Skip to main content
Immunity, Inflammation and Disease logoLink to Immunity, Inflammation and Disease
. 2022 Apr 19;10(5):e611. doi: 10.1002/iid3.611

Identification of B‐cell dominant epitopes in the recombinant protein P29 from Echinococcus granulosus

Yongxue Lv 1,2, Shasha Li 1,2, Tingrui Zhang 1,2, Yazhou Zhu 1,2, Jia Tao 1,2, Jihui Yang 1,2, Liangliang Chang 1,2, Changyou Wu 3, Wei Zhao 1,2,✉
PMCID: PMC9017632  PMID: 35478448

Abstract

Introduction

Echinococcus granulosus (E. granulosus) causes a hazardous zoonotic parasitic disease. This parasite can occupy the liver and several areas of the body, causing incurable damage. Our previous studies have provided evidence that the recombinant protein P29 (rEg.P29) exhibit immune protection in sheep and mice against pathological damage induced by E. granulosus, showing its potential as candidate for vaccine development. However, information on the B‐cell epitopes of rEg.P29 has not yet been reported.

Methods

Immunological model was established in mice with rEg.P29. SDS‐PAGE and Western blot were used to identify protein. Screening for B‐cell dominant epitope peptides of rEg.P29 by enzyme‐linked immunosorbent assay (ELISA) and immune serum. Dominant epitopes were validated using ELISA and flow cytometry. Multiple sequence alignment analysis was performed using BLAST and UniProt.

Results

Immunization with rEg.P29 induced intense and persistent antibody responses, and the epitope of the dominant antigen of B cells are identified as rEg.P29 166–185 (LKNAKTAEQKAKWEAEVRKD). Anti‐rEg.P29 166–185‐specific antibodies lack epitopes against IgA, IgE, and IgG3, compared to anti‐rEg.P29‐specific antibodies. However, anti‐rEg.P29 166–185 IgG showed comparatively higher titers, as determined among those peptides by endpoint titration. In addition, rEg.P29 and rEg.P29 166–185 promote B‐cell activation and proliferation in vitro. The dominant epitopes are relatively conserved in different subtypes of the rEg.P29 sequence.

Conclusion

rEg.P29 166–185 can act as a dominant B‐cell epitope for rEg.P29 and promote cell activation and proliferation in the same way as rEg.P29.

Keywords: B‐cell epitope, Echinococcus granulosus, rEg.P29


Our study provides information for the study of rEg.P29 peptide vaccines and sheds light on the rational design of vaccines.

graphic file with name IID3-10-e611-g003.jpg

1. INTRODUCTION

Echinococcus granulosus is a zoonotic parasitic disease with an extremely serious economic burden and poses great danger in human health. 1 Western China has a high incidence of hydatid disease. 2  E. granulosus grows slowly, and more than 80% of echinococcosis cysts occur in the host liver, causing incurable damage. 3 , 4 Currently, the main treatment methods for patients with cystic echinococcosis (CE) are surgery and drug treatment 5 ; however, drugs generally have side effects. Meanwhile, surgical treatment has a high recurrence rate and results in huge economic pressure and body damage to patients. 6 , 7 , 8

The massive use of anthelmintics has caused a series of problems, such as drug resistance, drug residues, and environmental pollution. 3 Vaccines are safe and residue‐free and are important tools for disease prevention and control. 9 , 10 However, traditional vaccines are composed of attenuated or inactivated pathogenic microorganisms and may cause unwanted or harmful immune responses in the body. 11 Therefore, the development of an effective and safe vaccine against parasitic diseases is important in animal husbandry and public health.

Despite the wide range of preventative approaches explored, a human vaccine against E. granulosus is not yet available. In fact, the E. granulosus vaccine has been proposed for a long time, and many candidate proteins have been studied, such as Eg95, antigen B, and rEg.P29. 12 , 13 , 14 , 15 , 16 Our previous study found that rEg.P29 showed 94.5% and 96.6% protective efficacy in sheep and mouse models with secondary infection, respectively, and induced strong cellular and humoral immune responses against E. granulosus infection. 16 , 17 However, the anti‐infective mechanism of rEg.P29 is still unclear.

In recent years, as our understanding of the immune response has improved and research on vaccine production has become more refined, the search for the most precise vaccine components, that is, antigenic epitopes, in recombinant vaccines has begun. These antigenic epitopes represent the smallest immunogenic regions of protein antigens and can induce a specific immune response with the desired effects in the body. 18 Considering the importance of rEg.P29, an epitope vaccine containing moderate antigenic peptides of the gene may serve as an efficient vaccine against E. granulosus infection.

Studies have shown that B‐cell‐mediated humoral immune responses play an important role against diseases. 18 Based on this study, we sought to screen for a dominant B‐cell epitope of rEg.P29 and provide a basis for the construction of peptide‐based Vaccines for rEg.P29.

2. MATERIALS AND METHODS

2.1. Animals and immunizations

This study was approved by the Experimental Animal Ethics Committee of the Ningxia Medical University. C57BL/6 female mice (SCXK2016‐0006) aged 6–8 weeks were purchased from the Animal Center of Ningxia Medical University and kept for acclimatized feeding for 7 days before the experiment. Immunization protocols per mouse are summarized briefly as follows: 20 μg rEg.P29 was mixed with 20 μg CpG ODN 1826 (rEg.P29 + CpG), or 50 μl Freund's complete adjuvant (rEg.P29 + FCA), and phosphate‐buffered saline (PBS) was used as control. Booster immunization was performed using Freund's incomplete adjuvant. For subcutaneous immunization, the mixture was suspended in PBS and injected in the lower quadrant of the abdomen (100 μl/mouse). Immunization was performed three times, 1 week apart (Figure 1A).

Figure 1.

Figure 1

rEg.P29 immunization induced a strong humoral immune response. Mice were primed and boosted with PBS, rEg.P29+FCA, or rEg.P29+CpG, following the prime‐boost protocol. (A) At the indicated time interval, mice were killed and serum was separated by centrifugation. (B) The expressed and purified recombinant P29 protein was detected by SDS‐PAGE analysis. Lane M, protein marker with molecular mass indicated on the left; Lane 1, Escherichia coli containing pET28a before IPTG induction; Lane 2, E. coli containing pET28a‐P29 6 h after induction; Lane 3, purified rEg.P29 using His‐affinity chromatography, as indicated by the arrow. (C) Western blot identifies rEg.P29. Purified rEg.P29 was immunoblotted with anti‐His tag antibody or postimmunized serum from mice. M, protein marker; Lane 1, anti‐his antibody; Lane 2, serum in PBS group; Lane 3, immune serum in rEg.P29+CpG group; Lane 4, immune serum in rEg.P29+FCA group. Anti‐rEg.P29 specific antibodies were detected by ELISA. (D) ELISA plate was coated with rEg.P29 (10 μg/ml). Then, serum levels of anti‐rEg.P29 antibodies were measured by ELISA using HRP‐labeled anti‐mouse antibodies. The absorbance was read at 450 nm. ****p < .0001, ***p < .001, **p < .01, ns, not significant, p > .05

2.2. Amino acid sequence

The complete amino acid sequence of rEg.P29 was obtained from GenBank (accession number XP_024351425.1).

2.3. Antigen and adjuvant

Protein purification and expression were performed as described previously. 15 Briefly, the positive strain was induced overnight with 0.05 mg/ml isopropyl‐b‐d‐thiogalactoside (IPTG; Invitrogen) at 37°C to express the recombinant protein P29, which was then purified using an anti‐His‐tagged nickel purification column (Merck). Purified rEg.P29 was identified using Western blot analysis. A BCA Kit (KeyGEN Biotech Products) was used to detect the protein concentration. Next, an overlapping peptide library of rEg.P29 and CpG ODN 1826 (TCCATGACGTTCCTGACGTT) was synthesized with98% purity with the assistance of Shanghai Shenggong Biological Co., Ltd. Complete and incomplete Freund's adjuvants were purchased from Sigma‐Aldrich.

2.4. Sample collection and cell preparation

Blood samples were obtained from the orbit, and the serum was collected and purified via centrifugation at 400 × g at 4°C for 10 min. Splenocytes were isolated from the tissue by filtering the tissue through a 70‐μm strainer in a sample diluent, and the prepared cell suspension was transferred to a density gradient (Tianjin Haoyang biological products). Spleen lymphocytes were separated via centrifugation at 450×g for 20 min.

2.5. Enzyme‐linked immunosorbent assay for antibody production

Enzyme‐linked immunosorbent assay (ELISA) plates were coated with individual peptides or rEg.P29 at 10 μg/ml and incubated overnight at 4°C. The plates were washed five times with 0.05% Tween 20 PBS (PBST) and blocked with 5% skim milk powder in PBST at 37°C for 1 h. After washing five times with PBST, the plates were incubated with primary serum (1:100) in PBS (with 10% FBS) for 2 h and washed five times with PBST for 2–3 min. One hundred microliters each of horseradish peroxidase (HRP)‐conjugated anti‐mouse IgM, IgG, IgA, IgG1, IgG2a, IgG2b, IgG2c, and IgG3 (Cat nos.: ab97230, ab97023, ab97235, ab97240, ab97245, ab97250, ab97255, and ab97260, respectively; Abcam), and IgE (Cat no.: PA1‐84764; Invitrogen) were added enzyme plates and incubated at 37°C for 1 h. After washing, 3,3′,5,5′‐Tetramethylbenzidine (TMB) was added for 8–10 min, and the reaction was stopped by 2 M H2SO4. The absorbance was measured at 450 nm within 15 min using an ELISA reader (Thermo Fisher Scientific).

2.6. Flow cytometry analysis

For the flow cytometry assay, phycoerythrin‐Texas Red (PE‐CF594) conjugated‐CD3, allophycocyanin‐Cyanin 7 (APC‐Cy7) conjugated‐CD19, phycoerythrin (PE) conjugated‐CD25, and Alexa Fluor700 conjugated‐CD69 were purchased from BD Biosciences, whereas Fixable Viability Dye eFluor™ 506 was obtained from Invitrogen.

Splenic lymphocytes were suspended in complete RPMI 1640 medium (HyClone) supplemented with 10% heat‐inactivated fetal calf serum (GeminiBio), 100 μg/ml streptomycin, 100 U/ml penicillin, 2 mM l‐glutamine, and 50 μM 2‐mercaptoethanol (Gibco). B‐cell activation was detected using flow cytometry. Briefly, cells were incubated with or without rEg.P29 or peptide (15 μg/ml) at 37°C, 5% CO2 for 24 and 72 h. The cells were washed two times with PBS containing 0.1% bovine serum albumin (BSA) and 0.05% sodium azide (Buffer1). Then, the cells were stained with monoclonal antibodies (CD3, CD19, CD25, and CD69) for 30 min at 4°C in the dark. After washing with Buffer1, the cells were suspended in 100 µl of PBS and subjected to FACSCelesta (BD) for analysis and data collection.

As for proliferation, the cells were washed two times with pre‐warmed PBS supplemented with 0.1% BSA, carboxyfluorescein diacetate succinimidyl ester at a final concentration of 2.5 µmol/L (CFSE, Invitrogen) was added, and the resulting mixture was incubated for 15 min at 37°C in the dark. The reaction was terminated with precooled RPMI1640 containing 10% FBS, incubated at 4°C for 5 min, and washed two times with precooled RPMI1640 containing 10% FBS. CFSE‐labeled cells were then cultured with or without 15 µg/ml rEg.P29 or peptide for 3 and 5 days at 37°C, 5% CO2. Cell samples were collected and stained with fluorochrome‐conjugated mAbs for phenotyping at 4°C in the dark. The samples were subjected to FACSCelesta™, and data were analyzed using FlowJo software (TreeStar).

2.7. Multiple sequence alignment

The amino acid sequences of P29 of different subtypes of E. granulosus were obtained using BLAST, and the conserved dominant epitopes were analyzed using UniProt (https://www.uniprot.org/). Amino acid sequences obtained from E. granulosus were as follows: AHA85389.1 (E. granulosus s.s. [G1]), AHA85390.1 (E. granulosus s.s. [G1]), AHA85391.1 (E. equinus), AHA85392.1 (E. ortleppi), AHA85393.1 (E. canadensis [G6]), AHA85394.1 (E. canadensis [G7]), AHA85395.1 (E. canadensis [G10]), AHA85396.1 (E. multilocularis), AHA85397.1 (E. multilocularis), AHA85398.1 (E. multilocularis), and AHA85399.1 (E. multilocularis).

2.8. Statistical analysis

All statistical analyses were performed using GraphPad Prism 8.0 (GraphPad Software Inc.) and SPSS 22.0. Unpaired Student's t‐test was used for comparisons between two groups, and one‐way or two‐way analysis of variance was used for comparisons among more than two groups. The least significant difference test or Student–Newman–Keuls test was used to analyze data with normal distribution and homogeneous variance. Dunnett's T3 test or independent sample t‐test was used to analyze data with normal distribution but had uneven variance. Data are represented as mean or mean ± SD. ****p < .001; ***p < .005; **p < .01; *p < .05 were considered statistically significant, whereas p > .05 was considered not significant (ns), as stated in figure legends.

3. RESULTS

3.1. Expression, purification, and identification of rEg.P29

The rEg.P29 was successfully expressed and purified. SDS‐PAGE analysis showed that rEg.P29 had a molecular weight of 31 kDa (Figure 1B). The protein concentration was 1 mg/ml, and the protein was stored at −80°C). Western blot analysis showed that rEg.P29 could not be recognized by antibodies in the mouse serum samples from the PBS group but could be recognized by a mouse monoclonal His‐tag antibody and mouse sera from the immunization group (Figure 1C).

3.2. rEg.P29 induced a sustained antibody response

To assess whether rEg.P29 induces specific immune responses in mice, we studied the antibody responses to rEg.P29 immunization in mice sera. Both immunization groups were compared with the control group. Immunization with rEg.P29 induced a high level of anti‐rEg.P29‐specific antibodies. The antibody responses peaked at Week 2 after boost immunization and were maintained for more than 16 weeks, except for IgA and IgE. Specifically, IgA and IgE levels gradually decreased at Week 4, but IgG remained at high levels. Both immunization groups were compared with the control group (Figure 1D).

3.3. Immunization induced a polarized Th1 response

Characterization of IgG isotype responses in rEg.P29 + FCA and rEg.P29 + CpG group showed the induction of both IgG1 and IgG2a antibody responses, with the IgG2a isotype showing a comparatively higher level than IgG1 (Figure 2).

Figure 2.

Figure 2

Vaccine‐induced a polarized Th1 response. Anti‐rEg.P29 specific antibodies were detected by ELISA. IgG1 and IgG2a in serum from immunized mice.****p < .0001, ***p < .001, **p < .01, ns, not significant, p > .05

3.4. Screening for the immunodominant linear B‐cell epitope peptides

The sera of mice immunized with rEg.P29 and HRP‐labeled goat anti‐mouse IgM and IgG were used as antibodies to detect the interaction between the antigen peptide (Table S1) and the serum. The dominant epitopes were selected, as shown in Figure 3A,B. Compared to the control group, the synthesized antigen peptide (Table S1) could induce ELISA‐specific reactions with the immune serum. ID34‐ID36 IgG and IgM levels were significantly higher than those of the other antigenic peptides in both immune groups.

Figure 3.

Figure 3

Identification of the core epitope of the immunodominant epitope peptide. ELISA detection of B‐cell epitope peptides of rEg.P29. (A, B) To determine the immunodominant epitope peptide of rEg.P29, ELISA plate was coated with synthetic peptides or rEg.P29. Then, serum samples from C57 mice that were immunized with PBS, rEg.P29 + FCA, or rEg.P29 + CpG were detected. The absorbance was read at 450 nm. (C) ELISA plate was coated with ID33‐ID37, mix peptides (ID1–ID45), or rEg.P29, specific IgG antibody was detected. (D) To determine the core epitope of immunodominant epitope peptide rEg.P29, ELISA plate was coated with four truncated or extended peptides. Then, serum samples from PBS, rEg.P29 + FCA, or rEg.P29 + CpG were detected.(E) Titers of IgG in sera from C57.****p < .0001, ***p < .001, **p < .01, ns, not significant, p > .05.

We further assessed IgG specific for ID33, ID34, ID35, ID36, and ID37 using ELISA. All of these epitopes were detected by peptide‐specific IgG in the rEg.P29 + FCA group, but only anti‐ID34‐ and anti‐ID35‐specific IgG were significantly higher than other antigenic peptides in both immune groups compared to the control group (p < .0001) (Figure 3C). To identify the core epitopes of the immunodominant peptide, we synthesized ID34 (rEg.P29 166–180), ID35 (rEg.P29 171–185), and their overlap (rEg.P29 171–180 and rEg.P29 166–185), as shown in Table 1. The ELISA plate was coated with these four peptides (10 μg/ml, respectively) and the positive control rEg.P29. Results indicated that the strongest IgG antibody reactivity was concentrated on a major immunodominant peptide, rEg.P29 166–185 (LKNAKTAEQKAKWEAEVRKD), of rEg.P29 (p < .001, Figure 3D). In addition, anti‐reg.P29166–185 anti‐rEg.P29 166‐185 IgG showed comparatively higher titers, as determined among those peptides by endpoint titration. As expected, anti‐rEg.P29 IgG maintained higher titers than anti‐rEg.P29 166–185 IgG (Figure 3E).

Table 1.

Amino acid sequence of dominant peptides

SEQ ID Location Purity (%) Sequence (N‐C) Number
ID34 rEg.P29 166–180 >98% LKNAKTAEQKAKWEA 15
ID35 rEg.P29 171–185 >98% TAEQKAKWEAEVRKD 15
rEg.P29 171–180 >98% TAEQKAKWEA 10
rEg.P29 166–185 >98% LKNAKTAEQKAKWEAEVRKD 20

3.5. Detection of antibody subtypes of B‐cell epitope core sequences

The ELISA plate was coated with rEg.P29 and rEg.P29 166–185 to detect antibody subtypes of B‐cell epitope core sequences. Results showed that anti‐rEg.P29 166–185‐specific antibodies lack epitopes against IgA, IgE, and IgG3, compared to anti‐rEg.P29‐specific antibodies (Figure 4A,B).

Figure 4.

Figure 4

Anti‐rEg.P29 or core peptide specific antibodies. (A) ELISA plate was coated with rEg.P29. Then, serum samples from C57 mice that were immunized with PBS, rEg.P29 + FCA, or rEg.P29 + CpG were detected. (B) ELISA plate was coated with rEg.P29 166–185. Then, serum samples from C57 mice that were immunized with PBS, rEg.P29 + FCA, or rEg.P29 + CpG were detected.****p < .0001, ***p < .001, **p < .01, ns, not significant, p > .05

3.6. rEg.P29 166–185 and rEg.P29 promote B‐cell activation and proliferation

The expression of CD69 and CD25 was assessed using flow cytometry to study the kinetics of cell activation. Results showed that the expression of CD69 and CD25 from day one was elevated (Figure 5A–D). Gating is shown in Figure S1. Increased CD69 expression in B cells after treatment with rEg.P29 or rEg.P29 166–185 was significantly different from that in cells cultured without rEg.P29 or rEg.P29 86–100 (medium) on Day 1 (p < .001, p < .0001; p < .001, p < .001). Meanwhile, CD69 expression in B cells decreased on Day 3 (p < .01, p < .001; p < .001, p < .001). Additionally, CD25‐expressing cells treated with rEg.P29 or rEg.P29 166–185 were significantly elevated on Day 3 compared to those not treated with rEg.P29 or rEg.P29 166–185 (all p < .0001, p < .0001; p < .0001, p < .0001). These results suggest that most rEg.P29‐specific B cells had already been activated from Day 1. It is worth noting that rEg.P29 166–185 induced slight increase in CD69 than the corresponding increase for rEg.P29 (p < .01, p > .05; p < .01, p > .05); moreover, there was no difference in the magnitude of CD25 elevation (p > .05, p > .05; p > .05, p > .05).

Figure 5.

Figure 5

rEg.P29 166–185 and rEg.P29 promoted specific B‐cell activation and proliferation. Mice were primed and boosted with PBS, rEg.P29 + FCA, or rEg.P29 + CpG and killed at Week 2 after boosting. Mononuclear cells from the spleen were isolated. (A–D) Cells were stimulated with rEg.P29 166–185, rEg.P29, and medium for 1 and 3 days. The cells were harvested and stained with fluorochrome‐conjugated monoclonal antibodies for CD69 and CD25. Data were collected by flow cytometry and analyzed using FlowJo. Representative dot plots in (A) show CD69 expression in B cells, (B) show CD25 expression in B cells. Frequencies of CD69 expression in B cells from rEg.P29 + FCA and rEg.P29 + CpG groups are shown in (C). Frequencies of CD25 expression in B cells from rEg.P29 + FCA and rEg.P29 + CpG groups are shown in (D). Cells were used for CFSE labeling and stimulated with rEg.P29 166–185, rEg.P29, and medium for 3 and 5 days. The cells were harvested and stained with fluorochrome‐conjugated monoclonal antibodies for CD3 and CD19. Data were collected by flow cytometry and analyzed using FlowJo. Representative dot plots in (E) show the identification of proliferative B cells. Frequencies of proliferative B cells from PBS, rEg.P29 + FCA, and rEg.P29 + CpG groups are shown in (F). Data from five mice, ****p < .0001, ***p < .001, **p < .01, ns, not significant, p > .05

Next, we performed CFSE labeling to estimate cell division (Figure 5E,F). After culturing with rEg.P29 or rEg.P29 166–185, the CFSE intensity of a portion of B cells was decreased at Day 3 (p < .01, p < .01; p < .05, p < .05) and further decreased at Day 5 (p < .0001, p < .0001; p < .0001, p < .001) compared to the control group.

3.7. rEg.P29 166–185 was relatively conserved in different subtypes of P29 sequences

Here, we analyzed the rEg.P29 sequences of different genotypes of E. granulosus and the corresponding regions of the dominant peptides. As shown in Figure S3, the dominant peptide (rEg.P29 166–185) was completely conserved in the P29 sequences of different subtypes.

4. DISCUSSION

With the improvement in living standards and sanitary conditions, the incidence rate of E. granulosus has been declining annually. 4 However, it is still a serious public health problem in pastoral areas. New disciplines, such as bioinformatics, immunoinformatics, and rational vaccine design, have been applied in recent years. 19 , 20 Among them, the design of a new vaccine composed of multiple epitopes of a single antigen has become a new method to enhance the host's protective immune response at humoral and cellular level. The epitope, also known as the antigenic determinant, is a chemical group in the antigen molecule that determines antigen specificity. 21 Epitope vaccines are based on the characteristics of the amino acid sequence of antigenic epitopes. They have become a new direction invaccine research because of their highly effective immune protection, safety, and stability. 22 , 23

In 2013, Esmaelizad et al. 24 synthesized a multi‐T‐cell epitope antigen based on five proteins: EgGST, EgA31, Eg95, Eg14‐3, and EgTrp. The antigen‐stimulated mouse spleen cells to produce IFN‐γ and obtained 99.6% protective efficacy in a mouse model. Simultaneously, multiepitope vaccines are also used in other fields. 25 , 26 , 27 The recombinant Bacillus Calmette–Guérin (BCG) vaccine (rBCG) constructed by Mohamud et al. 28 included two peptides, rBCG018 and rBCG032, that exhibited a stronger ability to induce cellular and humoral immune responses than BCG. Compared with traditional vaccines, synthetic peptide vaccines are easily prepared, have stable structure, and do not risk infection; thus, they are used for novel vaccine design at present.

Our previous studies have demonstrated that rEg.P29 has a favorable protective effect in sheep and mouse models. However, the B‐cell epitopes of rEg.P29 remain unclear. Identification of the B‐cell epitopes of rEg.P29 contributes not only in elucidating the mechanism underlying the B‐cell immune process of E. granulosus but also to the development of more effective epitope vaccine candidates. Screening epitopes with high immunogenicity is used for epitope development. Here, after the primer and booster doses of rEg.P29, the specific antibody levels peaked at Week 2. Immunized mice expressed IgM, IgG, IgG2a, and IgG2b, and few expressed IgA and IgE. Antibody production was maintained for at least 16 weeks, except for IgA and IgE. Studies have shown that IgG, IgG2a, and IgG2b may participate in the protective immune response induced by the vaccine, and IgG1 may be related to susceptibility to hydatidosis. Meanwhile, IgG3 may be associated with the formation of a local inflammatory response early in the host. 29 Th2‐related antibodies and cytokines mainly promote the escape of parasites and establish immune tolerance, while Th1 related antibodies and cytokines are closely related to anti‐infection. 30 , 31 Serological antibody tests showed that the immunized mice had a predominantly IgG and IgG2a antibody response against rEg.P29, followed by IgG1. MoreoverrEg.P29 immunization induced a predominantly Th1 immune response. Our results showed that the dominant epitope lacks anti‐rEg.P29 166–185 specific IgA, IgE, and IgG3 antibodies compared to anti‐rEg.P29 specific antibodies. These results suggest that rEg.P29 166–185 may only induce protective immunity while eliminating allergic reactions. 32 , 33 However, this difference may be caused by the adjuvant or the weak immunogenicity of the peptide, suggesting that multiple epitopes or vectors should be combined to improve the immunogenicity of the peptide. Furthermore, lymphocyte activation and proliferation levels are indicators that reflect the body's immune function. Here, we screened rEg.P29 166–185, for its ability to activate and proliferate B cells using flow cytometry. Results showed that rEg.P29 166–185 and rEg.P29 promote B‐cell activation and proliferation, highlighting that specific B cells can rapidly activate and proliferate in response to infection.

In addition, sequence alignment of the dominant epitope with the P29 protein of different isolates of E. granulosus revealed that rEg.P29 166–185 was highly conserved, suggesting its application as a broad‐spectrum vaccine. 34

Two adjuvants were used in the present study. CpG adjuvant is an oligodeoxynucleotide containing a CpG sequence with strong immune‐activating properties; it was reported to show few side effects and can be used in humans. 35 Our results showed that both CpG and Freund's adjuvant enhanced the humoral immune response. However, Freund's adjuvant induces severe local necrotic ulcers and is considered to be toxic for human use. Considering the translational application of the vaccine, we used CpG adjuvant in subsequent experiments. Nonetheless, studies have shown that adjuvants alone do not induce specific antibody responses, 36 as shown in Figure S2.

This study has some limitations. Our study did not validate the immunoprotective effect after immunization of the dominant epitope. Further studies are warranted.

5. CONCLUSION

In conclusion, our studies show that rEg.P29 immunization can induce a strong and sustained antibody response, and rEg.P29 166–185 can act as its dominant B‐cell epitope. Furthermore, rEg.P29 and rEg.P29 166–185 stimulation in vitro can promote B‐cell activation and proliferation.

ETHICS STATEMENT

All mouse experiments were given permission by the Ningxia Medical University Institutional Review Committee (Permit number: SCXK2016‐0006) and carried out in strict accordance with national and institutional guidelines. The data obtained met the appropriate ethical requirements.

AUTHOR CONTRIBUTIONS

Wei Zhao and Changyou Wu were in charge of the project design; Yongxue Lv and Shasha Li were responsible for conducting the experiments, the data analysis, and paper writing; Tingrui Zhang and Jihui Yang were responsible for guiding Flow analysis in the experiment; Jia Tao was responsible for the design of relevant peptides in the experiment; Liangliang Chang and Yazhou Zhu were responsible for animal feeding; Yongxue Lv was in charge of the revision; Wei Zhao and Changyou Wu were responsible for the experimental guidance; all authors read and approved the final manuscript.

Supporting information

Supplementary information.

ACKNOWLEDGMENTS

The authors thank Ningxia Medical University Science and Technology Center and Ningxia Key Laboratory of Prevention and Control of Common Infectious Diseases of Ningxia Medical University for providing the laboratory environment. This study was supported by the Key Projects of the Natural Science Foundation of Ningxia Hui Autonomous Region (No. 2020AAC02039), the Ningxia Hui Autonomous Region Key Research Program (No. 2018BEG02003), the Natural Science Foundation of Ningxia Hui Autonomous Region (No. NZ15212), Key R&D Projects (Major Science and Technology Projects; No. 2019BCG01001), and the Natural Science Foundation of Ningxia Hui Autonomous Region (No. 2021AAC03407).

Lv Y, Li S, Zhang T, et al. Identification of B‐cell dominant epitopes in the recombinant protein P29 from Echinococcus granulosus . Immun Inflamm Dis. 2022;10:e611. 10.1002/iid3.611

Yongxue Lv and Shasha Li contributed equally to this study.

DATA AVAILABILITY STATEMENT

Contact the corresponding author for data and material requests.

REFERENCES

  • 1. Borhani M, Fathi S, Darabi E, et al. Echinococcoses in Iran, Turkey, and Pakistan: old diseases in the new millennium. Clin Microbiol Rev. 2021;34:e29020. 10.1128/CMR.00290-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Schweiger A, Ammann RW, Candinas D, et al. Human alveolar echinococcosis after fox population increase, Switzerland. Emerging Infect Dis. 2007;13:878‐882. 10.3201/eid1306.061074 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Sander VA, Sanchez LE, Mendoza ML, Ramos DV, Corigliano MG, Clemente M. Use of veterinary vaccines for livestock as a strategy to control foodborne parasitic diseases. Front Cell Infect Microbiol. 2020;10:288. 10.3389/fcimb.2020.00288 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Wen H, Vuitton L, Tuxun T, et al. Echinococcosis: advances in the 21st century. Clin Microbiol Rev. 2019;32:e00075‐18. 10.1128/CMR.00075-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Baumann S, Shi R, Liu W, et al. Worldwide literature on epidemiology of human alveolar echinococcosis: a systematic review of research published in the twenty‐first century. Infection. 2019;47:703‐727. 10.1007/s15010-019-01325-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Brunetti E, Kern P, Vuitton DA. Expert consensus for the diagnosis and treatment of cystic and alveolar echinococcosis in humans. Acta Trop. 2010;114:1‐16. 10.1016/j.actatropica.2009.11.001 [DOI] [PubMed] [Google Scholar]
  • 7. Nabarro LE, Amin Z, Chiodini PL. Current management of cystic echinococcosis: a survey of specialist practice. Clin Infect Dis. 2015;60:721‐728. 10.1093/cid/ciu931 [DOI] [PubMed] [Google Scholar]
  • 8. Lissandrin R, Tamarozzi F, Mariconti M, Manciulli T, Brunetti E, Vola A. Watch and wait approach for inactive echinococcal cyst of the liver: an update. Am J Trop Med Hyg. 2018;99:375‐379. 10.4269/ajtmh.18-0164 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Pourseif MM, Moghaddam G, Nematollahi A, et al. Vaccination with rEGVac elicits immunoprotection against different stages of Echinococcus granulosus life cycle: a pilot study. Acta Trop. 2021;218:105883. 10.1016/j.actatropica.2021.105883 [DOI] [PubMed] [Google Scholar]
  • 10. Larrieu E, Mujica G, Araya D, et al. Pilot field trial of the EG95 vaccine against ovine cystic echinococcosis in Rio Negro, Argentina: 8 years of work. Acta Trop. 2019;191:1‐7. 10.1016/j.actatropica.2018.12.025 [DOI] [PubMed] [Google Scholar]
  • 11. Amarir F, Rhalem A, Sadak A, et al. Control of cystic echinococcosis in the Middle Atlas, Morocco: field evaluation of the EG95 vaccine in sheep and cesticide treatment in dogs. PLoS Neglected Trop Dis. 2021;15:e9253. 10.1371/journal.pntd.0009253 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Wang L, Gao J, Lan X, et al. Identification of combined T‐cell and B‐cell reactive Echinococcus granulosus 95 antigens for the potential development of a multi‐epitope vaccine. Ann Transl Med. 2019;7:652. 10.21037/atm.2019.10.87 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Kamenetzky L, Muzulin PM, Gutierrez AM, et al. High polymorphism in genes encoding antigen B from human infecting strains of Echinococcus granulosus . Parasitology. 2005;131:805‐815. 10.1017/S0031182005008474 [DOI] [PubMed] [Google Scholar]
  • 14. Da SE, Cancela M, Monteiro KM, Ferreira HB, Zaha A. Antigen B from Echinococcus granulosus enters mammalian cells by endocytic pathways. PLoS Neglected Trop Dis. 2018;12:e6473. 10.1371/journal.pntd.0006473 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Wang H, Li Z, Gao F, et al. Immunoprotection of recombinant Eg.P29 against Echinococcus granulosus in sheep. Vet Res Commun. 2016;40:73‐79. 10.1007/s11259-016-9656-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Gottstein B, Stojkovic M, Vuitton DA, Millon L, Marcinkute A, Deplazes P. Threat of alveolar echinococcosis to public health—a challenge for Europe. Trends Parasitol. 2015;31:407‐412. 10.1016/j.pt.2015.06.001 [DOI] [PubMed] [Google Scholar]
  • 17. Purcell AW, McCluskey J, Rossjohn J. More than one reason to rethink the use of peptides in vaccine design. Nat Rev Drug Discov. 2007;6:404‐414. 10.1038/nrd2224 [DOI] [PubMed] [Google Scholar]
  • 18. Conibear AC, Schmid A, Kamalov M, Becker C, Bello C. Recent advances in peptide‐based approaches for cancer treatment. Curr Med Chem. 2020;27:1174‐1205. 10.2174/0929867325666171123204851 [DOI] [PubMed] [Google Scholar]
  • 19. Sabatino D. Medicinal chemistry and methodological advances in the development of peptide‐based vaccines. J Med Chem. 2020;63:14184‐14196. 10.1021/acs.jmedchem.0c00848 [DOI] [PubMed] [Google Scholar]
  • 20. Piel L, Durfee CJ, White SN. Proteome‐wide analysis of Coxiella burnetii for conserved T‐cell epitopes with presentation across multiple host species. BMC Bioinform. 2021;22:296. 10.1186/s12859-021-04181-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Hajissa K, Zakaria R, Suppian R, Mohamed Z. Epitope‐based vaccine as a universal vaccination strategy against Toxoplasma gondii infection: a mini‐review. J Adv Vet Anim Res. 2019;6:174‐182. 10.5455/javar.2019.f329 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Liu W, Tang H, Li L, Wang X, Yu Z, Li J. Peptide‐based therapeutic cancer vaccine: current trends in clinical application. Cell Proliferation. 2021;54:e13025. 10.1111/cpr.13025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Nelde A, Rammensee HG, Walz JS. The peptide vaccine of the future. Mol Cell Proteom. 2021;20:100022. 10.1074/mcp.R120.002309 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Esmaelizad M, Ahmadian G, Aghaiypour K, Shamsara M, Paykari H, Tebianian M. Induction of protective T‐helper 1 immune responses against Echinococcus granulosus in mice by a multi‐T‐cell epitope antigen based on five proteins. Mem Inst Oswaldo Cruz. 2013;108:408‐413. 10.1590/S0074-0276108042013003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Schumacher T, Bunse L, Pusch S, et al. A vaccine targeting mutant IDH1 induces antitumour immunity. Nature. 2014;512:324‐327. 10.1038/nature13387 [DOI] [PubMed] [Google Scholar]
  • 26. Li J, Zhao J, Shen J, Wu C, Liu J. Intranasal immunization with Mycobacterium tuberculosis Rv3615c induces sustained adaptive CD4(+) T‐cell and antibody responses in the respiratory tract. J Cell Mol Med. 2019;23:596‐609. 10.1111/jcmm.13965 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Huang HJ, Curin M, Banerjee S, et al. A hypoallergenic peptide mix containing T cell epitopes of the clinically relevant house dust mite allergens. Allergy. 2019;74:2461‐2478. 10.1111/all.13956 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Mohamud R, Azlan M, Yero D, et al. Immunogenicity of recombinant Mycobacterium bovis bacille Calmette‐Guerin clones expressing T and B cell epitopes of Mycobacterium tuberculosis antigens. BMC Immunol. 2013;14(Suppl 1):S5. 10.1186/1471-2172-14-S1-S5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Zhang W, Wen H, Li J, Lin R, McManus DP. Immunology and immunodiagnosis of cystic echinococcosis: an update. Clin Dev Immunol. 2012;2012:101895. 10.1155/2012/101895 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Gottstein B, Soboslay P, Ortona E, Wang J, Siracusano A, Vuitton DΑ. Immunology of alveolar and cystic echinococcosis (AE and CE). Adv Parasitol. 2017;96:1‐54. 10.1016/bs.apar.2016.09.005 [DOI] [PubMed] [Google Scholar]
  • 31. Diaz A. Immunology of cystic echinococcosis (hydatid disease). Br Med Bull. 2017;124(1):121‐133. 10.1093/bmb/ldx033 [DOI] [PubMed] [Google Scholar]
  • 32. Bao J, Zheng H, Wang Y, et al. Echinococcus granulosus infection results in an increase in and genera in the gut of mice. Front Microbiol. 2018;9:2890. 10.3389/fmicb.2018.02890 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Anvari D, Rezaei F, Ashouri A, et al. Current situation and future prospects of Echinococcus granulosus vaccine candidates: a systematic review. Transbound Emerg Dis. 2021;68(3):1080‐1096. 10.1111/tbed.13772 [DOI] [PubMed] [Google Scholar]
  • 34. Wang J, Dong R, Zou P, et al. Identification of a novel linear B cell epitope on the Sao Protein of Streptococcus suis serotype 2. Front Immunol. 2020;11:1492. 10.3389/fimmu.2020.01492 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Papagno L, Kuse N, Lissina A, et al. The TLR9 ligand CpG ODN 2006 is a poor adjuvant for the induction of de novo CD8(+) T‐cell responses in vitro. Sci Rep. 2020;10:11620. 10.1038/s41598-020-67704-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Worzner K, Sheward DJ, Schmidt ST, et al. Adjuvanted SARS‐CoV‐2 spike protein elicits neutralizing antibodies and CD4 T cell responses after a single immunization in mice. EBioMedicine. 2021;63:103197. 10.1016/j.ebiom.2020.103197 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary information.

Data Availability Statement

Contact the corresponding author for data and material requests.


Articles from Immunity, Inflammation and Disease are provided here courtesy of Wiley

RESOURCES