Table 1.

Assays used for detection of Merkel cell polyomavirus in skin cancer.

First Author Year, Country	Sample Type	MCPyV Detection Assay/Target	Results	Novelty
Ungari M et al., 2021, Italy [28]	15 cases of MCC FFPE sampes	Immunohistochemical profile	CK20 (14/14), Neurofilament, (12/12), Synaptophysin (14/14); Chromogranin A (11/13), PAX5 (10/12), TDT (5/12), CK7 (1/14), TTF1(0/14)	The staining pattern of Neu-N could be used to optimize MCC diagnosis.
Prezioso C et al., 2021, Italy [22]	FFPE of skin and lymph nodes with histological diagnosis of MCC	Real-time polymerase chain reaction (qPCR) primer and probe, targeting sT gene MCPyV Nested PCR different MCPyV-specific primer pairs mapping VP1 and NCCR regions of the genome	MCPyV DNA was detected in 13/26 samples (50%), only in the primary lesions.	Data supports the “hit-and-run” hypothesis and may lead to speculation regarding MCPyV being necessary only in the initial steps of MCC oncogenesis, while further mutations drive the tumor independent from the virus.
Costa PVA et al., 2021, Brazil [23]	120 patients with histopathological exams of different cutaneous neoplasms	Two different techniques of PCR: conventional oligonucleotides complementary to the large T-antigen (LTAg) gene real-time PCR for detection of PyV DNA. oligonucleotides complementary to the region called the large T-antigen of each of the PyVs JCPyV, BKPyV, WUPyV, KIPyV, MCPyV, TSPyV, HPyV6, HPyV7, HPyV9, HPyV10, HPyV12, and STLPyV.	PyV DNA was found in 25.69% of the samples: 15% in basal cell carcinoma group, 1 5% in squamous cell carcinoma, 28.57% in melanoma, 1 5% in dermatofibrosarcoma protuberans, 13.33% in Kaposi’s sarcoma, 65% in Merkel cell carcinoma (MCC), and none in normal skin.	This study highlighted the presence of PyVs in different skin tumours.
Toptan T et al., 2020, Pittsburg, USA [31]	FFPE MCC	Differential peptide subtraction (DPS) Differential mass spectrometry (dMS) Targeted analysis SMART sequence (5′-AAGCAGTGGTATCAACGCAGAGTAC-3′) added to the 5′ end of each dMS-identified MCPyV-	DPS identified both viral and human biomarkers (MCPyV large T antigen, CDKN2AIP, SERPINB5, and TRIM29) that discriminate between MCPyV+ and MCPyV- MCC.	Potentially novel viral sequences can be identified in infectious tumors by DPS, a robust proteomic approach that can be employed when nucleic acid-based techniques are not feasible.
Starrett GJ et al. 2020, Bethesda, MD USA [30]	71 MCC patients FFPE sections	Deep sequencing with OncoPanel, a clinically implemented, next-generation sequencing assay targeting over 400 cancer-associated genes Illumina libraries using a KAPA HTP library kit	Recurrent somatic alterations common across MCC and alterations specific to each class of tumor, were associated with differences in overall survival.	High-confidence virus detection is valuable for identifying the molecular mechanisms of UV and viral oncogenesis in MCC.
Boyer M et al., 2020, France [29]	Blood samples of patients with MCC at different stages	Detection of circulating tumors cells (CTCs) using the CellSearch System and the RosetteSep-DEPArray workflow Antibodies against surface membrane markers (EpCAM, synaptophysin, CD24, CD44, CD56 and CD45)	CellSearch detected MCC CTCs in 26% of patients, and the R-D workflow in 42% of patients.	MCPyV DNA involved in MCC oncogenesis was detected in tumor biopsies, but not in all CTCs, suggesting that tumoral cells are heterogenous.
Motavalli Khiavi F et al., 2020, Tehran, Iran [24]	FFPE sections MCC patients 60 patients with BCC and 20 patients with SCC	Quantitative real-time PCR sequencing for mutational analysis of the MCPyV LT gene primers/TaqMan probe to amplify a segment of MCPyV large T antigen	MCPyV DNA was detected in 6 (10%) of 60 BCC (basal cell carcinoma) samples, and no viral genome was found in SCCs (squamous cell carcinoma). The median number of viral DNA copies per cell was 0.7 in 6 MCPyV-positive BCC samples.	No tumor-associated mutations were found in the LT-Ag sequence of MCPyVs from positive samples. MCPyV-positive MCC samples showed no tumor-associated mutations in the LT-Ag sequence.
Neto CF et al., 2019, Brazil [25]	MCC tumoral skin FFPE specimens non-MCC skin FFPE cancers were also analyzed.	Polymerase chain reaction (PCR) (conventional and real-time) for detection of MCPyV DNA gene region of polyoma LT MCPy primer sequences LT.1F 5′-CCACAGCCAGAGCTCTTCCT-3′ LT.1R 5′-TGGTGGTCTCCTCTCTGCTACTG-3′	All MCC samples available (13) tested positive for the presence of MCPyV DNA. MCPyV DNA detection rate was higher in patients with MCC than in the other group, and its analysis was statistically significant (p < 0.01).	In this Brazilian cohort of patients, an association between MCPyV and MCC was proven.
Kervarrec T et al., 2018, France [26]	12 conventional MCCs and 12 cutaneous squamous cell carcinomas as controls	MCPyV viral status was obtained by combining two independent molecular procedures. 2 nested pairs of primers (LT1n, forward 5′-GGCATGCCTGTGAATTAGGA-3′ and reverse 5′-TGTAAGGGGGCTTGCATAAA-3′; and VP1n, forward 5′-TGCAAATCCAGAGGTTCTCC-3′ and reverse 5′-GCAGATGTGGGAGGCAATA-3′)	Half of the combined MCC cases were positive for MCPyV in the neuroendocrine component.	The viral positivity in half of the combined MCC cases is indicative of similar carcinogenesis routes for combined and conventional MCC.
Álvarez-Argüelles ME et al., 2017, Spain [27]	34 FFPE MCC samples) and six non-MCC samples	MCPyV was quantified using quantitative real-time PCR (qRT-PCR) targeted the VP1 gene from EU375803 genbank sequence of MCPyV	In 31 (91.2%) MCC-individuals, MCPyV was detected. No virus was observed in any of the non-MCC tumors.	MCPyV was very frequent in MCC. The amplification techniques described here are suitable for detecting the presence of MCPyV virus in MCC and are easy to apply.
Wang L et al., 2017, USA [32]	87 MCCs from 75 patients	RNAscope probe targeting MCPyV T antigen transcripts on tissue microarrays (TMA) and whole-tissue sections Hs-V-MCPyV-LT-ST-Ag	RNA in situ hybridization (RNA-ISH) demonstrated the presence of MCPyV in 37 of 75 cases (49.3%).	RNA-ISH has a sensitivity comparable to qPCR for detecting the MCPyV and allows for correlation with tissue morphology.
Arvia R et al, 2017, Italy [33]	76 FFPE cutaneous biopsies	Two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples Primer Sequence (5′–3′) Primer Forward CCCTTTGGAGCAAATTCCA Primer Reverse CTGACCTCATCAAACATAGAGAA Probe CAAAATATCCACAAGCTCAGAAGTGA	The number of positive samples obtained by droplet digital PCR (ddPCR) was higher than that obtained by qPCR (45% and 37%, respectively).	The ddPCR represents a better MCPyV detection method in FFPE biopsies, especially those containing low numbers of copies of the viral genome.
Paulson KG 2017, Seattle WA [21]	219 patients with newly diagnosed MCC were followed prospectively (median follow-up, 1.9 years).	MCPyV-oncoprotein antibody detection Glutathione-S-transferase(GST)-tagged MCPyV small T-antigen	Antibodies to MCPyV oncoproteins were rare among healthy individuals (1%), but were present in most patients with MCC [52%]; p < 0.01).	The clinical management of newly diagnosed MCC patients can be optimized by determining the oncoprotein antibody titer. Thus, the patients can better be stratified into a higher risk seronegative cohort, in which radiological imaging techniques may play a more prominent role, and into a lower risk seropositive cohort, in which the oncoprotein antibody titer can be used to track the disease status.