Abstract
Dental plaque bacteria are one of the main factors responsible for the development of a periodontal disease, which is the most common infectious disease in dogs. The aim of this study was to identify the presence of periodontal disease-related bacteria in the dental plaque of dogs. Plaque samples were taken from dogs with and without periodontal disease. Samples were analyzed for the presence of Porphyromonas gulae, Tannerella forsythia and Treponema denticola using a PCR technique amplifying 16S rRNA genes of P. gulae and T. forsythia and flaB2 genes of Treponema species, including T. denticola. The presence of T. forsythia was confirmed in all samples. P. gulae was detected in all dogs with periodontal disease and in 71.43% of dogs without periodontal disease. Treponema spp. were detected in 64.29% of the samples. Based on Sanger sequencing and Basic Local Alignment Search Tool algorithm, Treponema spp. were identified as T. denticola and Treponema putidum. T. denticola was present in 28.57% of dogs with periodontal disease, while T. putidum was present in 42.86% of dogs with periodontal disease and in 57.14% of dogs without periodontal disease. T. putidum was positively correlated with both P. gulae and T. forsythia, suggesting that it may be involved in the development of periodontal disease.
Keywords: dog, periodontal disease, Porphyromonas gulae, Tannerella forsythia, Treponema denticola, Treponema putidum, PCR
1. Introduction
In veterinary medicine, periodontal diseases are the most common diseases of domestic carnivores and occur in approximately 80% of dogs older than 2 years [1,2]. The incidence of the disease increases significantly with age and weight of the animals. Epidemiological studies indicate higher occurrence in small breeds [3,4]. Based on the clinical signs, periodontal diseases are usually divided into two groups, gingivitis and periodontitis. The most common clinical signs of periodontal disease include halitosis, ptyalism, altered gingival color, gingival bleeding, tooth mobility, anorexia and behavioral changes. Periodontal diseases are the result of the accumulation of dental bacterial plaque on the surface of the teeth, which is exacerbated by the accumulation of mineralized dental calculus [5,6].
Periodontitis is a dysbiotic disease rather than an infection caused by only a few selected species of microorganisms. Dysbiosis of the periodontal microbiota represents a change in the relative number of individual components of the bacterial community, namely, the shift of subgingival Gram-positive bacteria to Gram-negative bacteria [7,8]. Porphyromonas gingivalis, Treponema denticola and Tannerella forsythia (formerly Bacteroides forsythus) are considered to be the most important pathogens in periodontal disease in humans [9]. Porphyromonas gulae, previously known as the animal biotype of the human periodontal pathogen P. gingivalis, has virulence properties that are associated with P. gingivalis and may play a key role in the pathology of periodontitis in companion animals [10]. Several different species of Treponema are found in the oral cavity of healthy dogs, which suggests that they are a part of normal microbiota [11]. However, T. denticola is most commonly associated with periodontal disease [12,13]. The meaning of Treponema spp. in the etiology of periodontal disease is still not entirely clear and requires further investigation [11]. The presence of T. forsythia in human dental plaque is associated with an increased risk of periodontitis [14], while in dogs, studies show conflicting results in the presence of T. forsythia in dental plaque [15,16]. The aim of present study was to determine the presence of P. gulae, T. denticola and T. forsythia in supragingival dental plaque samples of dogs with and without periodontal disease by PCR (Figure 1).
Figure 1.
Flowchart of sample processing.
2. Results
2.1. Study Population
Nine female and five male dogs of different breeds aged between 1–14 years were sampled. Based on the clinical signs, such as the amount of plaque, presence of dental calculus, inflammation of the gums or tooth loss, they were divided into two groups—healthy and periodontal disease (Table 1).
Table 1.
General information and periodontal status of the sampling dogs.
Dog | Breed | Age (Years) | Sex | Periodontal Status |
---|---|---|---|---|
1 | Jack Russell Terrier | 14 | ♂ | Periodontal disease |
2 | Yorkshire Terrier | 6 | ♀ | Periodontal disease |
3 | Maltese | 8 | ♀ | Periodontal disease |
4 | Maltese | 3 | ♀ | Periodontal disease |
5 | Prague Ratter | 11 | ♂ | Periodontal disease |
6 | Chihuahua | 9 | ♂ | Periodontal disease |
7 | Labrador Retriever | 10 | ♀ | Periodontal disease |
8 | German shepherd | 1 | ♀ | Healthy |
9 | German shepherd | 1 | ♀ | Healthy |
10 | German shepherd | 1 | ♀ | Healthy |
11 | German shepherd | 1 | ♀ | Healthy |
12 | German shepherd | 1 | ♀ | Healthy |
13 | German shepherd | 1 | ♂ | Healthy |
14 | German shepherd | 1 | ♂ | Healthy |
2.2. Molecular Analysis
Species-specific PCR using the primers targeting species P. gulae showed that P. gulae was detected in all dogs with periodontal disease and in 71.43% of healthy dogs. Using specific PCR for Treponema species, including T. denticola, the presence of Treponema spp. was detected in 71.43% of dogs with periodontal disease and in 57.14% dogs without periodontal disease. T. forsythia was detected in all dogs with and without periodontal disease by species-specific PCR. The presence of P. gulae and T. forsythia was confirmed by Sanger sequencing and Basic Local Alignment Search Tool algorithm. Based on these methods, Treponema spp. were identified as T. denticola and Treponema putidum. T. denticola was present in 28.57% of dogs with periodontal disease, T. putidum in 42.86% of dogs with periodontal disease and in 57.14% of healthy dogs. The results of detected periodontal pathogens in samples of dental plaques of healthy and periodontal disease groups are shown in Figure 2.
Figure 2.
Detection of periodontal pathogens in dental plaques of healthy and periodontal disease groups of dogs. P. g.—Porphyromonas gulae, T. f.—Tannerella forsythia, T. d.—Treponema denticola, and T. p.—Treponema putidum.
T. denticola was not present in any healthy dog. All three pathogens, P. gulae, T. forsythia and T. denticola, were detected in only two dogs with periodontal disease (28.57%). P. gulae together with T. forsythia were present in all dogs with periodontal disease and in five healthy dogs (71.43%) (Table 2).
Table 2.
Detection of periodontal pathogens in dental plaques of individual dogs.
Periodontal Disease Group | Healthy Group | ||||||||
---|---|---|---|---|---|---|---|---|---|
Dog | P. g. | T. f. | T. d. | T. p. | Dog | P. g. | T. f. | T. d. | T. p. |
1 | + | + | 8 | + | + | + | |||
2 | + | + | + | 9 | + | ||||
3 | + | + | + | 10 | + | + | + | ||
4 | + | + | 11 | + | + | + | |||
5 | + | + | + | 12 | + | + | + | ||
6 | + | + | + | 13 | + | ||||
7 | + | + | + | 14 | + | + |
P. g.—Porphyromonas gulae, T. f.—Tannerella forsythia, T. d.—Treponema denticola, and T. p.—Treponema putidum.
3. Discussion
Periodontal diseases represent a serious diagnostic and therapeutic problem in human and veterinary medicine. Therapy of periodontal diseases is focused on suppressing the progression of inflammation and often involves a combination of different therapeutic approaches, such as scaling and root planing, the use of antibiotics and antimicrobial agents (e.g., chlorhexidine), antimicrobial photodynamic therapy or even the use of probiotics [17,18]. Moreover, dental chews can be used in dogs to reduce periodontal disease by beneficially shifting the microbiota of dental plaque [19]. Periodontal pathogens from the dental plaque, apart from irreversible damaging periodontium, can also cause some systemic diseases, which points to the importance of their identification [16].
Both in humans and animals, composition of bacterial plaque has been studied for many decades using culture methods. In recent times, methods of molecular biology have come to the foreground because of its high specificity, low time-consuming character and technical demand. In the present study, we used molecular methods for the detection of P. gulae, T. forsythia and T. denticola, which are associated with canine periodontal disease. However, various research studies reported their different prevalence in plaque samples of dogs.
Özavci et al. (2019) detected the presence of P. gulae in dogs with periodontal disease in only 39% of samples [20]. Although, in the study of Senhorinho et al. (2011), the presence of P. gulae was observed in 56% of dogs without periodontitis and 92% of dogs with periodontitis [21]. Kato et al. (2011) reported the presence of P. gulae in 92.31% of dogs [15] and Yamasaki et al. (2012) in 71.2% of dogs [22]. In the present study, P. gulae was detected in 100% of dogs with and in 71.43% of dogs without periodontal disease.
Gołyńska et al. (2017) found T. forsythia in only one female dog, and in male dogs, they did not isolate this bacterium at all [16]. Özavci et al. (2019) detected the presence of T. forsythia in 4% of dogs with periodontal disease [20], which contradicts the results of other studies and the present study. Di Bello et al. (2014) identified T. forsythia in 67.12% of dogs [23] and Yamasaki et al. (2012) in 77.3% of dogs [22]. Kato et al. (2011) detected T. forsythia in almost all dogs analyzed; therefore, they consider it a common member of the canine oral microbiota [15]. In the present study, all dogs with and without periodontal disease were positive for T. forsythia.
Taxa belonging to the genus Treponema are common members of the microbial community of the human oral cavity. However, specific treponemes may be involved in the etiopathology of periodontal disease [24]. Valdez et al. (2000) confirmed the presence of T. denticola, T. socranskii ssp., T. vincentii, T. maltophilum, T. medium and T. pectinovorum in dental biofilm of dogs [25]. In the present study, consensus primers for the flaB2 gene for the detection of T. denticola, T. vincentii, T. medium ssp. bovis and T. phagedenis ssp. vaccae were used. The flaB2 gene has been previously used to determine Treponema species associated with bovine digital dermatitis [26,27].
Several studies report a prevalence of T. denticola in dogs of less than 7% [15,20,22,23]. In addition, Nishiyama et al. (2007) did not detect T. denticola in samples from dogs with periodontitis [28]. On the other hand, Gołyńska et al. (2017) observed T. denticola in all tested dogs [16]. In the present study, T. denticola was detected in 28.57% of dogs with periodontal disease but not in dogs without periodontal disease. Additionally, the presence of T. putidum was determined in the plaque samples taken from dogs with and without periodontal disease.
Oral treponemes are classified into 10 phylogroups. T. denticola and T. putidum belong to phylogroup 2 and share 98.5% of their 16S rRNA gene sequence homology [29]. Both T. putidum and T. denticola are associated with human periodontal disease. T. putidum was isolated for the first time from human periodontitis lesions and acute necrotizing ulcerative gingivitis sites [30]. T. putidum has homologues of virulence factors previously described within T. denticola, such as factor H binding protein implicated in evading complement-mediated killing, the major surface protein involved in cellular adhesion processes and cystalysin (hemolysin) involved in volatile sulfur compound production and erythrolysis [29]. In the present study, the presence of T. putidum was in positive correlation with both P. gulae and T. forsythia. Nises et al. (2018) detected T. putidum in samples from dogs with periodontal disease [11]. Based on these findings, we can assume that T. putidum also plays a role in the development of canine periodontal disease.
4. Materials and Methods
4.1. Animals and Sampling
A total of 14 dogs of different breeds, age and periodontal status were sampled at the Small Animal Clinic, University of Veterinary Medicine and Pharmacy in Kosice. Informed consent was obtained from the owners of the dogs for the study. The study was approved by the Ethics Commission of the University of Veterinary Medicine and Pharmacy in Kosice. Prior to the collection of dental plaque, an intraoral examination was performed to assess the periodontal status of each non-anesthetized dog by a veterinarian. The stage of periodontal disease was assessed according to Bauer et al. (2018) [31]. The dental plaque samples were taken from the buccal surfaces of the right upper canines and premolars with a syringe needle into an Eppendorf tube containing 300 µL of phosphate-buffered saline. After sampling, samples were stored at −70 °C until DNA extraction and PCR analysis were performed.
4.2. DNA Extraction
Thawed samples were centrifuged at 10,000× g for 10 min at 4 °C and the supernatant was discarded. The protocol for DNA extraction according to Vesty et al. (2017) [32] with some modifications was performed. Briefly, the pellet was resuspended in 180 µL of 10% sodium dodecyl sulphate and 25 µL of proteinase K was added to the mixture. The tubes were incubated at 55 °C for 2 h, with shaking at 300 rpm. Proteinase K was inactivated by heating at 95 °C for 5 min [33]. The tubes were then centrifuged at 10,000× g for 5 min at 23 °C and the supernatant was transferred to the Eppendorf tubes. Phenol and chloroform were equally (1:1) added to the supernatant and centrifuged at 10,000× g for 5 min at 23 °C. The upper aqueous phase was transferred to the Eppendorf tube. Isopropanol (0.6 volume of supernatant) and 3 M sodium acetate solution (0.1 volume of supernatant) were added. The nucleic acids were precipitated overnight at 4 °C. The following day, DNA was pelleted at 10,000× g for 10 min at 4 °C, washed with 100 µL of cold 70% ethanol and dried at 35 °C for 10 min. The pellets were resuspended in 30 μL of TE buffer [50 mM Tris-HCl, 10 mM EDTA]. The concentration of DNA was measured (NanoDrop 1000, Thermo Fisher Scientific, Waltham, WA, USA) and samples were diluted to a concentration of 50 ng/µL of template DNA.
4.3. PCR Assay
The PCR was processed using 2 µL (100 ng) of the sample (DNA template) added to 50 μL of reaction mixture containing OneTaq 2× Master Mix with Standard Buffer (New England Biolabs, Foster City, CA, USA), molecular grade water and primers. The primers used for PCR amplification of P. gulae, T. forsythia and Treponema species, including T. denticola, and PCR cycling conditions are listed in Table 3. PCR amplifications were performed in a thermocycler (TProfessional Basic, Biometra GmbH, Göttingen, Germany). A negative control (RNAse free H2O) was included in each PCR run. The amplicons were separated by gel electrophoresis and visualized with GelRed (Biotium, Inc., Hayward, CA, USA) under UV light [34]. A 100 bp DNA ladder (New England Biolabs, Foster City, CA, USA) was used as a molecular size standard.
Table 3.
Primer sequences and PCR conditions for the detection of periodontal pathogens.
Species (Gene) | Primer Sequence (5′ to 3′) | PCR Conditions | Length (bp) |
Source |
---|---|---|---|---|
Porphyromonas gulae (fragment of 16S rRNA gene) |
TTGGTTGCATGATCGGG | 94 °C 5 min, 35× [94 °C 30 s, 58 °C 1 min, 72 °C 30 s] 72 °C 5 min |
300 | [21] |
GCTTATTCTTACGGTACATTCAYA | ||||
Tannerella forsythia (fragment of 16S rRNA gene) |
GCGTATGTAACCTGCCCGCA | 95 °C 2 min, 36× [95 °C 30 s, 60 °C 1 min, 72 °C 1 min] 72 °C 2 min |
641 | [35] |
TGCTTCAGTGTCAGTTATACCT | ||||
Treponema denticola (flaB2 gene) |
ACGGYATTTCYTTTATTCAAGTTGC | 94 °C 5 min, 45× [94 °C 30 s, 63 °C 30 s, 72 °C 40 s] 72 °C 5 min |
471 | [27] |
CGAGTCTGTTYTGGTATGCACC |
4.4. Sequencing and Data Analysis
The amplification products were sent for Sanger sequencing in both forward and reverse directions (Microsynth, Wien, Austria). The obtained chromatograms of sequences were edited and aligned using Geneious alignment in Geneious 8.0.5 (Biomatters, Auckland, New Zealand). Homology searches were performed using the Basic Local Alignment Search Tool (BLAST) algorithm at the National Center for Biotechnology Information (NCBI). The nucleotide sequences were deposited in GenBank with accession numbers from MW595983 to MW595989, MW604827, MW604828, MW604829, MZ215849 and MZ215850, from OL839920 to OL839933, from OL906423 to OL906426, and from OM196210 to OM196214.
5. Conclusions
Based on our results, it can be assumed that T. forsythia is a common member of the oral microbiota of dogs, whereas T. denticola was detected only in dogs with periodontal disease. The higher prevalence of P. gulae was observed in dogs suffering with periodontal disease. Moreover, T. putidum may also be involved in the development of this disease. Further investigation is needed to clarify the possible co-involvement of T. putidum in the development of canine periodontal disease, and a larger sample size of studied population of dogs is needed as well.
Author Contributions
Conceptualization, J.K. and M.M.; methodology, R.M. and M.M.; validation, E.S., R.M. and M.M.; formal analysis, J.K.; investigation, J.K., M.S. and R.M.; resources, A.M., E.S., N.M. and J.F.; data curation, J.K.; writing—original draft preparation, J.K. and M.S.; writing—review and editing, E.S., R.M., R.N. and M.M.; visualization, J.K.; supervision, R.N.; project administration, M.M. and J.F.; funding acquisition, M.M. and J.F. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Scientific Grant Agency of the Ministry of Education, Science, Research and Sport of the Slovak Republic, grant number VEGA 1/0788/19 and by the Slovak Research and Development Agency, grant number APVV-16-0203. The APC was funded by Scientific Grant Agency of the Ministry of Education, Science, Research and Sport of the Slovak Republic, grant number VEGA 1/0714/20.
Institutional Review Board Statement
The study was conducted in accordance with the Declaration of Helsinki. The animal study protocol was approved by the Ethics Committee of the University of Veterinary Medicine and Pharmacy in Kosice (protocol code EKVP/2022-01, 14 January 2022).
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Stella J.L., Bauer A.E., Croney C.C. A cross-sectional study to estimate prevalence of periodontal disease in a population of dogs (Canis familiaris) in commercial breeding facilities in Indiana and Illinois. PLoS ONE. 2018;13:e0191395. doi: 10.1371/journal.pone.0191395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Garanayak N., Das M., Patra R.C., Biswal S., Panda S.K. Effect of age on dental plaque deposition and its control by ultrasonic scaling, dental hygiene chew, and chlorhexidine (0.2% w/v) in dogs. Vet. World. 2019;12:1872–1876. doi: 10.14202/vetworld.2019.1872-1876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Riggio M.P., Lennon A., Taylor D.J., Bennett D. Molecular identification of bacteria associated with canine periodontal disease. Vet. Microbiol. 2011;150:394–400. doi: 10.1016/j.vetmic.2011.03.001. [DOI] [PubMed] [Google Scholar]
- 4.Marshall M.D., Wallis C.V., Milella L., Colyer A., Tweedie A.D., Harris S. A longitudinal assessment of periodontal disease in 52 Miniature Schnauzers. BMC Vet. Res. 2014;10:166. doi: 10.1186/1746-6148-10-166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Harvey C.E., Laster L., Shofer F., Miller B. Scoring the full extent of periodontal disease in the dog: Development of a total mouth periodontal score (TMPS) system. J. Vet. Dent. 2008;25:176–180. doi: 10.1177/089875640802500303. [DOI] [PubMed] [Google Scholar]
- 6.Albuquerque C., Morinha F., Requicha J., Martins T., Dias I., Guedes-Pinto H., Bastos E., Viegas C. Canine periodontitis: The dog as an important model for periodontal studies. Vet. J. 2012;191:299–305. doi: 10.1016/j.tvjl.2011.08.017. [DOI] [PubMed] [Google Scholar]
- 7.Shaikh H.F.M., Patil S.H., Pangam T.S., Rathod K.V. Polymicrobial synergy and dysbiosis: An overview. J. Indian Soc. Periodontol. 2018;22:101–106. doi: 10.4103/jisp.jisp_385_17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hajishengallis G., Kajikawa T., Hajishengallis E., Maekawa T., Reis E.S., Mastellos D.C., Yancopoulou D., Hasturk H., Lambris J.D. Complement-Dependent Mechanisms and Interventions in Periodontal Disease. Front. Immunol. 2019;10:406. doi: 10.3389/fimmu.2019.00406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Mohanty R., Asopa S.J., Joseph M.D., Singh B., Rajguru J.P., Saidath K., Sharma U. Red complex: Polymicrobial conglomerate in oral flora: A review. J. Family Med. Prim. Care. 2019;8:3480–3486. doi: 10.4103/jfmpc.jfmpc_759_19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lenzo J.C., O’Brien-Simpson N.M., Orth R.K., Mitchell H.L., Dashper S.G., Reynolds E.C. Porphyromonas gulae Has Virulence and Immunological Characteristics Similar to Those of the Human Periodontal Pathogen Porphyromonas gingivalis. Infect. Immun. 2016;84:2575–2585. doi: 10.1128/IAI.01500-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Nises J., Rosander A., Pettersson A., Backhans A. The occurrence of Treponema spp. in gingival plaque from dogs with varying degree of periodontal disease. PLoS ONE. 2018;13:e0201888. doi: 10.1371/journal.pone.0201888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Dashper S.G., Seers C.A., Tan K.H., Reynolds E.C. Virulence factors of the oral spirochete Treponema denticola. J. Dent. Res. 2011;90:691–703. doi: 10.1177/0022034510385242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Nordhoff M., Rühe B., Kellermeier C., Moter A., Schmitz R., Brunnberg L., Wieler L.H. Association of Treponema spp. with canine periodontitis. Vet. Microbiol. 2008;127:334–342. doi: 10.1016/j.vetmic.2007.09.011. [DOI] [PubMed] [Google Scholar]
- 14.Malinowski B., Węsierska A., Zalewska K., Sokołowska M.M., Bursiewicz W., Socha M., Ozorowski M., Pawlak-Osińska K., Wiciński M. The role of Tannerella forsythia and Porphyromonas gingivalis in pathogenesis of esophageal cancer. Infect. Agent. Cancer. 2019;14:3. doi: 10.1186/s13027-019-0220-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kato Y., Shirai M., Murakami M., Mizusawa T., Hagimoto A., Wada K., Nomura R., Nakano K., Ooshima T., Asai F. Molecular detection of human periodontal pathogens in oral swab specimens from dogs in Japan. J. Vet. Dent. 2011;28:84–89. doi: 10.1177/089875641102800204. [DOI] [PubMed] [Google Scholar]
- 16.Gołyńska M., Polkowska I., Bartoszcze-Tomaszewska M., Sobczyńska-Rak A., Matuszewski Ł. Molecular-level evaluation of selected periodontal pathogens from subgingival regions in canines and humans with periodontal disease. J. Vet. Sci. 2017;18:51–58. doi: 10.4142/jvs.2017.18.1.51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Butera A., Gallo S., Maiorani C., Molino D., Chiesa A., Preda C., Esposito F., Scribante A. Probiotic Alternative to Chlorhexidine in Periodontal Therapy: Evaluation of Clinical and Microbiological Parameters. Microorganisms. 2021;9:69. doi: 10.3390/microorganisms9010069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Niemec B.A. Breed Predispositions to Dental and Oral Disease in Dogs. Wiley-Blackwell; San Diego, CA, USA: 2021. Periodontal Therapy in Small and Toy Breed Dogs; pp. 157–178. [Google Scholar]
- 19.Oba P.M., Carroll M.Q., Alexander C., Somrak A.J., Keating S., Sage A.M., Swanson K.S. Dental chews positively shift the oral microbiota of adult dogs. J. Anim. Sci. 2021;99:skab100. doi: 10.1093/jas/skab100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Özavci V., Erbas G., Parin U., Yüksel H.T., Kirkan Ş. Molecular detection of feline and canine periodontal pathogens. Vet. Anim. Sci. 2019;8:100069. doi: 10.1016/j.vas.2019.100069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Senhorinho G.N., Nakano V., Liu C., Song Y., Finegold S.M., Avila-Campos M.J. Detection of Porphyromonas gulae from subgingival biofilms of dogs with and without periodontitis. Anaerobe. 2011;17:257–258. doi: 10.1016/j.anaerobe.2011.06.002. [DOI] [PubMed] [Google Scholar]
- 22.Yamasaki Y., Nomura R., Nakano K., Naka S., Matsumoto-Nakano M., Asai F., Ooshima T. Distribution of periodontopathic bacterial species in dogs and their owners. Arch. Oral Biol. 2012;57:1183–1188. doi: 10.1016/j.archoralbio.2012.02.015. [DOI] [PubMed] [Google Scholar]
- 23.Di Bello A., Buonavoglia A., Franchini D., Valastro C., Ventrella G., Greco M.F., Corrente M. Periodontal disease associated with red complex bacteria in dogs. J. Small Anim. Pract. 2014;55:160–163. doi: 10.1111/jsap.12179. [DOI] [PubMed] [Google Scholar]
- 24.You M., Mo S., Leung W.K., Watt R.M. Comparative analysis of oral treponemes associated with periodontal health and disease. BMC Infect. Dis. 2013;13:174. doi: 10.1186/1471-2334-13-174. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Valdez M., Haines R., Riviere K.H., Riviere G.R., Thomas D.D. Isolation of oral spirochetes from dogs and cats and provisional identification using polymerase chain reaction (PCR) analysis specific for human plaque Treponema spp. J. Vet. Dent. 2000;17:23–26. [PubMed] [Google Scholar]
- 26.Evans N.J., Brown J.M., Demirkan I., Murray R.D., Vink W.D., Blowey R.W., Hart C.A., Carter S.D. Three unique groups of spirochetes isolated from digital dermatitis lesions in UK cattle. Vet. Microbiol. 2008;130:141–150. doi: 10.1016/j.vetmic.2007.12.019. [DOI] [PubMed] [Google Scholar]
- 27.Brandt S., Apprich V., Hackl V., Tober R., Danzer M., Kainzbauer C., Gabriel C., Stanek C., Kofler J. Prevalence of bovine papillomavirus and Treponema DNA in bovine digital dermatitis lesions. Vet. Microbiol. 2011;148:161–167. doi: 10.1016/j.vetmic.2010.08.031. [DOI] [PubMed] [Google Scholar]
- 28.Nishiyama S.A.B., Senhorinho G.N., Gioso M.A., Avila-Campos M.J. Detection of putative periodontal pathogens in subgingival specimens of dogs. Braz. J. Microbiol. 2007;38:23–28. doi: 10.1590/S1517-83822007000100006. [DOI] [Google Scholar]
- 29.Lacap-Bugler D.C., Jiang J., Huo Y.B., Chan Y., Leung F.C., Watt R.M. Complete Genome Sequence of the Oral Spirochete Bacterium Treponema putidum Strain OMZ 758T (ATCC 700334T) Genome Announc. 2014;2:e01076-14. doi: 10.1128/genomeA.01076-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Wyss C., Moter A., Choi B.K., Dewhirst F.E., Xue Y., Schüpbach P., Göbel U.B., Paster B.J., Guggenheim B. Treponema putidum sp. nov., a medium-sized proteolytic spirochaete isolated from lesions of human periodontitis and acute necrotizing ulcerative gingivitis. Int. J. Syst. Evol. Microbiol. 2004;54:1117–1122. doi: 10.1099/ijs.0.02806-0. [DOI] [PubMed] [Google Scholar]
- 31.Bauer A.E., Stella J., Lemmons M., Croney C.C. Evaluating the validity and reliability of a visual dental scale for detection of periodontal disease (PD) in non-anesthetized dogs (Canis familiaris) PLoS ONE. 2018;13:e0203930. doi: 10.1371/journal.pone.0203930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Vesty A., Biswas K., Taylor M.W., Gear K., Douglas R.G. Evaluating the Impact of DNA Extraction Method on the Representation of Human Oral Bacterial and Fungal Communities. PLoS ONE. 2017;12:e0169877. doi: 10.1371/journal.pone.0169877. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Aas J.A., Paster B.J., Stokes L.N., Olsen I., Dewhirst F.E. Defining the normal bacterial flora of the oral cavity. J. Clin. Microbiol. 2005;43:5721–5732. doi: 10.1128/JCM.43.11.5721-5732.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Huang Q., Baum L., Fu W.L. Simple and practical staining of DNA with GelRed in agarose gel electrophoresis. Clin. Lab. 2010;56:149–152. [PubMed] [Google Scholar]
- 35.Bankur P.K., Nayak A., Bhat K., Bankur R., Naik R., Rajpoot N. Comparison of culture and polymerase chain reaction techniques in the identification of Tannerella forsythia in periodontal health and disease, an in vitro study. J. Indian Soc. Periodontol. 2014;18:155–160. doi: 10.4103/0972-124X.131312. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Not applicable.