Skip to main content
PLOS One logoLink to PLOS One
. 2022 Apr 21;17(4):e0265184. doi: 10.1371/journal.pone.0265184

Evaluation of gene expression of PLEKHS1, AADAC, and CDKN3 as novel genomic markers in gastric carcinoma

Marwa Sayed Abdel-Tawab 1,*, Hanan Fouad 2,3, Asmaa M Othman 4, Ragaey A Eid 5, Marwa Abdeltawab Mohammed 6, Ahmed Hassan 7, Hoda Ramadan Reyad 1
Editor: Wen-Wei Sung8
PMCID: PMC9022821  PMID: 35446856

Abstract

Gastric cancer (GC) is considered lethal aggressive cancer. In Egypt, GC has a low incidence but unfortunately, it is mostly diagnosed at an advanced stage with a poor prognosis. Assessment of novel markers that can be used in the early detection of GC is an urgent need. The present study was performed to assess the association of the Pleckstrin homology domain-containing S1 (PLEKHS1)، arylacetamide deacetylase (AADAC, and Cyclin-dependent kinase inhibitor 3 (CDKN3) genes with GC and to correlate their gene expression levels with tumor stage, grade, and other clinicopathological features. The current work was performed on forty gastric tissue samples; twenty in Group 1 with GC tissues at different stages, and grades and twenty in Group 2 (control group) with non-tumorous tissue. PLEKHS1, AADAC, and CDKN3 gene expression were assessed by RT-qPCR. AADAC, CDKN3 genes were significantly (p<0.001) upregulated, while PLEKHS1 gene was significantly (p<0.001) downregulated in the GC group than the control group. AADAC gene expression exhibited a high significant (p<0.001) positive correlation with the tumor grades and the tumor stages. A high significant negative correlation between AADAC, and CDKN3 gene expression (r = -.760, p<0.001) was found. The three studied parameters showed high significant sensitivity and specificity in the prediction of the presence of GC. PLEKHS1, AADAC, and CDKN3 gene expressions were suggested to be used as diagnostic and predictive biomarkers of GC, additionally, AADAC may be used as a prognostic marker in these patients for further future confirming studies.

Introduction

Gastric cancer (GC) is the third one among the most common causes of death from cancer [1]. GC is always diagnosed at an advanced stage with a poor prognosis. It was reported that, GC in Egypt is the 12th most common cancer in Egyptians representing 1.6% of the total cancers [2]. Early diagnosis is thew need of the hour as even after surgical exploration of GC patients, local and distant failures were recorded after 6 months [3].

There are 3 pathways that are involved in most GC oncogenesis: the proliferation/stem cell, NF-kappaβ, and Wnt/beta-catenin pathways. The interplay between these pathways may affect disease prognosis and cancer mortality risk [4].

mRNA is involved in various cancers and is associated with cancer prognosis presenting many mRNA gene signatures associated with the cell cycle or immune signature and can be used in the assessment of the prediction of patient survival [5].

The Pleckstrin homology domain containing S1 (PLEKHS1) gene is located on chromosome 10q25.3, encoding the PLEKHS1 protein whose function is still unknown. PLEKHS1 gene is the second gene after telomerase reverse transcriptase (TERT) gene showing frequent promoter somatic non‑coding mutations which could be involved in various cancers [6].

The arylacetamide deacetylase (AADAC) gene is located on chromosome 3q25.1 [7] encoding 399 amino acids protein which is localized in the endoplasmic reticulum, involved in various drugs hydrolysis, and expressed in the pancreas, adrenal glands, liver, and gastrointestinal tract [8].

Microsomal AADAC competes against the activity of cytosolic arylamine N-acetyltransferase, which act as a catalyst in the arylamine and heterocyclic amine carcinogens biotransformation pathways [9].

The Cyclin-dependent kinase inhibitor 3 (CDKN3) gene is located on chromosome mapping 14q22 encoding CDKN3 protein also called cyclin-dependent kinase (Cdk)-associated phosphatase (KAP) belonging to the family of protein phosphatases and has a dual function in cell cycle regulation through binding to CDK2 kinase, and interaction with CDK1 [10]. Furthermore, CDKN3 was reported to be downregulated or upregulated in various cancers [11, 12].

A bioinformatics analysis study on GC found PLEKHS1 as a protective prognostic gene and AADAC as a risky prognostic gene while CDKN3 was found to be tightly correlated with the pathogenesis of GC [13], so the present study intended to experimentally evaluate these findings.

To the best of our knowledge, no previous studies experimentally evaluated PLEKHS1, AADAC, and CDKN3 genes expressions in GC so the present study aimed to do that through assessment of them by qRT-PCR in tumorous gastric tissue samples at different stages and grades and non-tumorous gastric tissue.

Materials and methods

Samples and studied groups

Gastric tissue samples whether tumorous or adjacent normal gastric tissues away from the tumor were fresh frozen samples just stored in the pathology department repositories at the time of collecting the samples for the present work. Patient names and identity were kept anonymous but pathology and clinical reports were retrieved for the study after getting written permission from the Head of Pathology Department, Faculty of Medicine, Cairo University. Forty (40) tissue samples were obtained from GC patients who underwent surgical resection of the stomach from January 2019 to June 2019 after getting written informed consent. These tissue samples were divided into two groups: 20 gastric adenocarcinoma samples as group 1 and 20 nontumorous samples as a control group or group 2. All patients were diagnosed pathologically according to the criteria of the American Joint Committee on Cancer. Histopathological diagnoses were performed by two professional pathologists independently. All the patients in the present study progressed during treatment. Metastasis were found as 14 samples obtained from patients with bone metastasis, 4 samples obtained from patients with bone and brain metastasis, and 2 samples obtained from patients with bone and liver metastasis. The current work was performed according to the guidelines and the principles of the Helsinki Declaration [14] and approved by research ethic committee, Faculty of Medicine, Cairo University (letter number was N-24-2019). The disease characteristics in GC group were showed in Table 1.

Table 1. The disease characteristics among the gastric carcinoma group.

Parameters Gastric carcinoma group n = 20 (%)
    Tumor size
    <3 cm        n (%) 12 (60)
    ≥3 cm        n (%) 8 (40)
    Lymph nodes
    <3        n (%) 12 (60)
    ≥3        n (%) 8 (40)
    Tumor grades
    G1        n (%) 2 (10)
    G2        n (%) 10 (50)
    G3        n (%) 8 (40)
    Tumor stages
    II        n (%) 12 (60)
    III        n (%) 6 (30)
    IV        n (%) 2 (10)
    Metastasis (organ)
    ≤1        n (%) 14 (70)
    >1        n (%) 6 (30)

n; number of cases, %; frequency.

Reverse transcription–quantitative polymerase Chain reaction (RT-qPCR)

Total RNA was extracted from tissue sections embedded in paraffin using the RNeasy FFPE kit (Cat No. 73504, Qiagen, USA) in compliance with the manufacturer’s protocol. At 260 nm, the extracted RNA had been quantified by spectrophotometry (JENWAY, USA).

Primer sequence

According to the GenBank RNA sequences, PCR primers were designed [15]. Optimal primer pair had been selected with optimal conditions as 60–65°C-melting temperature and 90–200 bp- applicant length. All procedures were performed in triplicate. AADAC, PLEKHS1, and CDKN3 primers were presented as shown in Table 2.

Table 2. PCR primers.

Gene Sequence Gene bank accession number
PLEKHS1 Forward primer. 5’- TGCTCTCACAGAAGCCACAG -3’ NM_182601.1
Reverse primer. 5’- GGACCGGGTAAGAAACAGGG -3’
AADAC Forward primer. 5’- CTAGAGACCAAGAAGCGGGAC -3’ NM_001086.3
Reverse primer. 5’- GTCCCAGGAGCTCCACAAAT -3’
CDKN3 Forward primer. 5’- AGCCGCCCAGTTCAATACAA -3’ NM_005192.4
Reverse primer. 5’- CCTGGAAGAGCACATAAACCG -3’
GAPDH Forward primer 5′- GATGCTGGTGCTGAGTATGTCG -3′ XR: 598347.1
Reverse primer 5′- GTGGTGCAGGATGCATTGCTGA -3′

Real-time quantitative 2-step qRT-PCR using SYBR Green

The current work used software version 3.1 (Applied Biosystems, USA) of Step One plus a real-time PCR system for the analysis of the studied genes. The annealing temperature was set to be optimal as per the PCR protocol and the selected primers.

The housekeeping gene that has been used as a reference gene for gene expression normalization was glyceraldehyde 3-phosphate dehydrogenase (GAPDH). cDNA was generated by using total RNA (5 μg), antisense sequence-specific primer (20 pmol), and AMV reverse transcriptase (0.8 μL), for 1 hr. at 37°C. The present work used the SYBR® Green method (Applied Biosystems, CA, United States) to assess the relative mRNA expressions. The sample of negative control was prepared with no template cDNA used. The optimum experiment requirements for all selected primers were optimized as annealing temperature was 60°C, Mater Mix of SYBR Green reaction volume was 25 μL, cDNA (1X/reaction) was 3 μL and each primer volume was 900 nmol/L used in the real time polymerase reaction. The amplification optimum conditions were organized according to the manufacturer’s instructions as following: Reverse transcription step (50°C for 15 min), initial PCR activation step (95°C for 15 min), denaturation step (95°C for 20 sec) and annealing/extension step (60°C for 40 sec) along 40 cycles.

Calculation of relative gene expression

The common double delta threshold cycle (ΔΔ Ct) method for relative quantification (RQ) was used for the calculation of the expression of the studied genes by using passive reference dye (ROX) for normalization of the fluorescence and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a reference gene. Applied Biosystems Step One plus software was used to calculate the Ct values of the reference gene and the analyzed genes. The Ct values of the target genes and the housekeeping gene (GAPDH) were included in PCR data analysis. No template cDNA used in the negative control sample. All values were normalized to GAPDH and expressed as fold changes relative to its control samples’ background levels.

RQ was calculated according to the following equation: [16].

  • Δ Ct (in GC) sample = Ct studied gene–Ct reference gene

  • Δ Ct (in control sample) = Ct studied gene–Ct reference gene

  • Δ Δ Ct = Δ Ct (in GC) sample–Δ Ct (in control sample)

  • RQ = 2 –(Δ Δ Ct)

Statistical analysis

Data was analyzed using the Windows 10 version 25 Statistical Package of Social Science (SPSS) applications. MedCalc® statistical software was used for production of the Receiving Operating Characteristic (ROC) curve. Easy descriptive analysis was done in the form of numbers and percentages of qualitative data, and arithmetic mean as central tendency measurement and standard deviations as a calculation of the dispersion of quantitative parametric data. Quantitative data used in the analysis were first tested for normality by a one-sample Kolmogorov-Smirnov test in each study group and then selected for inferential statistical tests. For quantitative parametric data: independent t-test samples, used to compare quantitative measurements between two independent classes. For qualitative results, the Chi-square test was used to compare two qualitative groups out of more than two. The P-value< 0.05 was statistically significant. ROC curve was used for prediction of the gastric adenocarcinoma and its metastatic susceptibility using gene expressions of AADAC CDKN3 and PLEKHS1. Sensitivity, and specificity were calculated at the optimal cut off values of the studied genes.

Results

PLEKHS1, AADAC, and CDKN3 gene expression levels in the studied groups

There were high significant (p<0.001) elevations in AADAC gene expression and CDKN3 gene expression in the gastric carcinoma group expressed by (M±SD) [(0.89±0.124), and (0.80±0.09)] compared to the corresponding values in the control group [(0.41±0.04), and (0.43±0.126) respectively] while PLEKHS1 gene expression showed a high significant (p<0.001) decrease in the gastric carcinoma group (1.68±0.31) compared to the corresponding values in the control group (2.70±0.17) as shown in Fig 1.

Fig 1. Comparison of PLEKHS1, AADAC, CDKN3 gene expressions between the studied groups.

Fig 1

High significant elevations in AADAC gene expression and CDKN3 gene expression in the gastric carcinoma group compared to the control group while PLEKHS1 gene expression showed a high significant decrease in the gastric carcinoma group compared to the control group. **: statistically high significant differences (P<0.001) compared to the corresponding values in control group.

Relations between the tumor progression and the studied parameters

AADAC gene expression showed high significant (p<0.001) increases in patients with tumor progression signs (tumor size ≥3 cm, ≥3 lymph nodes, higher grades, and higher stages) and a significant (p<0.05) increase in patients with high metastasis (˃ one organ) while PLEKHS1 and CDKN3 gene expressions showed no significant differences in the same patients compared to those with less tumor progression signs as shown in Table 3.

Table 3. Comparison between the levels of the studied parameters in different disease characteristics among the gastric carcinoma group.

Parameters PLEKHS1 gene expression AADAC gene expression CDKN3 gene expression
Tumor size
<3 cm 1.78±0.33 0.82±0.09 0.8±0.08
≥3 cm 1.54±0.25 1.00±0.04 0.8±0.11
p-value 0.098 <0.001** 0.999
Lymph nodes
<3 1.78±0.33 0.82±0.09 0.8±0.08
≥3 1.54±0.25 1.00±0.04 0.8±0.11
p-value 0.098 <0.001** 0.999
Tumor grades
G1 & G2 1.78±0.33 0.82±0.09 0.8±0.08
G3 1.54±0.25 1.00±0.04 0.8±0.11
p-value 0.098 <0.001** 0.999
Tumor stages
II 1.78±0.33 0.81±0.09 0.8±0.08528
III 1.46±0.24 1.00±0.05! 0.83±0.1
IV 1.77±0 1.01±0! 0.7±0
p-value 0.125 <0.001** 0.212
Metastasis
(organ) 1.75±0.32 0.85±0.12354 0.81±0.08
≤1 1.54±0.29 0.99±0.03 0.77±0.10
>1 0.172 0.013* 0.300
p-value

PLEKHS1; pleckstrin homology domain containing S1, AADAC; arylacetamide deacetylase, CDKN3; cyclin dependent kinase inhibitor 3

**; statistically high significant difference (P<0.001).

*; statistically significant difference (P<0. 05). G; grade of cancer.

Significant correlations in the study

There were highly significant positive correlations between AADAC gene expression and both tumor grades (r = .603, p<0.05) and tumor stages (r = .756, p<0.001) and there was a significant negative correlation between PLEKHS1 gene expression and tumor grades (r = -.462, p<0.05) while CDKN3 gene expressions had no significant correlations with tumor grades and stages. A high significant negative correlation between AADAC, and CDKN3 gene expression (r = -.760, p<0.001) was found.

ROC curve analysis of the studied parameters in the prediction of the presence of gastric adenocarcinoma

ROC curve analysis of the three studied parameters in the prediction of the presence of gastric adenocarcinoma indicated that the optimum cut-off value for PLEKHS1gene expression was ≤2.21 with AUC 0.993, 95% sensitivity and 100% specificity, for AADAC gene expression, a cut-off value of >0.48 with AUC 0.990, 95% sensitivity and 100% specificity, and for CDKN3 gene expression, a cutoff value of >0.65 with AUC 0.990, 100% sensitivity and 95% specificity as shown in Fig 2.

Fig 2. Comparison between PLEKHS1, AADAC, CDKN3 gene expressions in the prediction of the presence of gastric adenocarcinoma.

Fig 2

PLEKHS1, AADAC, CDKN3 gene expressions showed high significant sensitivity and specificity in the prediction of the presence of GC.

Discussion

The World Health Organization estimates that in 2018, GC accounted for 783,000 deaths worldwide [17]. mRNA dysfunction has been shown to be involved in various cancers and has been significantly associated with cancer prognosis [5].

The current study aimed to evaluate PLEKHS1, AADAC and CDKN3 gene expressions in GC because they were included in gene-signature for GC in some bioinformatics analysis studies [13, 1820].

The present study showed a highly significant (p<0.001) decrease in PLEKHS1 gene expression levels in the GC group as compared to the control group. Also, PLEKHS1 gene expression showed high significant sensitivity (95%) and specificity (100%) in the prediction of the presence of GC. Additionally, a significant negative correlation between PLEKHS1 gene expression and tumor grades was found pointing to its probable protective role in GC.

Liu et al. [13] coincided with these results because they reported PLEKHS1as a protective prognostic gene in GC using multiple gene expression profile datasets integrated analysis.

These findings coincided with Chen et al. [18], who reported PLEKHS1 as one of the four genes of the prognostic-protective marker for predicting the overall survival (OS) of GC using univariate, multivariate, and Lasso Cox regression analyses but Zhang et al. [21] showed PLEKHS1 upregulation in the intestinal-type-GC and it was considered as one of a five-gene signature for the disease using The Cancer Genome Atlas (TCGA) database.

Coinciding with the present findings Zhou et al. [22] by using the TCGA database, showed that PLEKHS1 was downregulated in stage I Testicular germ cell tumors (TGCTs) patients, and it was reported as one of the new eight-gene signatures that could be used in the prediction of relapse-free survival (RFS) having a protective role in TGCT relapse.

On the contrary, some bioinformatics analysis studies reported the upregulation of PLEKHS1 in some cancers from these studies; Xiong et al. [23] who reported that PLEKHS1 was one of the top 10 up-regulated genes which were involved in the 5-5-Fluorouracil-based chemoradiation resistance in colorectal cancer (CRC), Yong et al. [24] who showed that PLEKHS1 among the upregulated genes in colon adenocarcinoma (COAD), Zhenfeng et al. [25] who reported that PLEKHS1 as one of the differentially expressed genes (DEGs) which upregulated and associated with poor prognosis in hepatocellular carcinoma (HCC) and Pignot et al. [26] who showed PLEKHS1 upregulation in non‑muscle‑invasive bladder cancer (NMIBC).

These results could be explained by the previous studies reporting that PLEKHS1 proteins could cause noncoding mutations of upstream and promoter elements, which could be involved in tumorigenesis [6]. According to a genome-wide analysis, mutations in non-coding regions of PLEKHS1 were found in 14 types of cancers and are associated with poor prognosis [27].

The present study showed a highly significant (p<0.001) increase in AADAC gene expression levels in the GC group as compared to the control group. AADAC gene expression showed high significant (p<0.001) increases in patients with tumor progression signs (tumor size ≥3 cm, ≥3 lymph nodes, higher grades, and higher stages) and a significant (p<0.05) increase in patients with high metastasis (˃ one organ). There were highly significant positive correlations between AADAC gene expression and both tumor grades and, tumor stages. Also, AADAC gene expression showed high significant sensitivity (95%) and specificity (100%) in the prediction of the presence of GC.

These findings matched with the findings of Wu et al. [19] who reported AADAC upregulation, and it was one of the nine-gene prognostic signature for gastric carcinoma using integrated bioinformatics analyses.

Wu et al. [28] coincided with the present results as they found the AADAC gene to be one of five survival-related genes significantly upregulated and significantly correlated with overall survival (OS) in resectable pancreatic cancer (PC) by using the TCGA database followed by multivariant analysis. They explained their results as the protein coded by AADAC protein is extensively implicated in the hydrolysis of various drugs [9], whose function may be related to chemotherapy resistance in pancreatic cancer.

The present study showed a highly significant (p<0.001) increase in CDKN3 gene expression levels in the GC group as compared to the control group. Also, CDKN3 gene expression showed high significant sensitivity (100%) and specificity (95%) in the prediction of the presence of GC. CDKN3 gene expressions showed no significant correlations with tumor grades and stages.

These results coincided with Li et al. [20] who showed knockdown of CDKN3 in human GC cells, significantly decreased cancer cell proliferation, invasion, migration, and adhesion leading to cell apoptosis while upregulation of CDKN3 in GC was significantly associated with bad prognosis suggesting that CDKN3 could be a novel therapeutic target in GC treatment.

Liu et al. [29] agreed with the current findings as they showed that CDKN3 loss extensively decreased cancer cell proliferation and significantly decreased the invasion and adhesion abilities and CDKN3 loss had been associated with downregulation of CDK1 and CDK2.

Some studies coincided with the current findings but in other gastrointestinal cancers. From these studies, Wang et al. [30] showed that CDKN3 was upregulated in esophageal cancer and considered as a prognostic marker of the disease using bioinformatic analysis which showed the association between CDKN3 and the cell cycle stage transition, DNA replication, and DNA repair system, Further, Yang et al. [31] showed that CDKN3 was upregulated in colorectal cancer.

The mechanism of CDKN3 upregulation could be explained by the hypomethylation of its promoter region [32].

On the contrary, CDKN3 was reported as a tumor suppressor in some cancers [11] as it is a negative regulator of Cyclin-dependent kinases (CDK1 and CDK2) [33] but the exact effect of CDKN3 in cancer cell proliferation, either enhancing or precluding, it cannot be explained by its CDK regulation, alone.

In the present study, a high significant negative correlation between AADAC, and CDKN3 gene expression was found. This relation may be found as AADAC acts as an oncogene while CDKN3 acts as a tumor suppressor gene, whatever this finding needs more further future studies.

Conclusion

In conclusion, AADAC and CDKN3 genes were significantly upregulated in gastric adenocarcinoma. On the other hand, PLEKHS1 was significantly downregulated in gastric adenocarcinoma and showed an inverse correlation with tumor grade suggesting its protective role in GC. Finally, AADAC, CDKN3, and PLEKHS1 could be used as diagnostic and predictive biomarkers of GC, and AADAC could be used as a prognostic marker in these patients. These genes are suggested to be used as novel therapeutic targets in GC for further future confirming studies on larger samples.

Supporting information

S1 Data

(SAV)

Acknowledgments

The current study was supported by Head of Pathology Department Faculty of Medicine Cairo University who provided great facilitation during collection of archival gastric tissue samples. We express our appreciation of the cooperation of Prof. Dr. Soliman Saba, Head of Pathology Department.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This research did not receive any specific grant from any funding agency in the public.

References

  • 1.Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal AJCacjfc. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. 2018;68(6):394–424. [DOI] [PubMed] [Google Scholar]
  • 2.Hashem TAA, El-Fotouh MA, Ehab A, El Rebey HS, Satar MA, Attallah HSJMMJ. Her-2 neu status in gastric carcinoma in Egyptian patients: The epidemiology and the response to chemotherapy. 2016;29(2):449. [Google Scholar]
  • 3.Gunderson LL, Sosin HJIJoROBP. Adenocarcinoma of the stomach: areas of failure in a re-operation series (second or symptomatic look) clinicopathologic correlation and implications for adjuvant therapy. 1982;8(1):1–11. [DOI] [PubMed] [Google Scholar]
  • 4.Ooi CH, Ivanova T, Wu J, Lee M, Tan IB, Tao J, et al. Oncogenic pathway combinations predict clinical prognosis in gastric cancer. 2009;5(10):e1000676. doi: 10.1371/journal.pgen.1000676 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhao L, Jiang L, He L, Wei Q, Bi J, Wang Y, et al. Identification of a novel cell cycle‐related gene signature predicting survival in patients with gastric cancer. 2019;234(5):6350–60. doi: 10.1002/jcp.27365 [DOI] [PubMed] [Google Scholar]
  • 6.Weinhold N, Jacobsen A, Schultz N, Sander C, Lee WJNg. Genome-wide analysis of noncoding regulatory mutations in cancer. 2014;46(11):1160–5. doi: 10.1038/ng.3101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Yamazaki K, Kusano K, Tadano K, Tanaka IJG. Radiation hybrid mapping of human arylacetamide deacetylase (AADAC) locus to chromosome 3. 1997;44(2):248–50. doi: 10.1006/geno.1997.4879 [DOI] [PubMed] [Google Scholar]
  • 8.Kobayashi Y, Fukami T, Nakajima A, Watanabe A, Nakajima M, Yokoi TJDM, et al. Species differences in tissue distribution and enzyme activities of arylacetamide deacetylase in human, rat, and mouse. 2012;40(4):671–9. doi: 10.1124/dmd.111.043067 [DOI] [PubMed] [Google Scholar]
  • 9.Probst MR, Beer M, Beer D, Jenö P, Meyer UA, Gasser RJJoBC. Human liver arylacetamide deacetylase. Molecular cloning of a novel esterase involved in the metabolic activation of arylamine carcinogens with high sequence similarity to hormone-sensitive lipase. 1994;269(34):21650–6. [PubMed] [Google Scholar]
  • 10.Johnson LN, De Moliner E, Brown NR, Song H, Barford D, Endicott JA, et al. Structural studies with inhibitors of the cell cycle regulatory kinase cyclin-dependent protein kinase 2. 2002;93(2–3):113–24. doi: 10.1016/s0163-7258(02)00181-x [DOI] [PubMed] [Google Scholar]
  • 11.Nalepa G, Barnholtz-Sloan J, Enzor R, Dey D, He Y, Gehlhausen JR, et al. The tumor suppressor CDKN3 controls mitosis. 2013;201(7):997–1012. doi: 10.1083/jcb.201205125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lai M-W, Chen T-C, Pang S-T, Yeh C-T, editors. Overexpression of cyclin-dependent kinase-associated protein phosphatase enhances cell proliferation in renal cancer cells. Urologic Oncology: Seminars and Original Investigations; 2012: Elsevier. [DOI] [PubMed] [Google Scholar]
  • 13.Liu X, Wu J, Zhang D, Bing Z, Tian J, Ni M, et al. Identification of potential key genes associated with the pathogenesis and prognosis of gastric cancer based on integrated bioinformatics analysis. 2018;9:265. doi: 10.3389/fgene.2018.00265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Shrestha B, Dunn LJJoNHRC. The declaration of helsinki on medical research involving human subjects: A review of seventh revision. 2019;17(4):548–52. doi: 10.11124/JBISRIR-2017-003901 [DOI] [PubMed] [Google Scholar]
  • 15.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TLJBb. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. 2012;13(1):1–11. doi: 10.1186/1471-2105-13-134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Livak KJ, Schmittgen TDJm. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. 2001;25(4):402–8. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 17.Ferlay J, Ervik M, Lam F, Colombet M, Mery L, Piñeros M, et al. Global cancer observatory: cancer today. Lyon: International Agency for Research on Cancer; 2018. 2020. [Google Scholar]
  • 18.Chen J, Wang A, Ji J, Zhou K, Bu Z, Lyu G, et al. An innovative prognostic model based on four genes in Asian patient with gastric Cancer. 2021;53(1):148. doi: 10.4143/crt.2020.424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wu K-Z, Xu X-H, Zhan C-P, Li J, J-LJWJoGO. Identification of a nine-gene prognostic signature for gastric carcinoma using integrated bioinformatics analyses. 2020;12(9):975. doi: 10.4251/wjgo.v12.i9.975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Li Y, Ji S, Fu L-Y, Jiang T, Wu D, Meng F-DJOr. Knockdown of cyclin-dependent kinase inhibitor 3 inhibits proliferation and invasion in human gastric cancer cells. 2017;25(5):721. doi: 10.3727/096504016X14772375848616 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Zhang Y, Wu X, Zhang C, Wang J, Fei G, Di X, et al. Dissecting expression profiles of gastric precancerous lesions and early gastric cancer to explore crucial molecules in intestinal‐type gastric cancer tumorigenesis. 2020;251(2):135–46. doi: 10.1002/path.5434 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhou J-G, Yang J, Jin S-H, Xiao S, Shi L, Zhang T-Y, et al. Development and Validation of a Gene Signature for Prediction of Relapse in Stage I Testicular Germ Cell Tumors. 2020;10:1147. doi: 10.3389/fonc.2020.01147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Xiong W, Jiang Y-X, Ai Y-Q, Liu S, Wu X-R, Cui J-G, et al. Microarray analysis of long non-coding RNA expression profile associated with 5-fluorouracil-based chemoradiation resistance in colorectal cancer cells. 2015;16(8):3395–402. doi: 10.7314/apjcp.2015.16.8.3395 [DOI] [PubMed] [Google Scholar]
  • 24.Liu Y, Li C, Dong L, Chen X, Fan RJBR. Identification and verification of three key genes associated with survival and prognosis of COAD patients via integrated bioinformatics analysis. 2020;40(9):BSR20200141. doi: 10.1042/BSR20200141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Deng Z, Wang J, Xu B, Jin Z, Wu G, Zeng J, et al. Mining TCGA database for tumor microenvironment-related genes of prognostic value in hepatocellular carcinoma. 2019;2019. doi: 10.1155/2019/2408348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Pignot G, Le Goux C, Vacher S, Schnitzler A, Radvanyi F, Allory Y, et al. PLEKHS1: A new molecular marker predicting risk of progression of non‑muscle‑invasive bladder cancer. 2019;18(4):3471–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Fredriksson NJ, Ny L, Nilsson JA, Larsson EJNg. Systematic analysis of noncoding somatic mutations and gene expression alterations across 14 tumor types. 2014;46(12):1258–63. doi: 10.1038/ng.3141 [DOI] [PubMed] [Google Scholar]
  • 28.Wu C, Wu Z, Tian BJBs. Five gene signatures were identified in the prediction of overall survival in resectable pancreatic cancer. 2020;20(1):1–10. doi: 10.1186/s12893-020-00856-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liu L-M, Huang Q, Chen Q-N, Liu Z-Y, Ge B-JJIJOC, MEDICINE E. A critical role of CDKN3 in gastric cancer and regulates tumor cell proliferation. 2016;9(1):172–8. [Google Scholar]
  • 30.Wang J, Che W, Wang W, Su G, Zhen T, Jiang ZJCm, et al. CDKN3 promotes tumor progression and confers cisplatin resistance via RAD51 in esophageal cancer. 2019;11:3253. doi: 10.2147/CMAR.S193793 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yang C, Sun J-JJAPJoCP. Mechanistic studies of cyclin-dependent kinase inhibitor 3 (CDKN3) in colorectal cancer. 2015;16(3):965–70. doi: 10.7314/apjcp.2015.16.3.965 [DOI] [PubMed] [Google Scholar]
  • 32.Niculescu MD, Yamamuro Y, Zeisel SHJJon. Choline availability modulates human neuroblastoma cell proliferation and alters the methylation of the promoter region of the cyclin‐dependent kinase inhibitor 3 gene. 2004;89(5):1252–9. doi: 10.1111/j.1471-4159.2004.02414.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hannon GJ, Casso D, Beach DJPotNAoS. KAP: a dual specificity phosphatase that interacts with cyclin-dependent kinases. 1994;91(5):1731–5. doi: 10.1073/pnas.91.5.1731 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Wen-Wei Sung

16 Nov 2021

PONE-D-21-19753Evaluation of Gene expression of PLEKHS1, AADAC, and CDKN3 as novel genomic markers in  Gastric Carcinoma in Egyptian PatientsPLOS ONE

Dear Dr. Marwa Sayed Abdel-Tawab,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Dec 31, 2021. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Wen-Wei Sung, M.D., Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Partly

Reviewer #4: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Abdel-Tawab et al demonstrated in this manuscript that PLEKHS1, AADAC and CDKN3 can act as markers for gastric carcinoma based on clinical samples from Egyptian patients. While the authors did show the correlation of gastric carcinoma with mRNA expression of indicated genes, that is the sole result in this study, and there are many questions regarding PLEKHS1, AADAC, and CDKN3 in gastric carcinoma to be answered.

1. The rationales for choosing PLEKHS1, AADAC and CDKN3 as targets are missing in introduction or discussion.

2. By emphasizing Egyptian patients in the study, are there any difference for the expression profile of PLEKHS1, AADAC and CDKN3 between Egyptian patients and patient from other area?

3. The association between PLEKHS1, AADAC, and CDKN3 are missing. Moreover, the molecular mechanism for the impacts of PLEKHS1, AADAC, and CDKN3 in tumor is not showed.

Reviewer #2: In my opinion, the authors performed a well-constructed study to test their research questions. The statistical analysis seemed to me to be adequate and well carried out. In the discussion, the authors made a careful analysis of their results and compared them with other works already published.

Reviewer #3: Comments:

In the present report the authors have tried to experimentally validate PLEKHS1, AADAC, and CDKN3 genes expressions in gastric cancer. A previous study by Liu X et al 2018 using integrated analysis of multiple gene expression profile datasets had narrowed down to a list comprising of the above said markers. The authors have a valid aim in further validating the markers in an independent set of samples. The methodology and the statistical analysis adopted for the study is appropriate. However, their validation process has several deficiencies due to which in the present form cannot be recommended for publication. The following are the major short comings.

1. The authors need to provide a clear definition of their sample set like inclusion and exclusion criteria. For instance, they need to provide information on the source of their normal samples. Paired normal (Sourced from adjacent normal tissues away from the tumor) or normal gastric tissue. It would be ideal if they could compare with both kinds of normal tissue. Histological subtype of the samples assessed. The overall distribution of samples across the various stages is highly limited. For instance, only 2 samples are used in stage IV. In table 1 it is not clear what the authors mean the by the term “Outcome”. The row on Metastasis needs to describe which organ. Visceral organ metastasis is considered stage IV disease.

2. The tissue source is from archival FFPE sections, though routinely used for analysis there are some drawbacks regarding the quality of RNA sourced from this source. Preferably including fresh frozen samples in the study will help in overcome questions regarding the quality of the assays performed.

3. Additional protein expression studies using Immunohistochemistry and archival FFPE sections for the markers will considerably increase the impact of the findings by increasing the sample numbers.

4. In the results section the authors mention fold change values “[(0.89±0.124), and (0.80±0.09)] compared to the corresponding values in the control group [(0.41±0.04), and (0.43±0.126) respectively] “ what the common calibrator was used to determine the fold changes in tumor and control groups?

5. It is not clear why the authors mention “Demographic Data in the studied groups:” considering the fact that the control samples were sourced from the same gastric tumor tissue (paired normal) else the authors need to specifically mention this.

6. While mentioning data on “Relations between the tumor progression and the studied parameters” it is necessary to give back ground information on how many of the patients progressed during treatment and how many did not do so.

7. Overall, considering that the present study is a validation analysis a larger sample set is required to assess the markers along with clinicopathological features such as H. Pylori status, subtypes of gastric cancer.

Reviewer #4: This study suggests that PLAKHS1, AADAC and CDKN3 genes can be used as biomarkers and prognostic marker (in the caso of AADAC gene) of gastric cancer. This topic is of great clinical relevance. However, the manuscript should be improved before publication. Initially, English should be revised and the tittle "Figure Ligands" must be corrected to "Figure legends". These, should also be improved and include more descriptive data on the figures to which they refer. The style of the References must be corrected and adapted to the standard recommended by the Journal.

With respect to the Subjects and Methods section, the number of specimens analyzed in some groups is low (e.g. n=2 for G1 tumor grade and tumor stage IV), unfortunately; only 1 housekeeping gene was used (ideally authors should work with 2 housekeeping genes) and another technique that allows the assessment of proteins that are encoded by the analyzed genes (such as IHC) should be added in order to strengthen the results.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Reviewer #4: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Apr 21;17(4):e0265184. doi: 10.1371/journal.pone.0265184.r002

Author response to Decision Letter 0


11 Dec 2021

Reviewer #1

1. The rationales for choosing PLEKHS1, AADAC and CDKN3 as targets are missing in introduction or discussion.

Response:

The rationales for choosing PLEKHS1, AADAC and CDKN3 as targets are included in the following paragraph in the introduction “A bioinformatics analysis study on GC found PLEKHS1 as a protective prognostic gene and AADAC as a risky prognostic gene while CDKN3 was found to be tightly correlated with the pathogenesis of GC [13], so the present study intended to experimentally evaluate these findings.”

2. By emphasizing Egyptian patients in the study, are there any difference for the expression profile of PLEKHS1, AADAC and CDKN3 between Egyptian patients and patient from other area?

Response:

We do not know if there are any difference for the expression profile of PLEKHS1, AADAC and CDKN3 between Egyptian patients and patient from other area so, we delete these words “in Egyptian patients “from the title.

3. The association between PLEKHS1, AADAC, and CDKN3 are missing. Moreover, the molecular mechanism for the impacts of PLEKHS1, AADAC, and CDKN3 in tumor is not showed.

Response:

A high significant negative correlation between AADAC, and CDKN3 gene expression (r= -.760, p<0.001) was found. This paragraph was added to the abstract, results, and discussion. The molecular mechanism for the impacts of PLEKHS1, AADAC, and CDKN3 in tumor needs more evaluating further future studies as we mentioned at the end of the abstract and conclusion.

Reviewer #3

1. The authors need to provide a clear definition of their sample set like inclusion and exclusion criteria. For instance, they need to provide information on the source of their normal samples. Paired normal (Sourced from adjacent normal tissues away from the tumor) or normal gastric tissue. It would be ideal if they could compare with both kinds of normal tissue. Histological subtype of the samples assessed. The overall distribution of samples across the various stages is highly limited. For instance, only 2 samples are used in stage IV. In table 1 it is not clear what the authors mean the by the term “Outcome”. The row on Metastasis needs to describe which organ. Visceral organ metastasis is considered stage IV disease.

Response:

We mentioned that the source of the normal samples were adjacent normal tissues away from the tumor.

We mean by outcome in table 1; tissues have tumor (positive) or not (negative) and we delete this item from the table as if it could not be understood.

only 2 samples are used in stage IV because we were eager to have fresh frozen samples but at this time, only 2 samples in stage IV were available.

Metastasis were found as 14 samples obtained from patients with bone metastasis, 4 samples obtained from patients with bone and brain metastasis, and 2 samples obtained from patients with bone and liver metastasis

2. The tissue source is from archival FFPE sections, though routinely used for analysis there are some drawbacks regarding the quality of RNA sourced from this source. Preferably including fresh frozen samples in the study will help in overcome questions regarding the quality of the assays performed.

Response:

The samples already were fresh frozen samples just stored in the pathology department repositories at the time of collecting the samples for the present work.

3. Additional protein expression studies using Immunohistochemistry and archival FFPE sections for the markers will considerably increase the impact of the findings by increasing the sample numbers.

Response: These additional protein expression studies need more cost, and we have no any funding source except our own work, so we add that our findings need more evaluating further future studies to overcome all limitations in our study.

4. In the results section the authors mention fold change values “[(0.89±0.124), and (0.80±0.09)] compared to the corresponding values in the control group [(0.41±0.04), and (0.43±0.126) respectively] “what the common calibrator was used to determine the fold changes in tumor and control groups?

Response: The common calibrator was used to determine the fold changes in tumor and control groups expressed by (M±SD), these words are added to the result section.

5. It is not clear why the authors mention “Demographic Data in the studied groups:” considering the fact that the control samples were sourced from the same gastric tumor tissue (paired normal) else the authors need to specifically mention this.

Response: We mean demographic data in the studied subjects not groups. We delete this paragraph to avoid misunderstanding from readers.

6. While mentioning data on “Relations between the tumor progression and the studied parameters” it is necessary to give background information on how many of the patients progressed during treatment and how many did not do so.

Response: All the patients in our study progressed during treatment. We add these words to the subject and methods section.

7. Overall, considering that the present study is a validation analysis a larger sample set is required to assess the markers along with clinicopathological features such as H. Pylori status, subtypes of gastric cancer.

Response:

You are right! this is a one of our study limitations, but these additional data were not available for all patients, so we could not do this assessment.

Reviewer #4

1. Initially, English should be revised, and the tittle "Figure Ligands" must be corrected to "Figure legends".

Response: It is done

2. These should also be improved and include more descriptive data on the figures to which they refer.

Response: It is done

3. The style of the References must be corrected and adapted to the standard recommended by the Journal.

Response: It is done

4. With respect to the Subjects and Methods section, the number of specimens analyzed in some groups is low (e.g., n=2 for G1 tumor grade and tumor stage IV)

Response:

only 2 samples are used in stage IV or in grade 1 because we were eager to have fresh frozen samples but during the period of our samples collection, only theses samples were available.

5. Unfortunately, only 1 housekeeping gene was used (ideally authors should work with 2 housekeeping genes) and another technique that allows the assessment of proteins that are encoded by the analyzed genes (such as IHC) should be added in order to strengthen the results.

Response:

These additional protein expression studies need more cost, and we have no any funding source except our own work, so we add that our findings need more evaluating further future studies to overcome all limitations in our study.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Wen-Wei Sung

30 Dec 2021

PONE-D-21-19753R1Evaluation of Gene expression of PLEKHS1, AADAC, and CDKN3 as novel genomic markers in  Gastric CarcinomaPLOS ONE

Dear Dr. Marwa Sayed Abdel-Tawab,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

There are still major concerns need further revision according to the reports from reviewer 4. Please try to revise the manuscript with more supportive results.

Please submit your revised manuscript by Feb 15, 2022. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Wen-Wei Sung, M.D., Ph.D.

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: All comments have been addressed

Reviewer #4: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #3: Yes

Reviewer #4: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #3: No

Reviewer #4: No

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #3: The authors have addressed the queries raised by the reviewer. The study size is small however considering that additional samples will be required a fact that has been acknowledged in the authors response the manuscript can be accepted.

Minor points

Correction for English language usage may be necessary to improve the readability of the paper.

Reviewer #4: Although the authors made modification to the original text, not all the suggested corrections ans questions were properly performed or answered.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: No

Reviewer #4: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Apr 21;17(4):e0265184. doi: 10.1371/journal.pone.0265184.r004

Author response to Decision Letter 1


31 Dec 2021

Response to reviewers

Reviewer #4

1. Initially, English should be revised, and the tittle "Figure Ligands" must be corrected to "Figure legends".

Response: It is done

2. These should also be improved and include more descriptive data on the figures to which they refer.

Response: It is done

3. The style of the References must be corrected and adapted to the standard recommended by the Journal.

Response: It is done

4. With respect to the Subjects and Methods section, the number of specimens analyzed in some groups is low (e.g., n=2 for G1 tumor grade and tumor stage IV)

Response:

GC has low incidence and prevalence in Egyptians representing 1.6% of the total cancers [1], so we could not find more fresh frozen samples during the period of our samples collection. We were eager to work as rapid as possible to ensure the stability of RNA in the collected samples only 2 samples were used in stage IV or in grade 1 because, only theses samples were available in the fresh frozen samples during the period of our samples collection.

5. Unfortunately, only 1 housekeeping gene was used (ideally authors should work with 2 housekeeping genes) and another technique that allows the assessment of proteins that are encoded by the analyzed genes (such as IHC) should be added in order to strengthen the results.

Response:

Using of one housekeeping gene is the routine method at our molecular biology unit of Kasr Alaini Medicine College in Egypt. This method is accepted in many published articles introduced by researchers to international journals and PLoS One journal [2].

These additional protein expression studies need more cost, and we have no any funding source except our own work, so our study evaluates the gene expression ant it is obvious in the title of the article mentioning that that our findings need more confirming further future studies to overcome all limitations in our study. It is very difficult to do additional work on the same samples.

References

1.Abdelwahab Hashem TA, El-Fotouh MA, Ehab A, El Rebey HS, Satar MA, Attallah HS. Her-2 neu status in gastric carcinoma in Egyptian patients: The epidemiology and the response to chemotherapy. Menoufia Med J 2016; 29: 449-53.

2. Shan L, Lian F, Guo L, Qiu T, Ling Y, Ying J, Lin D. Detection of ROS1 gene rearrangement in lung adenocarcinoma: comparison of IHC, FISH and real-time RT-PCR. PLoS One. 2015 Mar 5;10(3):e0120422. doi: 10.1371/journal.pone.0120422. PMID: 25742289; PMCID: PMC4351102.

Attachment

Submitted filename: Response to reviewer 4.docx

Decision Letter 2

Wen-Wei Sung

17 Jan 2022

PONE-D-21-19753R2Evaluation of Gene expression of PLEKHS1, AADAC, and CDKN3 as novel genomic markers in  Gastric CarcinomaPLOS ONE

Dear Dr. Marwa Sayed Abdel-Tawab,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

The reviewers have major concerns include, but not limited, the references. Please revise the manuscript carefully.

Please submit your revised manuscript by Feb 28, 2022. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Wen-Wei Sung, M.D., Ph.D.

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: All comments have been addressed

Reviewer #4: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #3: Yes

Reviewer #4: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #3: Yes

Reviewer #4: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #3: (No Response)

Reviewer #4: Unfortunatelly, the References' section remains wrong, with several mistakes, which demonstrates the authors' regrettable lack of attention.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: No

Reviewer #4: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Apr 21;17(4):e0265184. doi: 10.1371/journal.pone.0265184.r006

Author response to Decision Letter 2


20 Jan 2022

Reviewer #4

1. The style of the References must be corrected and adapted to the standard recommended by the Journal.

Response: I reformatted, revised all references through EndNote X9 and corrected all mistakes in the references.

Attachment

Submitted filename: Response to reviewer 4.docx

Decision Letter 3

Wen-Wei Sung

28 Feb 2022

Evaluation of Gene expression of PLEKHS1, AADAC, and CDKN3 as novel genomic markers in  Gastric Carcinoma

PONE-D-21-19753R3

Dear Dr. Marwa Sayed Abdel-Tawab,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Wen-Wei Sung, M.D., Ph.D.

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #4: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #4: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #4: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #4: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #4: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #4: No

Acceptance letter

Wen-Wei Sung

2 Apr 2022

PONE-D-21-19753R3

Evaluation of Gene expression of PLEKHS1, AADAC, and CDKN3 as novel genomic markers in Gastric Carcinoma

Dear Dr. Abdel-Tawab:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Wen-Wei Sung

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Data

    (SAV)

    Attachment

    Submitted filename: Response to Reviewers.docx

    Attachment

    Submitted filename: Response to reviewer 4.docx

    Attachment

    Submitted filename: Response to reviewer 4.docx

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES