mice were performed after euthanasia. In the MKN1 xenograft model, peritoneal dissemination was not observed in the siCRABP1 group (Fig. 5). Peritoneal metastasis in the NUGC4-model mice was disseminated to a smaller extent in the siCRABP1 group compared with the untransfected group (Fig. S3).
Figure 5.
Effect of CRABP1 knockdown on peritoneal metastasis formation in mouse xenograft models of MKN1 cells. Left images show dissemination of representative tumors in the peritoneal cavities of mice. Right panels present all tumor nodules and the bottom graph shows the average total weight of tumor nodules. *P<0.05. Error bars indicate standard deviation. si-, small interfering; CRABP1, cellular retinoic acid binding protein 1.
Prognostic impact of CRABP1 expression
The DFS rate of the CRABP1-high group was significantly lower compared with that of the CRABP1-low group (5-year DFS rates; 59.6% and 77.8%, respectively; P=0.012) (Fig. 6A) and were consistent with those of the extra-validation cohort (Fig. 6B).
Figure 6.
Prognostic implications of CRABP1 mRNA expression in patients with gastric cancer. (A) Kaplan-Meier analysis of disease-free survival in the insti- tutional cohort. The present dataset consisted of 230 clinical samples who underwent surgical resection for stages I-III gastric cancer. (B) Kaplan-Meier analysis of disease-free survival in the external validation cohort from the integrated Kaplan-Meier plotter dataset (http://kmplot.com/analysis/). (C) Frequencies of the sites of initial recurrence after curative gastrectomy according to CRABP1 expression. CRABP1, cellular retinoic acid binding protein 1; CI, confidence interval; HR, hazard ratio; n.s, not significant.
Next, gastric cancer recurrence patterns were analyzed according to CRABP1 mRNA levels of 230 patients who underwent R0 resection (stages I-III). Among them, 57 (24.7%) experienced postoperative recurrence at 65 initial recurrence sites. Analysis of recurrence patterns revealed that high expression of CRABP1 mRNA was significantly associated with peritoneal recurrence (P=0.016) (Fig. 6C), but not with the other two recurrence patterns.
The correlations between CRABP1 expression and clinicopathological characteristics of patients were next examined (Table III). High CRABP1 expression was significantly associated with lymph node metastasis. Univariate analysis of DFS demonstrated that carbohydrate antigen 19-9 (37 IU/ml), tumor size ≥50 mm, macroscopic type (Borrmann type 4/5), pT4, lymphatic involvement, vascular invasion, invasive growth, lymph node metastasis and high CRABP1 mRNA expression in gastric cancer tissues were significant prognostic factors for adverse outcomes (Table IV). Multivariable analysis identified high CRABP1 mRNA expression as an independent prognostic factor of poor outcome (hazard ratio 1.89; 95% confidence interval, 1.15-3.09; P=0.012).
Table III.
CRABP1 expression and the clinical characteristics of patients with gastric cancer.
| Clinical characteristics | Expression level of CRABP1
|
P-value | |
|---|---|---|---|
| Low (n=126) | High (n=104) | ||
| Age, years | 0.687 | ||
| <70 | 74 | 64 | |
| ≥70 | 52 | 40 | |
| Sex | 0.769 | ||
| Male | 89 | 76 | |
| Female | 37 | 28 | |
| CEA (ng/ml) | 0.850 | ||
| ≤5 | 107 | 90 | |
| >5 | 19 | 14 | |
| CA19-9 (IU/ml) | 0.382 | ||
| ≤37 | 102 | 89 | |
| >37 | 24 | 15 | |
| Tumor location | 0.992 | ||
| Entire | 4 | 4 | |
| Upper third | 34 | 27 | |
| Middle third | 43 | 37 | |
| Lower third | 45 | 36 | |
| Tumor size (mm) | 0.562 | ||
| <50 | 68 | 56 | |
| ≥50 | 58 | 48 | |
| Macroscopic type | 0.376 | ||
| Borrmann type 4/5 | 10 | 12 | |
| Others | 116 | 92 | |
| Multifocal lesions | 0.823 | ||
| Absent | 115 | 94 | |
| Present | 11 | 10 | |
| Tumor depth (UICC) | 0.581 | ||
| pT1-3 | 83 | 64 | |
| pT4 | 43 | 40 | |
| Differentiation | 1.000 | ||
| Differentiated | 54 | 45 | |
| Undifferentiated | 72 | 59 | |
| Lymphatic involvement | 0.288 | ||
| Absent | 24 | 14 | |
| Present | 102 | 90 | |
| Vascular invasion | 0.077 | ||
| Absent | 55 | 33 | |
| Present | 71 | 71 | |
| Infiltrative growth | 0.886 | ||
| Absent | 58 | 29 | |
| Present | 68 | 75 | |
| Lymph node metastasis | 0.006 | ||
| Absent | 58 | 29 | |
| Present | 68 | 75 | |
| UICC stage | 0.056 | ||
| I | 34 | 16 | |
| II | 40 | 31 | |
| III | 52 | 57 | |
CRABP1, cellular retinoic acid-binding protein 1; CEA, carcinoembryonic antigen; CA19-9, carbohydrate antigen 19-9; UICC, Union for International Cancer Control.
Table IV.
Prognostic factors for disease-free survival of patients with gastric cancer.
| Variables | Univariate
|
Multivariable
|
||||
|---|---|---|---|---|---|---|
| Hazard ratio | 95% CI | P-value | Hazard ratio | 95% CI | P-value | |
| Age (≥70 years) | 0.82 | 0.50-1.34 | 0.420 | |||
| Sex (female) | 1.06 | 0.63-1.76 | 0.834 | |||
| CEA (>5 ng/ml) | 1.39 | 0.74-2.58 | 0.304 | |||
| CA 19-9 (>37 IU/ml) | 2.35 | 1.37-4.03 | 0.002 | 1.82 | 1.03-3.22 | 0.040 |
| Tumor location (lower third) | 0.76 | 0.46-1.27 | 0.297 | |||
| Tumor size (≥50 mm) | 1.95 | 1.21-3.15 | 0.006 | 1.44 | 0.88-2.35 | 0.145 |
| Macroscopic type (Borrmann type 4/5) | 2.32 | 1.27-4.24 | 0.007 | 1.26 | 0.65-2.45 | 0.487 |
| Multifocal lesions | 0.91 | 0.39-2.09 | 0.816 | |||
| Tumor depth (pT4, UICC) | 2.55 | 1.59-4.08 | <0.001 | 1.63 | 0.96-2.78 | 0.073 |
| Tumor differentiation (undifferentiated) | 1.59 | 0.97-2.60 | 0.068 | |||
| Lymphatic involvement | 4.12 | 1.50-11.30 | 0.006 | 0.93 | 0.29-3.04 | 0.932 |
| Vascular invasion | 2.66 | 1.52-4.65 | <0.001 | 1.34 | 0.72-2.48 | 0.359 |
| Invasive growth | 1.66 | 1.03-2.69 | 0.038 | 1.12 | 0.64-1.97 | 0.687 |
| Lymph node metastasis | 7.97 | 3.63-17.49 | <0.001 | 4.94 | 2.03-12.03 | <0.001 |
| High CRABP1 expression | 2.07 | 1.28-3.35 | 0.003 | 1.89 | 1.15-3.09 | 0.012 |
CRABP1, cellular retinoic acid-binding protein 1; CI, confidence interval; CEA, carcinoembryonic antigen; CA19-9, carbohydrate antigen 19-9; UICC, Union for International Cancer Control.
Discussion
In the present study, biomarkers of the malignant phenotype of gastric cancer that predict postoperative recurrence were searched. As a result, it was identified that the expression levels of CRABP1 mRNA correlated with those of genes encoding EMT-related molecules. Furthermore, knockdown of CRABP1 influenced the proliferation, invasiveness, and migration of gastric cancer cell lines. The results of these in vitro analyses are consistent with the demonstration that CRABP1 expression in primary tumor tissues of gastric cancer was an independent predictor for worse postoperative recurrence-free survival, which significantly correlated with an increased rate of peritoneal recurrence.
CRABP1 specifically binds retinoic acid, an activator of ERK1/2, which in turn, activates protein phosphatase 2A through binding to CRABP1 to lengthen the cell cycle (17). This effect sensitizes cancer cells to apoptosis by triggering the homeostatic action of retinoic acid on the genome via the retinoic acid receptor (18). Thus, CRABP1 may encode a tumor suppressor, as indicated by findings that CRABP1 inhibits the growth of cancers such as those of the esophagus and thyroid (19-21). Conversely, evidence has indicated that the tumor suppressive effect of CRABP1 is independent of its retinoic acid-binding activity and may contribute to the malignant transformation of mesenchymal tumors (22). Moreover, these findings suggested that high expression of CRABP1 is associated with lymph node metastasis and poor differentiation/high grade of pancreatic neuroendocrine tumors (22). Furthermore, a previous study revealed that CRABP1 expression is associated with poor prognosis of patients with breast cancer, which reflects high Ki67 immunoreactivity and a high pathological grade (23). Thus, the relationships between CRABP1 expression and cancer varies among organs, suggesting that CRABP1 may possess unidentified functions.
Metastasis that leads to cancer recurrence involves factors such as adhesion, infiltration, and angiogenesis, as the EMT contributes to cancer progression and metastasis (24-26). For example, the present PCR array results showed that CRABP1 expression significantly and positively correlated with that of numerous EMT-promoting factors. Moreover, CRABP1 expression negatively correlated with the expression of TFPI2, which is often suppressed during the EMT; and the gene encoding TFPI2 is frequently methylated in gastric cancers (27,28). These results suggested that CRABP1 is coordinately expressed with cancer-related molecules and may promote peritoneal dissemination of gastric cancer through the EMT.
Furthermore, siRNA-mediated knockdown of CRABP1 expression reduced the proliferative, invasive and migratory capacities of gastric cancer cells. Proliferation and invasion of gastric cancer cells are required for their migration from the primary tumor site, passage through endothelial cells, and invasion of lymphatic and blood vessels, which culminates in the colonization of lymph nodes and target organs, as well as the proliferation of cancer cells in the parenchyma (29).
In a mouse xenograft model of peritoneal metastasis of gastric cancer, it was found that the total weight of disseminated nodules was lower in the group, in which CRABP1 mRNA levels were knocked down compared with those of the untransfected group. These results suggested that CRABP1 is involved in the recurrence of peritoneal dissemination of gastric cancer. In the present study, high expression of CRABP1 in gastric cancer tissues was associated with a higher recurrence rate, shorter DFS and significantly more frequent peritoneal dissemination, leading to recurrence. These results indicated that preoperative and intraoperative analysis of CRABP1 expression may predict the risk of peritoneal dissemination recurrence after curative resection.
Thus, evaluating the expression of CRABP1 as a biomarker of patients at high risk of peritoneal dissemination may inform decisions on implementing a surveillance plan that considers the course of peritoneal dissemination after surgery. Specifically, closely spaced abdominal echocardiography and computed tomography of the pelvis can be used to detect small amounts of ascites and small peritoneal nodules. Furthermore, the present data have important clinical implications for administering adjuvant chemotherapy to patients with high tissue levels of CRABP1 mRNA after resection of gastric cancer to reduce their risk of recurrence.
There are several limitations to the present study. First, the clinical impact of CRABP1 expression was retrospectively evaluated. Second, the clinical samples of the present study were insufficient to evaluate CRABP1 as a biomarker to detect disseminated metastasis. A prospective observational study of clinical samples, including disseminated metastasis, is there- fore required to evaluate the prognostic ability of CRABP1 expression levels. Third, the detailed molecular mechanisms underlying the correlation between high CRABP1 expres- sion and postoperative prognosis, including disseminated recurrence, must be determined. Identification of the relevant signal transduction pathways is required to fully understand the role of CRABP1 in tumor progression. In breast cancer cells, CRABP1 sequesters all-trans-retinoic acid (atRA) in the cytosol, inhibiting its nuclear action (23). Evaluating the expression levels of CRABP1 in gastric cancer cells and the effects of atRA on the tumor may further illuminate their mechanism of action related to malignancy.
In summary, it was revealed in the present study that CRABP1 influenced the malignant phenotype of gastric cancer cells and that its high expression in primary tumor tissues may serve as a biomarker for determining the prognosis of recurrence after curative resection, particularly that of patients with peritoneal dissemination.
Supplementary Data
Acknowledgments
Not applicable.
Abbreviations
- ATCC
American Type Culture Collection
- atRA
all-trans-retinoic acid
- CA
carbohydrate antigen
- CRABP1
cellular retinoic acid-binding protein 1
- CT
computed tomography
- DFS
disease-free survival
- EMT
epithelial-mesenchymal transition
- GAPDH
glyceraldehyde-3-phosphate dehydrogenase
- JCRB
Japanese Collection of Research Bioresources Cell Bank
- OS
overall survival
- PBS
phosphate-buffered saline
- RT-qPCR
reverse transcription-quantitative polymerase chain reaction
- ROC
receiver operating characteristic
- UICC
Union for International Cancer Control
Funding Statement
No funding was received.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.
Authors' contributions
KS, MK, and SN performed the experiments and data analysis. KS, MK, DS, SN, YI, NH, MH, CT, GN, and YK collected cases and clinical data. KS and MK confirm the authenticity of all the raw data. KS and MK conceived and designed the study and prepared the initial draft of the manuscript. YK supervised the project. All authors contributed to the final manuscript. All authors read and approved the final manuscript.
Ethics approval and consent to participate
The present study conformed to the ethical guidelines of the World Medical Association Declaration of Helsinki Ethical Principles for Medical Research Involving Human Subjects (2013). The present study was approved (approval no. 2014-0043) by the Institutional Review Board of Nagoya University (Nagoya, Japan). Written informed consent was obtained from all patients. Animal experiments were approved (approval no. M210414-001) by the Animal Research Committee of Nagoya University (Nagoya, Japan).
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
- 1.Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394–424. doi: 10.3322/caac.21492. [DOI] [PubMed] [Google Scholar]
- 2.Wadhwa R, Song S, Lee JS, Yao Y, Wei Q, Ajani JA. Gastric cancer-molecular and clinical dimensions. Nat Rev Clin Oncol. 2013;10:643–655. doi: 10.1038/nrclinonc.2013.170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.McLean MH, El-Omar EM. Genetics of gastric cancer. Nat Rev Gastroenterol Hepatol. 2014;11:664–674. doi: 10.1038/nrgastro.2014.143. [DOI] [PubMed] [Google Scholar]
- 4.Dong D, Ruuska SE, Levinthal DJ, Noy N. Distinct roles for cellular retinoic acid-binding proteins I and II in regulating signaling by retinoic acid. J Biol Chem. 1999;274:23695–23698. doi: 10.1074/jbc.274.34.23695. [DOI] [PubMed] [Google Scholar]
- 5.Kanda M, Shimizu D, Tanaka H, Shibata M, Iwata N, Hayashi M, Kobayashi D, Tanaka C, Yamada S, Fujii T, et al. Metastatic pathway-specific transcriptome analysis identifies MFSD4 as a putative tumor suppressor and biomarker for hepatic metastasis in patients with gastric cancer. Oncotarget. 2016;7:13667–13679. doi: 10.18632/oncotarget.7269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Liu JY, Peng CW, Yang XJ, Huang CQ, Li Y. The prognosis role of AJCC/UICC 8th edition staging system in gastric cancer, a retrospective analysis. Am J Transl Res. 2018;10:292–303. [PMC free article] [PubMed] [Google Scholar]
- 7.Kanda M, Murotani K, Kobayashi D, Tanaka C, Yamada S, Fujii T, Nakayama G, Sugimoto H, Koike M, Fujiwara M, Kodera Y. Postoperative adjuvant chemotherapy with S-1 alters recurrence patterns and prognostic factors among patients with stage II/III gastric cancer: A propensity score matching analysis. Surgery. 2015;158:1573–1580. doi: 10.1016/j.surg.2015.05.017. [DOI] [PubMed] [Google Scholar]
- 8.Foo M, Leong T. Adjuvant therapy for gastric cancer: Current and future directions. World J Gastroenterol. 2014;20:13718–13727. doi: 10.3748/wjg.v20.i38.13718. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kanda M, Nomoto S, Oya H, Takami H, Shimizu D, Hibino S, Hashimoto R, Kobayashi D, Tanaka C, Yamada S, et al. The expression of melanoma-associated antigen D2 both in surgically resected and serum samples serves as clinically relevant biomarker of gastric cancer progression. Ann Surg Oncol. 2016;23(Suppl 2):S214–S221. doi: 10.1245/s10434-015-4457-8. [DOI] [PubMed] [Google Scholar]
- 10.Umeda S, Kanda M, Miwa T, Tanaka H, Tanaka C, Kobayashi D, Suenaga M, Hattori N, Hayashi M, Yamada S, et al. Expression of sushi domain containing two reflects the malignant potential of gastric cancer. Cancer Med. 2018;7:5194–5204. doi: 10.1002/cam4.1793. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kanda M, Shimizu D, Fujii T, Sueoka S, Tanaka Y, Ezaka K, Takami H, Tanaka H, Hashimoto R, Iwata N, et al. Function and diagnostic value of Anosmin-1 in gastric cancer progression. Int J Cancer. 2016;138:721–730. doi: 10.1002/ijc.29803. [DOI] [PubMed] [Google Scholar]
- 12.Kanda M, Shimizu D, Tanaka H, Tanaka C, Kobayashi D, Hayashi M, Iwata N, Niwa Y, Yamada S, Fujii T, et al. Significance of SYT8 for the detection, prediction, and treatment of peritoneal metastasis from gastric cancer. Ann Surg. 2018;267:495–503. doi: 10.1097/SLA.0000000000002096. [DOI] [PubMed] [Google Scholar]
- 13.Shimizu D, Kanda M, Tanaka H, Kobayashi D, Tanaka C, Hayashi M, Iwata N, Niwa Y, Takami H, Yamada S, et al. GPR155 serves as a predictive biomarker for hematogenous metastasis in patients with gastric cancer. Sci Rep. 2017;7:42089. doi: 10.1038/srep42089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Shimizu D, Kanda M, Sugimoto H, Shibata M, Tanaka H, Takami H, Iwata N, Hayashi M, Tanaka C, Kobayashi D, et al. The protein arginine methyltransferase 5 promotes malignant phenotype of hepatocellular carcinoma cells and is associated with adverse patient outcomes after curative hepatectomy. Int J Oncol. 2017;50:381–386. doi: 10.3892/ijo.2017.3833. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kilkenny C, Browne WJ, Cuthill IC, Emerson M, Altman DG. Improving bioscience research reporting: The ARRIVE guidelines for reporting animal research. PLOS Biol. 2010;8:e1000412. doi: 10.1371/journal.pbio.1000412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Szász AM, Lánczky A, Nagy Á, Förster S, Hark K, Green JE, Boussioutas A, Busuttil R, Szabó A, Győrffy B. Cross-validation of survival associated biomarkers in gastric cancer using transcriptomic data of 1,065 patients. Oncotarget. 2016;7:49322–49333. doi: 10.18632/oncotarget.10337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Persaud SD, Park SW, Ishigami-Yuasa M, Koyano-Nakagawa N, Kagechika H, Wei LN. All trans-retinoic acid analogs promote cancer cell apoptosis through non-genomic Crabp1 mediating ERK1/2 phosphorylation. Sci Rep. 2016;6:22396. doi: 10.1038/srep22396. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Persaud SD. The functional role of retinoic acid and the cellular retinoic acid binding protein 1 (Crabp1) in tumor suppression. 2018;141 [Google Scholar]
- 19.Tanaka K, Imoto I, Inoue J, Kozaki K, Tsuda H, Shimada Y, Aiko S, Yoshizumi Y, Iwai T, Kawano T, Inazawa J. Frequent methylation-associated silencing of a candidate tumor-suppressor, CRABP1, in esophageal squamous-cell carcinoma. Oncogene. 2007;26:6456–6468. doi: 10.1038/sj.onc.1210459. [DOI] [PubMed] [Google Scholar]
- 20.Celestino R, Nome T, Pestana A, Hoff AM, Gonçalves AP, Pereira L, Cavadas B, Eloy C, Bjøro T, Sobrinho-Simões M, et al. CRABP1, C1QL1 and LCN2 are biomarkers of differentiated thyroid carcinoma, and predict extrathyroidal extension. BMC Cancer. 2018;18:68. doi: 10.1186/s12885-017-3948-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Huang Y, de la Chapelle A, Pellegata NS. Hypermethylation, but not LOH, is associated with the low expression of MT1G and CRABP1 in papillary thyroid carcinoma. Int J Cancer. 2003;104:735–744. doi: 10.1002/ijc.11006. [DOI] [PubMed] [Google Scholar]
- 22.Kainov Y, Favorskaya I, Delektorskaya V, Chemeris G, Komelkov A, Zhuravskaya A, Trukhanova L, Zueva E, Tavitian B, Dyakova N, et al. CRABP1 provides high malignancy of transformed mesenchymal cells and contributes to the pathogenesis of mesenchymal and neuroendocrine tumors. Cell Cycle. 2014;13:1530–1539. doi: 10.4161/cc.28475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Liu RZ, Garcia E, Glubrecht DD, Poon HY, Mackey JR, Godbout R. CRABP1 is associated with a poor prognosis in breast cancer: Adding to the complexity of breast cancer cell response to retinoic acid. Mol Cancer. 2015;14:129. doi: 10.1186/s12943-015-0380-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15:178–196. doi: 10.1038/nrm3758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Pastushenko I, Blanpain C. EMT transition states during tumor progression and metastasis. Trends Cell Biol. 2019;29:212–226. doi: 10.1016/j.tcb.2018.12.001. [DOI] [PubMed] [Google Scholar]
- 26.Aiello NM, Kang Y. Context-dependent EMT programs in cancer metastasis. J Exp Med. 2019;216:1016–1026. doi: 10.1084/jem.20181827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Qu Y, Dang S, Hou P. Gene methylation in gastric cancer. Clin Chim Acta Int J Clin Chem. 2013;424:53–65. doi: 10.1016/j.cca.2013.05.002. [DOI] [PubMed] [Google Scholar]
- 28.Takada H, Wakabayashi N, Dohi O, Yasui K, Sakakura C, Mitsufuji S, Taniwaki M, Yoshikawa T. Tissue factor pathway inhibitor 2 (TFPI2) is frequently silenced by aberrant promoter hypermethylation in gastric cancer. Cancer Genet Cytogenet. 2010;197:16–24. doi: 10.1016/j.cancergencyto.2009.11.004. [DOI] [PubMed] [Google Scholar]
- 29.Kanda M, Kodera Y. Molecular mechanisms of peritoneal dissemination in gastric cancer Molecular mechanisms of peritoneal dissemination in gastric cancer. World J Gastroenterol. 2016;22:6829–6840. doi: 10.3748/wjg.v22.i30.6829. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.






