Skip to main content
Springer Nature - PMC COVID-19 Collection logoLink to Springer Nature - PMC COVID-19 Collection
. 2022 Apr 20;49(10):9725–9735. doi: 10.1007/s11033-022-07455-5

Considerations for the selection of tests for SARS-CoV-2 molecular diagnostics

Huriye Erbak Yılmaz 1,2,✉, Evin Iscan 2, Ozden Oz 2,3, Tuğçe Batur 2, Aybike Erdoğan 2, Seval Kılıç 2, Zeynep Mutlu 2, Murat Yılmaz 4, Kevin J Spring 5
PMCID: PMC9019540  PMID: 35441938

Abstract

During the course of 2020, the outbreak of Severe Acute Respiratory Syndrome Coronavirus-2 (SARS‐CoV‐2) spread rapidly across the world. Clinical diagnostic testing for SARS-Cov-2 infection has relied on the real‐time Reverse Transcriptase Polymerase Chain Reaction and is considered the gold standard assay. Commercial vendors and laboratories quickly mobilised to develop diagnostic tests to detect the novel coronavirus, which was fundamentally important in the pandemic response. These SARS-Cov-2 assays were developed in line with the Food Drug Administration-Emergency Use Authorization guidance. Although new tests are continuously being developed, information about SARS-CoV-2 diagnostic molecular test accuracy has been limited and at times controversial. Therefore, the analytical and clinical performance of SARS-CoV-2 test kits should be carefully considered by the appropriate regulatory authorities and evaluated by independent laboratory validation. This would provide improved end-user confidence in selecting the most reliable and accurate diagnostic test. Moreover, it is unclear whether some of these rapidly developed tests have been subjected to rigorous quality control and assurance required under good manufacturing practice. Variable target gene regions selected for currently available tests, potential mutation in target gene regions, non-standardized pre-analytic phase, a lack of manufacturer independent validation data all create difficulties in selecting tests appropriate for different countries and laboratories. Here we provide information on test criteria which are important in the assessment and selection of SARS-CoV-2 molecular diagnostic tests and outline the potential issues associated with a proportion of the tests on the market.

Supplementary Information

The online version contains supplementary material available at 10.1007/s11033-022-07455-5.

Keywords: SARS-CoV-2, COVID-19, Real-time RT-PCR, Diagnostic performance, Test selection

Introduction

The World Health Organization (WHO) released a statement officially confirming cases of pneumonia with unknown origin in Wuhan City, Hubei Province on 31 December 2019 [1]. On 9 January 2020, a novel coronavirus was announced as the causative agent by the Chinese authorities and later officially named Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-Cov-2) and responsible for the disease known as COVID-19 [2]. The number of confirmed cases rapidly increased and spread to other countries as the pandemic developed across the globe [3].

The COVID-19 pandemic continues to spread rapidly manifesting as second and third waves of increased transmission with concerns of important viral transmission by asymptomatic or moderately symptomatic patients [4]. During pandemics, rapid highly sensitive diagnostic tests play an essential role in epidemiological control and clinical management by identifying infected individuals and ensuring disease management to prevent the spread of the infectious agent and save lives [5].

The WHO stated that testing was a critical factor in controlling the spread of SARS-CoV-2 [6] (https://apps.who.int/iris/handle/10665/331509) and subsequently re-emphasized the call to include retesting due to the low accuracy of some of the available tests and associated pre-analytical issues [7–9]. Polymerase Chain Reaction (PCR) based methods are the gold standard in virus detection and are the assay of choice for the diagnosis of SARS-CoV-2 [10]. On 13 January 2020 the WHO released SARS-CoV-2 diagnostic testing guidance and the first real-time Reverse-Transcriptase PCR (RT-PCR) test was published by Corman et al. in January 2020 [11]. Further, the FDA released guidance on Emergency Use Authorisation (EUA) procedures for laboratories on 29 February 2020. The EUA supports emergency preparedness and response and fosters the development and availability of medical products for use in emergencies [12]. The FDA also updates the list of tests that have received EUA approval on its website [13].

During the development of a new diagnostic test, its performance should be compared using another device, a recognized reference method or clinical criteria for diagnosis. Also, validation studies examining the clinical performance of test are required before approval by the FDA [14]. However, understanding of FDA-EUA approval has been confusing as many clinical laboratories have mostly only experienced working with over-detailed FDA-IVD kits for which approval is highly complex and stringent [15]. Compared to FDA-IVD approval, the process for FDA-EUA approval is less stringent and mainly focused on analytical performance criteria. As the COVID-19 pandemic unfolded, the FDA-EUA recommended in the template for FDA-EUA approval of SARS-CoV-2 molecular-based tests the inclusion of Limit of Detection (LoD) as well as analytical sensitivity, cross-reactivity for analytical specificity and clinical evaluation for performance evaluation [16]. However diagnostic sensitivity, diagnostic specificity, positive predictive value and negative predictive value are among the basic and essential performance criteria for clinical diagnostic tests and have largely not been applied for SARS-CoV-2 molecular-based tests [17, 18]. Information on SARS-CoV-2 kits that have received FDA-EUA approval up to 1st September 2020 is contained in Supplementary Table 1. The instruction for use (IFU) supplied with these kits was used to extract information on analytical performance, target gene, sample volume, sample type and turnaround time of each test kit [13].

In several published studies, it has been suggested that some issues with SARS-CoV-2 detection were associated with pre-analytical and analytical factors. These included the lack of standardization of specimen type, the time of sampling, sample storage conditions, contamination, the use of insufficiently validated and verified assays, low viral load related to disease phase and recombination or mutation of viral genes [15, 19]. Here, in this review we examine the basic test features which are important in the selection of SARS-CoV-2 molecular diagnostic tests and discuss the existing problems of current tests that affect test selection.

Molecular diagnostic test selection criteria

The WHO’s guide to aid selection of diagnostic tests describes the ASSURED (Affordable, Sensitive, Specific, User-friendly, Rapid and robust, Equipment-free and Deliverable to end-users) criteria which is considered the benchmark for determining if a diagnostic test is fit for purpose depending on need [20]. For SARS-CoV-2 the first aspect of this practical guide is defining the test purpose and includes determining if (i) the required test is qualitative or quantitative, (ii) it is a point-of-care (POC) test or a central laboratory test, (iii) the test will be performed manually or by automated instrumentation and (iv) it requires specialist skills and who will perform the work (laboratory technician or healthcare worker) [21]. Although a number of different assays have been developed for the detection of SARS-CoV-2, the quantitative RT-PCR assay is considered the gold standard. The RT-PCR reaction can be performed in one step or two steps. The one-step RT-PCR performs both reverse transcription and amplification in the same tube. Since technician-based errors, sample mismatching, aliquoting, pipetting errors are lower; the potential risk of cross-contamination is lower. It is also cheaper and easier to set up and is ideal for high throughput applications. Further, gene specific primers are used to generate the cDNA leaving no cDNA template for the amplification of other gene targets. In the two-step method, the cDNA synthesis and RT-PCR reactions are performed in separate tubes. Additional pipetting steps increase the risk of pipetting errors and cross-contamination. However, two-step RT-PCR is more sensitive than one-step RT-PCR and it is possible to perform reverse transcription of other gene regions and the cDNA can be stored for later additional use. The preferred technique for detecting SARS-CoV-2 is one-step RT-PCR as it is quicker and easily integrated into liquid handling robotic platforms and automated systems [22–24]. Isothermal nucleic acid amplification is another technique used to detect SARS-CoV-2 and is especially useful for POC tests as it does not require a thermal cycler. Amplification occurs only at one temperature under isothermal conditions and can be performed in a single tube, without the need for sophisticated instrumentation. Droplet digital PCR (ddPCR), gene chip and loop-mediated isothermal amplification are the other nucleic acid based detection methods that have been used for the detection of SARS-Cov2. Nevertheless, the RT-PCR remains the predominant method for SARS-CoV-2 detection [11, 25, 26].

The second part of the ASSURED guide focuses on reviewing market available tests and includes appraising the workflow, technical characteristics, practicability, and test kit applicability. Basic information such as manufacturer details, the kit catalogue number, storage conditions of the kit, shelf-life stability (temperature, humidity, pressure), in-use stability (opened pack stability, opened vial stability and onboard stability if it is used with an instrument), and shipping stability are required. In addition, other information including appropriate specimen type (such as blood, oropharyngeal swab, nasopharyngeal swab, sputum or faeces), the required sample volume, control reagents, total turnaround time, RNA extraction and additional equipment requirement is required. Finally, instrument size, cost, education needs of the users and frequency of education, installation and maintenance requirements should be determined [21, 27].

Practicability dictates whether a new assay can be easily combined with other assays currently used in the laboratory and can be performed under the same conditions. Hence, determining if a new assay will incur additional cost and impact on the workforce is needed [28]. Regarding the technical and workflow characteristics of test kits, it is important to choose those with ready-to-use reagents, a small number of reaction tubes, and a limited number of pipetting steps to reduce the risk of contamination which is an important potential cause of false positive results [29]. This is especially critical during a pandemic when high throughput (number of samples in a run) and short turnaround time are demanded. Long turnaround times can result in the backlogs and increase in workload and number of patients in pandemic outpatient clinics requiring increased isolation periods [29]. Current sample production capacity, the total time required to perform the test and the number of tests each device can perform on an hourly and daily basis in theory and in practice should be taken into account [30].

The matrices that test kits can work with and the limit of detection values of different matrices are reported in the IFU documentation of the kits [16]. A test kit compatible with the sample type to be analysed needs to be selected. Particular consideration should also be given in regard to matrix interfering substances and inhibitors which may cause the assay to fail [31]. Mucin, blood contamination, nasal sprays, drops, corticosteroids and gels, throat lozenges, oral anaesthetic and analgesic drugs or sprays, anti-viral and antibacterial drugs, haemoglobin, conjugated and unconjugated bilirubin, proteins in circulation, lipids, antibodies and rheumatoid factors can all interfere with the PCR reaction. Evaluation of potential interfering agents is therefore highly pertinent for new techniques [30].

The third part of the ASSURED criteria focuses on the analysis of the approvals granted by international and national organizations [21]. Manufacturers can obtain approval for SARS-CoV-2 molecular diagnostic kits from regulatory authorities such as CE-IVD, FDA-EUA, Australian Therapeutic Goods Administration (TGA), Singapore Health & Safety/Sciences Authority (HSA), Korea Ministry of Food & Drug Safety EUA (Korea-MFDS-EUA), Health Canada, China National Product Administration (NMPA)-EUA [32]. The regulatory approvals of the kits are shown in Supplementary table 1.

The final part of the guide involves the review of test performance under optimum conditions and clinical laboratory conditions as well as monitoring of the test during routine use, including quality control and assurance. The diagnostic accuracy of the test should be checked in peer reviewed publications and data from the manufacturer [21]. Importantly, data provided by manufacturers should be verified by post-market assessment [33] (https://asm.org/Articles/2020/April/False-Negatives-and-Reinfections-the-Challenges-of).

Challenges in selecting Sars-Cov-2 molecular diagnostic tests

Diagnostic performance challenges of SARS-CoV-2 diagnostic molecular tests

Analytical sensitivity and specificity should not be confused with diagnostic sensitivity and specificity as each has different meanings [34]. High analytical sensitivity does not necessarily equate to a high diagnostic sensitivity, and similarly, a test with high analytical specificity does not warrant that the test has high diagnostic specificity. Analytical sensitivity is the smallest amount of a substance that can be detected by an assay and is known as the limit of detection (LoD) [16].

It is important to demonstrate a low LoD, which indicates greater analytical sensitivity and is likely the most common data provided by assay developers [18]. The SARS-CoV-2 kits granted FDA-EUA approval and the LoD values of the target genes of the tests are shown in Supplementary Table 1.

According to published studies on RT-PCR based assays for SARS-CoV-2 the reported diagnostic sensitivity ranged from 59 to 71% [35, 36]. It is known that diagnostic sensitivity is especially important in determining false negativity [17, 34]. During the COVID-19 pandemic, an enormous volume of tests have been performed and the number of infected individuals that test negative (i.e. false negative rate) constitutes a significant risk for pandemic control. There are a number of factors that may contribute to false negative results such as low viral load prior to onset of symptoms, insufficient sampling, unsuitable transport/storage conditions and mutation in the gene target site. The impact of false negative test results may create unnecessary confidence and increase the spread of the disease [37].

False positivity and cross-reactivity are also important issues that currently have not been well evaluated [38]. In low prevalence settings, the false positive rate has been found to be proportionally higher than in the high prevalence settings. However, in the high prevalence setting, individuals with a false positive result also have a major risk of viral exposure if isolated with patients with active COVID-19 infection. False positive results may cause delay of surgeries, workforce loss and unnecessary treatment and isolation [39]. In the real word setting it can be difficult to determine whether the source of false positivity is due to sample cross contamination, contamination during sampling from surface or gloves, cross reactions with other viruses or intrinsic analytical issues associated with some kits [38].

Non-standardized pre-analytical factors

There are numerous pre-analytic, analytic and post-analytic factors that affect performance, accuracy and repeatability of a diagnostic test [40, 41]. In some studies, it was mentioned that the high false negativity and false positivity rates of SARS-CoV-2 RT-PCR kits were mainly related to the pre-analytical phase, in particular sampling location, sampling time, transport and storage conditions [19, 40, 42, 43].

It has been found information on sample type and timing aimed at improving test accuracy change day by day. In the Korean guide, both nasopharyngeal and oropharyngeal sampling was recommended, while the United States Center for Disease Control and Prevention (US-CDC) recently updated their sampling procedure [44, 45]. It was established that sputum is the most sensitive sample for SARS-CoV-2 nucleic acid detection, with nasopharyngeal swabs the next most sensitive [46]. However, sputum induction produces an increased risk of aerosol transmission. There are also studies on the diagnostic value of saliva and faeces samples, with saliva being an easily obtained sample, but is not the preferred sample specimen [47, 48]. Due to the rapid release of updates, sample type, matrix effect and applicability features of kits should be taken into consideration [28]. The ability of kits to work with various matrices will make it easier to adapt to changing sampling procedures [44, 49].

Another crucial issue is that SARS-CoV-2 is an RNA virus and since the structure of RNA is much more sensitive than DNA to environmental factors, the integrity of RNA viruses can be more affected by transport and storage conditions [50, 51]. Swab variety, different viral transport media and PCR inhibitors can affect PCR-based viral detection [9, 46]. The US-CDC reported that swab samples should only be collected with a synthetic-tipped swab and the swab should be used with an aluminium or plastic shaft. Cotton swabs are not recommended in the US-CDC guideline, while transport of cotton swabs in viral transport medium (VTM) is considered appropriate in the Korean guidelines [44, 52]. Recently it has been reported that samples collected in VTM reduce the sensitivity of POC COVID-19 tests and the US-CDC updated guidance also noted that for some POC tests the use of VTM is not advised [44, 53]. In addition one manufacturer added further information to their IFU; indicating swabs should be placed directly in the POC instrument for testing and specimens in VTM are not an appropriate sample type [54].

In the Chinese Center for Disease Control (China-CDC) guidelines for SARS-Cov-2 molecular assays, there is no detailed information about swab suitability for different specimen types, but it is stated swabs can be placed in different VTM such as isotonic saline solution, tissue culture solution, or phosphate buffer solution [49]. The US-CDC has also published a standardized VTM contents and protocol to enable laboratory VTM reagent preparation [55]. Further, some SARS-CoV-2 RT-PCR kits contain specific swabs and VTMs and these kits are not guaranteed to work when using different swab types and VTM [45, 49, 55, 56]. The specimen collection and transport materials that are supplied with any product should be evaluated during test selection. Additionally, the pre-analytic phase gains more importance for home sample collection kits. An effective self-sampling of patients, contamination of the swabs, and the use of nasal swabs in self collection kits instead of nasopharyngeal swabs used in healthcare settings can have an impact on disease control by adversely affecting test results and clinical diagnosis [57].

Target genes for molecular diagnostic SARS-CoV-2 tests

Coronaviruses of the Coronaviridae family are enveloped zoonotic RNA viruses. Mammals serve as an intermediate host and contribute to coronavirus genetic diversity by facilitating recombination and mutation [58, 59]. The SARS-CoV-2 has a 29,903-nucleotide long viral genome with genes encoding structural proteins: spike (S), envelope (E), transmembrane (M), helicase (Hel), and nucleocapsid (N). There are also species-specific genes necessary for viral replication. These are RNA dependent RNA polymerase (RdRp), hemagglutinin-esterase (HE) and open reading frames ORFla and ORF1b [45, 60]. The N, E, S, ORF and RdRp are the target viral genes that have been used for molecular diagnostic tests, with test kits having numerous different primer sets directed against these regions [45, 61, 62]. Several SARS-CoV-2 RT-PCR based detection protocols have also been published by the World Health Organization [62] and the target genes of current SARS-Cov-2 tests from different organisations/institutions are shown in Table 1.

Table 1.

SARS-CoV-2 molecular test gene target regions [11, 62]

Country Organisation/Institute Gene targets forward and reverse primer sequences (5’-3’)
China Chinese Center for Disease Control and Prevention Target 1: ORF1ab
 CCDC-ORF1- F: 5’-CCCTGTGGGTTTTACACTTAA-3’
 CCDC-ORF1-R: 5’-ACGATTGTGCATCAGCTGA-3’
Target 2: N
 CCDC-N-F: 5’-GGGGAACTTCTCCTGCTAGAAT-3’
 CCDC-N-R: 5’-CAGACATTTTGCTCTCAAGCTG-3’
Germany Charitè Target 1: RdRp
 RdRp_SARSr-F: 5’-GTGARATGGTCATGTGTGGCGG-3’
 RdRp_SARSr-R: 5’CARATGTTAAASACACTATTAGCATA-3’
Target 2:E
 E_Sarbeco-F:ACAGGTACGTTAATAGTTAATAGCGT
 E_Sarbeco-R:ATATTGCAGCAGTACGCACACA
Hong Kong SAR Hong Kong University Target 1: ORF 1b-nsp14
 HKU-ORF1-F: 5’-TGGGGYTTTACRGGTAACCT-3’
 HKU-ORF1-R: 5’-AACRCGCTTAACAAAGCACTC-3’
Target 2: N
 HKU-N-F: 5’-TAATCAGACAAGGAACTGATTA-3’
 HKU-N-R: 5’-CGAAGGTGTGACTTCCATG-3’
Thailand National Institute of Health Target 1:N
 WH-NIC N-F:CGTTTGGTGGACCCTCAGAT
 WH-NIC N-R:CCCCACTGCGTTCTCCATT
USA United States Centers for Disease Control and Prevention Three targets in N gene
 Target 1: N1
  2019-nCoV_N1-F: 5’-GAC CCC AAA ATC AGC GAA AT-3’
  2019-nCoV_N1-R: 5’-TCT GGT TAC TGC CAG TTG AAT CTG-3’
 Target 2: N2
  2019-nCoV_N2-F: 5’-TTA CAA ACA TTG GCC GCA AA-3’
  2019-nCoV_N2-R: 5’-GCG CGA CAT TCC GAA GAA-3’
 Target 3: N3
  2019-nCoV_N3-F: 5’-GGG AGC CTT GAA TAC ACC AAA A-3’
  2019-nCoV_N3-R: 5’-TGT AGC ACG ATT GCA GCA TTG-3’
France Pasteur Institute, Paris Two targets in RdRp gene
 Target 1: RdRP/nCoV_IP2
  nCoV_IP2-F: 5’-ATGAGCTTAGTCCTGTTG-3’
  nCoV_IP2-R: 5’-CTCCCTTTGTTGTGTTGT-3’
 Target 2:RdRP/nCoV_IP4
  nCoV_IP4-F: 5’-GGTAACTGGTATGATTTCG-3’
  nCoV_IP4-R: 5’-CTGGTCAAGGTTAATATAGG-3’

RdRp rna-bound rna polymerase, E envelope, N nucleocapsid, ORF open reading frame, F Forward, R Reverse

It is necessary to evaluate the analytical performance of different kits to ensure the test results are correctly interpreted. In in vitro sensitivity studies, the most sensitive target gene regions were determined to be the E gene and RdRp gene [11]. Comparison of the analytical performance and sensitivities of SARS-CoV-2 RT-PCR assays by the China-CDC, Charité (Universitätsmedizin Berlin Institute of Virology, Germany), US-CDC and Hong Kong University (HKU) revealed different analytical sensitivities between these assays when testing samples with low viral loads [63, 64]. Additionally, many of the available kits target different genes and do not provide the primer sequences data. This complicates kit selection as well as validation and verification of the sensitivity of the primer sets [65].

SARS-Cov-2 mutation and viral evolution

Mutations occurring within the primer–probe binding sequences of target gene are another potentially crucial issue in SARS-CoV-2 transmission and re-infection [33]. The analysis of 7666 SARS-CoV-2 genomes revealed 198 repetitive mutations in the SARS-CoV-2 genome. Numerous repetitive mutations have been detected in the Orf1ab in region encoding Nsp6, Nsp11, Nsp13 and the gene region encoding the S protein [66]. In another study 2,492 SARS-CoV-2 genome sequences were analysed and 1407 mutations were detected, of which 337 were in structural regions, including 173, 30, 25 and 109 mutations in S, M, E and N genes respectively [67]. Coding and non-coding mutations, SARS-CoV-2 variants show that SARS-CoV-2 exerts ongoing evolution [66–70]. Viral evolution can potentially cause a decrease in the sensitivity of SARS-CoV-2 assays due to primer or probe binding mismatch [71]. One study reviewed 992 SARS-CoV-2 sequences and 12 nucleotide mismatches in the primary-probe binding region of at least two virus sequences were detected during the early stages of the pandemic [63]. Therefore, mutations and global diversity in the SARS-CoV-2 genome sequence are a crucial point when considering appropriate test selection. Whole-genome sequencing (WGS) can overcome the mutation-based problems which can increase the false-negative rate in RT-PCR based assays. However, WGS is not practical, cost-effective and applicable to clinical laboratories as a primary detection assay [72]. Nevertheless, analysis of SARS-CoV-2 target gene mutations and dynamic sequence analysis for determination of the targeted gene in the tests to be developed plays a vital role in the success of innovative tests [66, 72].

Recently, the United Kingdom reported the emergence of the SARS-CoV-2 Alpha variant B.1.1.7, which is highly transmissible and spread rapidly to other countries. Similarly, the Beta variant (known as B.1.351), Gamma variant (B.1.1.28.1) and Delta variant (B.1.617.2) have since been found in countries worldwide [73]. The FDA has published a letter to healthcare providers warning that mutations in the virus genome target regions may create primary probe incompatibility and that genetic variants can increase false negative results. The FDA also noted that tests that rely on the detection of multiple regions of the genome may be less impacted by genetic variation in the SARS-CoV-2 genome than tests that rely solely on detection of only a single region [74]. Therefore, the ability of kits to detect multiple variants and any updated test performance of kits should be taken into consideration. Specific SARS-CoV-2 variant detection kits may also be needed to screen for cases that are clinically compatible, abut have a high risk of false negativity [74, 75].

Inadequate SARS-Cov-2 kit verification

During routine use, it is imperative to monitor and document test performance and user complaints to the regulatory authorities. In Supplementary Table 1, each approved EUA test has its own characteristics and limitations. The verification phase is important in objectively evaluating the accuracy of kits. For this reason, on 3 April 2020, the American Society of Microbiology published a protocol describing the verification process of commercial SARS-CoV-2 kits, which are used in clinical laboratories [15, 18, 21, 33]. In the first step of verification, the information reported by the manufacturer is verified. In the second step, accuracy and precision studies are performed [15]. Accuracy is evaluated by comparing patient results with another EUA approved kit. Precision includes repeatability and reproducibility, it provides information about the study within-run variability, variability between-days, between runs, between lots, between operators and instruments [76]. Quality control is another component of monitoring the performance of a test in routine use [21]. Internal controls are necessary for evaluation of specimen quality, as well as RNA isolation and amplification steps [9]. This involves the use of an extraction negative control, extraction positive control, no template control and positive template control. External quality control assurance is a program in which blind panels of verified positive and negative samples are periodically sent to participating laboratories from a single coordinating center. The results of each laboratory are compared to the results of other laboratories and/or to an assigned value. Comparative results from all peer groups using the same method and device are reported to all participating laboratories. External quality assessment (EQA) materials usually include internationally accepted standards [77–79] (https://aslm.org/wp-content/uploads/2020/05/Assuring-quality-test-results-short-version-pdf.pdf?x78457). Information about internal quality controls for the extraction and amplification steps as well as external quality control materials and supply conditions can be obtained from EUA kit manufacturers.

Discussion

The COVID-19 pandemic has been a significant issue for global health, society and economies. The chief executive and general manager of the WHO, Tedros Ghebreyesus emphasized that countries should give priority to diagnostic testing and isolation by saying: “You cannot fight a fire blindfolded” [80]. However, what is more important than providing a result in clinical laboratories is to give an accurate result [81]. Diagnostic errors are critical clinically and economically and the effects of diagnostic errors are compounding during outbreaks [82]. Unnecessary quarantining and treatment of a patient that has a false positive test result can cause significant impacts on individuals, as well as loss of workforce and time for healthcare workers and unnecessary cost. In addition, false negative test results of asymptomatic or mildly symptomatic patients create a risk to pandemic control [19]. Surgical mortality and pulmonary complications may also occur due to peri-operative infection in patients with false negative pre-operative screening results and also pose a risk for surgical crew [83]. Further, convalescent immune plasma therapy is a promising treatment for SARS-CoV-2 and the eligibility criteria for donors and patients is determined by RT-PCR testing [84]. Therefore, high false negativity of SARS-CoV-2 diagnostic tests can challenge pandemic management at multiple points [19].

Rapidly produced SARS-CoV-2 RT-PCR tests have been able to obtain FDA-EUA and is a new classification for clinical laboratories. Also, diagnostic performance problems of SARS-CoV-2 molecular test have increased questions about diagnostic molecular test selection in clinical laboratories. In one study, false negativity rates of two tests that approved FDA-EUA were 14.8% and 11% [85]. Feng et al. recommended chest computer tomography to detect the first-period change of COVID-19 when RT-PCR test results are negative [86]. This is not only an issue for false negative and false positive results, but also for conflicting results that vary from initial and subsequent confirmatory tests and may be due to pre-analytical (viral load) or analytical factors [19, 87]. Many studies associate false negative results with the pre-analytical phase. Different studies have shown that viral RNA is detected in different patterns depending on sample type and the time of sample collection and the disease phase [46]. It is important to carefully consider pre-analytical variables that will affect test clinical performance. However, in a comparison study in which the pre-analytical phase conditions were equal for all kits tested, seven commercial kits (which were granted FDA-EUA) were compared with an in-house kit and the diagnostic sensitivity values ranged from 62.5% to 81.2% [88].

The accurate diagnosis of patients infected with SARS-CoV-2 is crucial to controlling the spread of SARS-CoV-2. However, some RT-PCR based diagnostic assays do not meet proper clinical diagnostic performance standards. These tests are recommended to be performed by trained staff in central laboratories and may not be widely deployed in undeveloped countries with limited health care facilities, or in remote locations. Although the diagnosis of SARS-CoV-2 by RT-PCR is mostly laboratory-based, molecular-based POC tests may be an attractive alternative due to reduced transport problems and relatively shorter turnaround times. POC tests can be used in any location, such as hospitals, clinics, emergency departments or remote locations [89, 90]. In Supplementary Table 1, molecular POC assays that use isothermal nucleic acid amplification technology for the detection of SARS-CoV-2 is shown. However, in comparative diagnostic accuracy studies, the performance of POC tests was found to have significant limitations for the diagnosis of SARS-CoV-2 [85, 91, 92]. Although NGS based detection provides better results, it is not a cost-effective and practical method for routine clinical diagnosis [93]. Similarly, ddPCR is more sensitive than RT-PCR and allows the detection of lower viral loads, but has low throughput and requires more specialised technical settings and equipment, making it unsuitable for widespread use [24, 25].

Epidemiologically regional and common mutations in primer and probe target regions in the SARS-CoV-2 genome should be considered in kit selection. Although primers and probes are specifically designed against protected areas of the viral genome, mismatches between primers and probes and target sequences can occur and result in decreased test accuracy [71]. These primary probe mismatch mutations can also affect assay annealing temperatures and increase the risk of dimer and hairpin formation of primers [94]. RT-PCR approaches that target multiple genes may overcome mutation based errors. This would potentially increase the amount of information gained from a single test, improve diagnostic specificity and reduce reagent usage and cost, as well as workload in clinical laboratories [17, 95, 96]. Considering that SARS-CoV-2 is continuously evolving and accumulating mutations, access to genome sequencing data to assist primers and probe design is an important requirement for assay developers and is likely to decrease false negative rates. Improving the multiplex properties of nucleic acid tests and integrating these with serological tests may also improve test accuracy [17, 95]. Further, combined tests may enable better differentiation of false negatives in the early and late phases of infection [19, 97].

The clinical performance of commercial kits should be evaluated objectively and publicly shared by the authoritative institutions. Rapidly produced tests do not go through the verification phase and clinical trials have been inadequate [37]. In order to provide users with more accurate diagnostic kits, several organizations have invited assay developers to evaluate their test products independently [27, 98]. In order to compare the kits, the LoD values obtained using standardized reference material are shown in Supplementary Table 1 [99]. The Foundation for Innovative New Diagnositics (FIND) is an organization that is working with the WHO and in partnership with the University Hospital of Geneva (HUG) to evaluate assays to verify molecular test kits detection limit, and clinical performance data reported by vendors. The evaluated commercial test data is now being published on the FIND website [98]. While diagnostic sensitivities ranging from 90 to 100% have been reported by FIND, the fact that tests perform at approximately 70% of diagnostic sensitivity in routine use emphasizes the importance of verification by end users [15, 35]. Monitoring and publishing the performance of kits will be a useful guide for users in selecting tests [33]. An important part of test performance monitoring is the quality control phase. External quality control is a critical process for the verification of molecular assay accuracy. It is recommended that an international external quality assessment is needed to assess the quality of assays used [38]. Procedures for internal quality control and external quality control of molecular tests and the provision of control materials with kits is also critical in test selection [81, 95].

It is clear that pandemics affect the economies of all countries, and successive waves of infection magnify this problem. Choosing a cost-effective high performance test by considering the above parameters during kit selection will enhance the role and success of clinic laboratories in pandemic management.

Conclusion

Early and accurate diagnosis of SARS-CoV-2 is the first of a number interventions required for effective pandemic management. It is essential to increase the diagnostic sensitivity and specificity of SARS-CoV-2 tests to minimize the impact of the pandemic on the global health system. Therefore, laboratories and national authorities should consider types of RT-PCR tests (one-step vs. two-step), pre-analytical factors (types of samples, interfering substances, transport conditions), diagnostic and analytical accuracy (specificity, sensitivity), target genes analysed, mutation variants of the virus, quality control requirements in PCR test selection. Further, laboratories should verify kits under laboratory conditions and monitor performance data. Requesting updated diagnostic performance data from manufacturers as part of the test selection process will encourage companies to evaluate their commercial kits by independent authorities.

Supplementary Information

Below is the link to the electronic supplementary material.

Acknowledgements

None.

Author contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Evin Özcan İşcan, Özden Öz, Tuğçe Batur, Aybike Erdoğan, Seval Kılıç, Zeynep Mutlu. The first draft of the manuscript was written by Huriye Erbak Yilmaz. Kevin Spring and Murat Yilmaz contributed to the review and editing. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

No financial support or funding was received for this paper.

Declarations

Conflict of interest

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Huriye Erbak Yılmaz, Email: huriyeerbak@hotmail.com, Email: huriye.erbak@msfr.ibg.edu.tr.

Evin Iscan, Email: evin.iscan@ibg.edu.tr.

Ozden Oz, Email: ozden.oz@msfr.ibg.edu.tr.

Tuğçe Batur, Email: tugce.batur@ibg.edu.tr.

Aybike Erdoğan, Email: aybike.erdogan@msfr.ibg.edu.tr.

Seval Kılıç, Email: seval.kilic@msfr.ibg.edu.tr.

Zeynep Mutlu, Email: zeynep.mutlu@ozal.edu.tr.

Murat Yılmaz, Email: murat.yilmaz@deu.edu.tr.

Kevin J. Spring, Email: k.spring@westernsydney.edu.au

References

  • 1.World Health Organization. Available at: https://www.who.int/csr/don/05-january-2020-pneumonia-of-unkown-cause-china/en/. Accessed January 5th 2020
  • 2.European Centre for Disease Prevention and Control (ECDC). Risk assessment: Outbreak of acute respiratory syndrome associated with a novel coronavirus, Wuhan, China. Available at: https://www.ecdc.europa.eu/en. Accessed January 22nd 2020
  • 3.Lu R, Zhao X, Li J, Niu P, Yang B, Wu H, Wang W, Song H, Huang B, Zhu N, Bi Y, Ma X, Zhan F, Wang L, Hu T, Zhou H, Hu Z, Zhou W, Zhao L, Chen J, Meng Y, Wang J, Lin Y, Yuan J, Xie Z, Ma J, Liu WJ, Wang D, Xu W, Holmes EC, Gao GF, Wu G, Chen W, Shi W, Tan W. Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020;395(10224):565–574. doi: 10.1016/S0140-6736(20)30251-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bai Y, Yao L, Wei T, Tian F, Jin DY, Chen L, Meiyun WM. Presumed asymptomatic carrier transmission of COVID-19. JAMA. 2020;323(14):1406–1407. doi: 10.1001/jama.2020.2565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Patel R, Babady E, Theel ES, Storch GA, Pinsky BA, St. George K, Smith TC, Bertuzzi S. Report from the American Society for Microbiology COVID-19 International Summit, 23 March 2020: value of diagnostic testing for SARS-CoV-2/COVID-19. mBio. 2020;11(2):e0072220. doi: 10.1128/mBio.00722-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.World Health Organization. Laboratory testing strategy recommendations for COVID-19. 2020) Available at: https://apps.who.int/iris/handle/10665/331509. Accessed March 16th 2020
  • 7.Ramdas K, Darzi A, Jain S. ‘Test, re-test, re-test’: using inaccurate tests to greatly increase the accuracy of COVID-19 testing. Nat Med. 2020;26(6):810–811. doi: 10.1038/s41591-020-0891-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.World Health Organization. Operational considerations for case management of COVID-19 in health facility and community. Available at: https://apps.who.int/iris/bitstream/handle/10665/331492/WHO-2019-nCoV-HCF_operations-2020.1-eng.pdf?sequence=1&isAllowed=y. Accessed March 19th 2020
  • 9.World Health Organization. Laboratory testing for 2019 novel coronavirus (2019-nCoV) in suspected human cases. WHO - Interim Guid. (2020) Available at: https://www.who.int/publications/i/item/10665-331501. Accessed March 2nd 2020
  • 10.Das P, Mondal S, Pal S, Roy S, Vidyadharan A, Dadwal R, Bhattacharya S, Mishra DK, Chandy M. COVID diagnostics by molecular methods: a systematic review of nucleic acid based testing systems. Indian J Med Microbiol. 2021;39(3):271–278. doi: 10.1016/j.ijmmb.2021.05.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, Bleicker T, Brünink S, Schneider J, Schmidt ML, Mulders DG, Haagmans BL, van der Veer B, van den Brink S, Wijsman L, Goderski G, Romette JL, Ellis J, Zambon M, Peiris M, Drosten C. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance. 2020;25(3):2000045. doi: 10.2807/1560-7917.ES.2020.25.3.2000045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.FDA. Emergency Use Authorization Available at: https://www.fda.gov/emergency-preparedness-and-response/mcm-legal-regulatory-and-policy-framework/emergency-use-authorization. Accessed February 29th 2020
  • 13.FDA. Individual EUAs for Molecular Diagnostic Tests for SARS-CoV-2 Available at: https://www.fda.gov/medical-devices/coronavirus-disease-2019-covid-19-emergency-use-authorizations-medical-devices/in-vitro-diagnostics-euas-molecular-diagnostic-tests-sars-cov-2#individual-molecular. Accessed April 1st 2021
  • 14.Statistical Guidance on Reporting Results from Studies Evaluating Diagnostic Tests - Guidance for Industry and FDA Staff. Available from: https://www.fda.gov/regulatory-information/search-fda-guidance-documents/statistical-guidance-reporting-results-studies-evaluating-diagnostic-tests-guidance-industry-and-fda. Accessed March 13th 2007
  • 15.Mitchell SL, St George K, Rhoads DD, Butler-Wu SM, Dharmarha V, McNult P, Miller MB. Understanding, verifying and implementing emergency use authorization molecular diagnostics for the detection of SARS-CoV-2 RNA. J Clin Microbiol. 2020;58(8):e00796–e820. doi: 10.1128/JCM.00796-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Molecular Diagnostic Template for Manufacturers. Available from: https://www.fda.gov/medical-devices/emergency-situations-medical-devices/emergency-use-authorizations.Accessed July 28th 2020
  • 17.Udugama B, Kadhiresan P, Kozlowski HN, Malekjahani A, Osborne M, Li VYC, Chen H, Mubareka S, Gubbay JB, Chan WCW. Diagnosing COVID-19: the disease and tools for detection. ACS Nano. 2020;14(4):3822–3835. doi: 10.1021/acsnano.0c02624. [DOI] [PubMed] [Google Scholar]
  • 18.Saah AJ, Hoover DR. “Sensitivity” and “Specificity” reconsidered: the meaning of these terms in analytical and diagnostic settings. Ann Intern Med. 1997;126(1):91–4. doi: 10.7326/0003-4819-126-1-199701010-00026. [DOI] [PubMed] [Google Scholar]
  • 19.Lippi G, Simundic A-M, Plebani M. Potential preanalytical and analytical vulnerabilities in the laboratory diagnosis of coronavirus disease 2019 (COVID-19) Clin Chem Lab Med. 2020;58(7):1070–1076. doi: 10.1515/cclm-2020-0285. [DOI] [PubMed] [Google Scholar]
  • 20.Grenier J, Pinto L, Nair D, Steingart K, Dowdy D, Ramsay A, Pai M. Widespread use of serological tests for tuberculosis: data from 22 high-burden countries. Eur Respir J. 2012;39(2):502–505. doi: 10.1183/09031936.00070611. [DOI] [PubMed] [Google Scholar]
  • 21.Kosack CS, Page AL, Klatser PR. A guide to aid the selection of diagnostic tests. Bull World Health Organ. 2017;95(9):639–645. doi: 10.2471/BLT.16.187468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wacker MJ, Godard MP. Analysis of one-step and two-step real-time RT-PCR using SuperScript III. J Biomol Tech : JBT. 2005;16(3):266–271. [PMC free article] [PubMed] [Google Scholar]
  • 23.Wong MLMJ. Real-time PCR for mRNA quantitation. Biotechniques. 2005;39(1):75–85. doi: 10.2144/05391RV01. [DOI] [PubMed] [Google Scholar]
  • 24.Carter LJ, Garner LV, Smoot JW, Li Y, Zhou Q, Saveson CJ, Sasso JM, Gregg AC, Soares DJ, Beskid TR, Jervey SR, Liu C. Assay techniques and test development for COVID-19 diagnosis. ACS Cent Sci. 2020;6(5):591–605. doi: 10.1021/acscentsci.0c00501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Shen M, Zhou Y, Ye J, Abdullah Al-Maskri AA, Kang Y, Zeng S, Cai S. Recent advances and perspectives of nucleic acid detection for coronavirus. J Pharm Anal. 2020;10(2):97–101. doi: 10.1016/j.jpha.2020.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kashir J, Yaqinuddin A. Loop mediated isothermal amplification (LAMP) assays as a rapid diagnostic for COVID-19. Med Hypotheses. 2020;141:109786. doi: 10.1016/j.mehy.2020.109786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.World Health Organization. Instructions for Submission Requirements: In vitro diagnostics (IVDs) Detecting SARS-CoV-2 Nucleic Acid. Available at: https://www.who.int/diagnostics_laboratory/200428_final_pqt_ivd_347_instruction_ncov_nat_eul.pdf?ua=1. Accessed April 20th 2020
  • 28.Broeders S, Huber I, Grohmann L, Berben G, Taverniers I, Mazzara M, Roosensa N, Morissetg D. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci Technol. 2014;37(2):115–26. doi: 10.1016/j.tifs.2014.03.008. [DOI] [Google Scholar]
  • 29.Pillet S, Lardeux M, Dina J, Grattard F, Verhoeven P, Le Goff J, Vabret A, Pozzetto B. Comparative evaluation of six commercialized multiplex PCR kits for the diagnosis of respiratory infections. PLoS ONE. 2013;8(8):72174–72174. doi: 10.1371/journal.pone.0072174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.World Health Organization. Instructions for Submission Requirements: In vitro diagnostics (IVDs) Detecting SARS-CoV-2 Nucleic Acid. Available at: https://www.who.int/diagnostics_laboratory/200324_final_pqt_ivd_347_instruction_ncov_nat_eul.pdf?ua=1. Accessed March 23th 2020
  • 31.Garnett E, Jung J, Tam E, Rajapakshe D, Cheney S, Brown C, Cao J, Muldrew K, Singh I, Versalovic J, Devaraj S. Clinical validation and performance evaluation of the automated vitros total anti-SARS-CoV-2 antibodies assay for screening of serostatus in COVID-19. Am J Clin Pathol. 2020;154(6):742–747. doi: 10.1093/ajcp/aqaa157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.FINDXX. Available at: https://www.finddx.org/covid-19/pipeline/. Accessed April 1st 2020
  • 33.Prinzi A. (2020). False Negatives and Reinfections: the Challenges of SARS-CoV-2 RTPCR Testing Available at: https://asm.org/Articles/2020/April/False-Negatives-and-Reinfections-the-Challenges-of Accesed April 27th 2020
  • 34.Trevethan R. Sensitivity, specificity, and predictive values: foundations, pliabilities, and pitfalls in research and practice. Front publ Heal. 2017;5:307. doi: 10.3389/fpubh.2017.00307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fang Y, Zhang H, Xie J, Lin M, Ying L, Pang P, Ji W. Sensitivity of chest CT for COVID-19: comparison to RT-PCR. Radiology. 2020;296(2):E115–E117. doi: 10.1148/radiol.2020200432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ai T, Yang Z, Hou H, Zhan C, Chen C, Lv W, Tao Q, Sun Z, Xia L. Correlation of chest CT and RT-PCR testing for coronavirus DISEASE 2019 (COVID-19) in China: a report of 1014 cases. Radiology. 2020;296(2):E32–E40. doi: 10.1148/radiol.2020200642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Jarvis KF, Kelley JB. Temporal dynamics of viral load and false negative rate influence the levels of testing necessary to combat COVID-19 spread. Sci Rep. 2021;11(1):9221. doi: 10.1038/s41598-021-88498-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Cohen AN, Kessel B. (2020). False positives in reverse transcription PCR testing for SARS-CoV-2. medRxiv. doi: 10.1101/2020.04.26.20080911
  • 39.Healy B, Khan A, Metezai H, Blyth I, Asad H. The impact of false positive COVID-19 results in an area of low prevalence. Clin Med (Lond) 2021;21(1):e54–e56. doi: 10.7861/clinmed.2020-0839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lippi G, Simundic AM. European Federation for Clinical Chemistry and Laboratory Medicine (EFLM) working group for pre-analytical phase (WG-PRE). The EFLM strategy for harmonization of the pre-analytical phase. Clin Chem Lab Med. 2018;56(10):1660–1666. doi: 10.1515/cclm-2017-0277. [DOI] [PubMed] [Google Scholar]
  • 41.Hawkins R. Managing the pre- and post-analytical phases of the total testing process. Ann Lab Med. 2012;32(1):5–16. doi: 10.3343/alm.2012.32.1.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Cheng MP, Papenburg J, Desjardins M, Kanjilal S, Quach C, Libman M, Dittrich S, Yansouni CP. Diagnostic testing for severe acute respiratory syndrome-related coronavirus-2: a narrative review. Ann Intern Med. 2020;172(11):726–734. doi: 10.7326/M20-1301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Tang Y-W, Schmitz JE, Persing DH, Stratton CW. The Laboratory Diagnosis of COVID-19 Infection: Current Issues and Challenges. J Clin Microbiol. 2020;58(6):e00512. doi: 10.1128/JCM.00512-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.CDC. Interim Guidelines for Collecting and Handling of Clinical Specimens for COVID-19 Testing Available at: https://www.cdc.gov/coronavirus/2019-ncov/lab/guidelines-clinical-specimens.html. Accessed March 21st 2020
  • 45.Hong KH, Lee SW, Kim TS, Huh HJ, Lee J, Kim SY, Park JS, Kim GJ, Sung H, Roh KH, Kim JS, Kim HS, Lee ST, Seong MW, Ryoo N, Lee H, Kwon KC, Yoo CK. Guidelines for laboratory diagnosis of coronavirus disease 2019 (COVID-19) in Korea. Ann Lab Med. 2020;161(17):667–671. doi: 10.3343/alm.2020.40.5.351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Yang Y, Yang M, Yuan J, Wang F, Wang Z, Li J, Zhang M, Xing L, Wei J, Peng L, Wong G, Zheng H, Wu W, Shen C, Liao M, Feng K, Li J, Yang Q, Zhao J, Liu L, Liu Y. (2020). Evaluating the accuracy of different respiratory specimens in the laboratory diagnosis and monitoring the viral shedding of 2019-nCoV infections. medRxiv. 10.1101/2020.02.11.20021493
  • 47.Xu R, Cui B, Duan X, Zhang P, Zhou X, Yuan Q. Saliva: potential diagnostic value and transmission of 2019-nCoV. Int J Oral Sci. 2020;12(1):11. doi: 10.1038/s41368-020-0080-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Azzi L, Carcano G, Gianfagna F, Grossi P, Gasperina DD, Genoni A, Fasano M, Sessa F, Tettamanti L, Carinci F, Maurino V, Rossi A, Tagliabue A, Baj A. Saliva is a reliable tool to detect SARS-CoV-2. J Infect. 2020;81(1):e45–e50. doi: 10.1016/j.jinf.2020.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Technical Guidelines for COVID-19 Laboratory Testing Chinese Center for Disease Control and Prevention. Available at: http://www.chinacdc.cn/en/COVID19/202003/P020200323390321297894.pdf Accessed March 15th 2020. [DOI] [PMC free article] [PubMed]
  • 50.Van Doremalen N, Bushmaker T, Morris DH, Holbrook MG, Gamble A, Williamson BN, Tamin A, Harcourt JL, Thornburg NJ, Gerber SI, Lloyd-Smith JO, de Wit E, Munster VJ. Aerosol and surface stability of SARS-CoV-2 as compared with SARS-CoV-1. N Engl J Med. 2020;382(16):1564–1567. doi: 10.1056/NEJMc2004973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Relova D, Rios L, Acevedo AM, Coronado L, Perera CL, Pérez LJ. Impact of RNA degradation on viral diagnosis: an understated but essential step for the successful establishment of a diagnosis network. Vet Sci. 2018;5(1):19. doi: 10.3390/vetsci5010019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Hong KH, Lee SW, Kim TS, Huh HJ, Lee J, Kim SY, Park JS, Kim GJ, Sung H, Roh KH, Kim JS, Kim HS, Lee ST, Seong MW, Ryoo N, Lee H, Kwon KC, Yoo CK. Guidelines for laboratory diagnosis of coronavirus disease 2019 (COVID-19) in Korea. Ann Lab Med. 2020;40(5):351–360. doi: 10.3343/alm.2020.40.5.351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Mitchell SL, George KS. Evaluation of the COVID19 ID NOW EUA assay. J Clin Virol. 2020;128:104429. doi: 10.1016/j.jcv.2020.104429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.ID NOW COVID-19 Technical Brief-April 2020 Sample Type Labeling Update. Abbott Diagnostics Scarborough, Inc (2020). Available at: https://www.abbott.com/corpnewsroom/diagnostics-testing/customer-update-on-our-idnow-covid-19-test.html Accessed April 15th 2020
  • 55.Interim Guidelines for Collecting, Handling, and Testing Clinical Specimens for COVID-19 Available at: https://www.cdc.gov/coronavirus/2019-ncov/lab/guidelines-clinical-specimens.html. Accessed May 22nd 2020)
  • 56.Clinical management of severe acute respiratory infection when COVID-19 is suspected. Available at: https://www.who.int/ publications-detail/clinical-management-of-severe-acuterespiratory-infection-when-novel-coronavirus-(ncov)-infection-issuspected. Accessed January 12th 2020
  • 57.IFCC. Available at: https://www.ifcc.org/media/478434/hahnhometestingfinal.pdf. Accessed April 30th 2020
  • 58.Peiris JS, Guan Y, Yuen KY. Severe acute respiratory syndrome. Nat Med. 2004;10(12 Suppl):S88–S97. doi: 10.1038/nm1143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Ye Z-W, Yuan S, Yuen K-S, Fung S-Y, Chan C-P, Jin D-Y. Zoonotic origins of human coronaviruses. Int J Biol Sci. 2020;16(10):1686–1697. doi: 10.7150/ijbs.45472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, Hu Y, Tao ZW, Tian JH, Pei YY, Yuan ML, Zhang YL, Dai FH, Liu Y, Wang QM, Zheng JJ, Xu L, Holmes EC, Zhang YZ. A new coronavirus associated with human respiratory disease in China. Nature. 2020;579(7798):265–269. doi: 10.1038/s41586-020-2008-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.World Health Organization. Laboratory testing for coronavirus disease 2019 (COVID-19) in suspected human cases: interim guidance. Available at: https://www.who.int/publications/i/item/laboratory-testing-of-2019-novel-coronavirus-(-2019-ncov)-in-suspected-human-cases-interim-guidance-17-january-2020. Accessed March 19th 2020
  • 62.World Health Organization. WHO technical guidance on COVID-19 Available at: https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance Accessed January 24th 2020
  • 63.Vogels CBF, Brito AF, Wyllie AL, Fauver JR, Ott IM, Kalinich CC, Petrone ME, Casanovas-Massana A, Catherine Muenker M, Moore AJ, Klein J, Lu P, Lu-Culligan A, Jiang X, Kim DJ, Kudo E, Mao T, Moriyama M, Oh JE, Park A, Silva J, Song E, Takahashi T, Taura M, Tokuyama M, Venkataraman A, Weizman OE, Wong P, Yang Y, Cheemarla NR, White EB, Lapidus S, Earnest R, Geng B, Vijayakumar P, Odio C, Fournier J, Bermejo S, Farhadian S, Dela Cruz CS, Iwasaki A, Ko AI, Landry ML, Foxman EF, Grubaugh ND. Analytical sensitivity and efficiency comparisons of SARS-COV-2 qRT-PCR primer-probe sets. Nat Microbiol. 2020;5:1299–1305. doi: 10.1038/s41564-020-0761-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Kim, S.; Kim, D.; Lee, B. (2020). Insufficient Sensitivity of RNA Dependent RNA Polymerase Gene of SARS-CoV-2 Viral Genome as Confirmatory Test using Korean COVID-19 Cases doi: 10.20944/preprints202002.0424.v1
  • 65.Park M, Won J, Choi BY, Lee CJ. Optimization of primer sets and detection protocols for SARS-CoV-2 of coronavirus disease 2019 (COVID-19) using PCR and real-time PCR. Exp Mol Med. 2020;52:963–977. doi: 10.1038/s12276-020-0452-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.van Dorp L, Acman M, Richard D, Shaw LP, Ford CE, Ormond L, Owen CJ, Pang J, Tan CCS, Boshier FAT, Ortiz AT, Balloux F. Emergence of genomic diversity and recurrent mutations in SARS-CoV-2. Infect Genet Evol. 2020;83:104351. doi: 10.1016/j.meegid.2020.104351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Islam MR, Hoque MN, Rahman MS, Alam ASMRU, Akther M, Puspo JA, Akter S, Sultana M, Crandall KA, Hossain MA. Genome wide analysis of severe acute respiratory syndrome coronavirus-2 implicates World-Wide circulatory virus. Europe PMC. 2020 doi: 10.1038/s41598-020-70812-6. [DOI] [Google Scholar]
  • 68.Pachetti M, Marini B, Benedetti F, Giudici F, Mauro E, Storici P, Masciovecchio C, Angeletti S, Ciccozzi M, Gallo RC, Zella D, Ippodrino R. Emerging SARS-CoV-2 mutation hot spots include a novel RNA-dependent-RNA polymerase variant. J Transl Med. 2020;18(1):179. doi: 10.1186/s12967-020-02344-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Andersen KG, Rambaut A, Lipkin WI, Holmes EC, Garry RF. The proximal origin of SARS-CoV-2. Nat Med. 2020;26(4):450–452. doi: 10.1038/s41591-020-0820-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Phan T. Genetic diversity and evolution of SARS-CoV-2. Infect Genet Evol. 2020;81:104260. doi: 10.1016/j.meegid.2020.104260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Khan KA, Cheung P. Presence of mismatches between diagnostic PCR assays and coronavirus SARS-CoV-2 genome. R Soc Open Sci. 2020;7(6):200636. doi: 10.1098/rsos.200636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Yan C, Cui J, Huang L, Du B, Chen L, Xue G, Li S, Zhang W, Zhao L, Sun Y, Yao H, Li N, Zhao H, Feng Y, Liu S, Zhang Q, Liu D, Yuan J. Rapid and visual detection of 2019 novel coronavirus (SARS-CoV-2) by a reverse transcription loop-mediated isothermal amplification assay. Clin Microbiol Infect. 2020;26(6):773–779. doi: 10.1016/j.cmi.2020.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Singh J, Rahman SA, Ehtesham NZ, Hira S, Hasnain SE. SARS-CoV-2 variants of concern are emerging in India. Nat Med. 2021;27(7):1131–1133. doi: 10.1038/s41591-021-01397-4. [DOI] [PubMed] [Google Scholar]
  • 74.FDA. FDA Issues Alert Regarding SARS-CoV-2 Viral Mutation to Health Care Providers and Clinical Laboratory Staff Available at: https://www.fda.gov/news-events/press-announcements/fda-issues-alert-regarding-sars-cov-2-viral-mutation-health-care-providers-and-clinical-laboratory Accessed January 8th 2021
  • 75.Kami W, Kinjo T, Arakaki W, Oki H, Motooka D, Nakamura S, Fujita J. Rapid and simultaneous identification of three mutations by the Novaplex™ SARS-CoV-2 variants I assay kit. J Clin Virol Off Publ Pan Am Soc Clin Virol. 2021;141:104877. doi: 10.1016/j.jcv.2021.104877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Chesher D. Evaluating assay precision. Clin Biochem Rev. 2008;29(1):S23–S26. [PMC free article] [PubMed] [Google Scholar]
  • 77.Pelt-Verkuil EV, Belkum AV, Hays JP. Principles and technical aspects of PCR amplification. Netherlands: Springer; 2008. [Google Scholar]
  • 78.American Society for Laboratory Medicine. Assuring quality COVID-19 test results: quality control and external quality assurance strategies. Available at: https://aslm.org/wp-content/uploads/2020/05/Assuring-quality-test-results-short-version-pdf.pdf?x78457 Accessed May 1st 2020
  • 79.Matheeussen V, Corman VM, Donoso Mantke O, McCulloch E, Lammens C, Goossens H, Niemeyer D, Wallace PS, Klapper P, Niesters HG, Drosten C, Ieven M, RECOVER project and collaborating networks International external quality assessment for SARS-CoV-2 molecular detection and survey on clinical laboratory preparedness during the COVID-19 pandemic, April/May 2020. Eurosurveillance. 2020;25(27):2001223. doi: 10.2807/1560-7917.ES.2020.25.27.2001223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.WHO; 2020. WHO Director-General’s opening remarks at the media briefing on COVID Available at: https://www.who.int/director-general/speeches/detail/who-director-general-s-opening-remarks-at-the-media-briefing-on-covid-19. Accessed March 16th 2020
  • 81.Newton PN, Bond KC, 53 signatories from 20 countries COVID-19 and risks to the supply and quality of tests, drugs, and vaccines. Lancet Glob Health. 2020;8(6):e754–e755. doi: 10.1016/S2214-109X(20)30136-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Lippi G, Plebani M, Graber ML. Building a bridge to safe diagnosis in health care. The role of the clinical laboratory. Clin Chem Lab Med. 2016;54:1–3. doi: 10.1515/cclm-2015-1135. [DOI] [PubMed] [Google Scholar]
  • 83.COVIDSurg Collaborative. Mortality and pulmonary complications in patients undergoing surgery with perioperative SARS-CoV-2 infection: an international cohort study. Lancet. 2020;396(10243):27–38. doi: 10.1016/S0140-6736(20)31182-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Chen L, Xiong J, Bao L, Shi Y. Convalescent plasma as a potential therapy for COVID-19. Lancet Infect Dis. 2020;20(4):398–400. doi: 10.1016/S1473-3099(20)30141-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Winter L. False Negatives in Quick COVID-19 Test Near 15 Percent: Study. Scientist. Available from: https://www.the-scientist.com/news-opinion/false-negatives-in-quick-covid-19-test-near-15-percent-study-67451 Accessed April 21st 2020
  • 86.Feng H, Liu Y, Lv M, Zhong J. A case report of COVID-19 with false negative RT-PCR test: necessity of chest CT. Jpn J Radiol. 2020;38(5):409–410. doi: 10.1007/s11604-020-00967-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Li Y, Yao L, Li J, Chen L, Song Y, Cai Z, Yang C. Stability issues of RT-PCR testing of SARS-CoV-2 for hospitalized patients clinically diagnosed with COVID-19. J Med Virol. 2020;92(7):903–908. doi: 10.1002/jmv.25786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.van Kasteren PB, van der Veer B, van den Brink S, Wijsman L, de Jonge J, van den Brandt A, Molenkamp R, Reusken CBEM, Meijer A. Comparison of seven commercial RT-PCR diagnostic kits for COVID-19. J Clin Virol Off Publ Pan Am Soc Clin Virol. 2020;128:104412. doi: 10.1016/j.jcv.2020.104412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Yang T, Wang YC, Shen CF, Cheng CM. Point-of-Care RNA-Based Diagnostic Device for COVID-19. Diagn (Basel, Switzerland) 2020;10(3):165. doi: 10.3390/diagnostics10030165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Mattioli IA, Hassan A, Oliveira ON, Jr, Crespilho FN. On the Challenges for the diagnosis of SARS-CoV-2 based on a review of current methodologies. ACS Sens. 2020;5(12):3655–3677. doi: 10.1021/acssensors.0c01382. [DOI] [PubMed] [Google Scholar]
  • 91.Zhen W, Smith E, Manji R, Schron D, Berry GJ. Clinical Evaluation of three sample-to-answer platforms for the detection of SARS-CoV-2. J Clin Microbiol. 2020;58(8):e00783–e820. doi: 10.1128/JCM.00783-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Hogan CA, Sahoo MK, Huang C, Garamani N, Stevens B, Zehnder J, Pinsky BA. Five-minute point-of-care testing for SARS-CoV-2: not there yet. J Clin Virol. 2020;128:104410. doi: 10.1016/j.jcv.2020.104410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Li X, Geng M, Peng Y, Meng L, Lu S. Molecular immune pathogenesis and diagnosis of COVID-19. J Pharm Anal. 2020;10(2):102–108. doi: 10.1016/j.jpha.2020.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Lorenz TC. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies. J V Exp JoVE. 2012;63:e3998. doi: 10.3791/3998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Ishige T, Murata S, Taniguchi T, Miyabe A, Kitamura K, Kawasaki K, Nishimura M, Igari H, Matsushita K. Highly sensitive detection of SARS-CoV-2 RNA by multiplex rRT-PCR for molecular diagnosis of COVID-19 by clinical laboratories. Clin Chim Acta. 2020;507:139–142. doi: 10.1016/j.cca.2020.04.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Chen Y, Huang S, Zhou L, Wang X, Yang H, Li W. Coronavirus Disease 2019 (COVID-19): emerging detection technologies and auxiliary analysis. J Clin Lab Anal. 2022;36:e24152. doi: 10.1002/jcla.24152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Zhou Y, Pei F, Ji M, Wang L, Zhao H, Li H, Yang W, Wang Q, Zhao Q, Wang Y. Sensitivity evaluation of 2019 novel coronavirus (SARS-CoV-2) RT-PCR detection kits and strategy to reduce false negative. PLoS One. 2020;15(11):e0241469. doi: 10.1371/journal.pone.0241469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.FIND evaluation update: Sars-CoV-2 Molecular diagnostics. Available at: https://www.finddx.org/covid-19/sarscov2-eval-molecular/ Accessed July 3th 2020)
  • 99.SARS-CoV-2 Reference Panel Comparative Data Available at: https://www.fda.gov/medical-devices/coronavirus-covid-19-and-medical-devices/sars-cov-2-reference-panel-comparative-data Accessed October 30th 2020

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Molecular Biology Reports are provided here courtesy of Nature Publishing Group

RESOURCES