Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Jun 1.
Published in final edited form as: Prostate. 2022 Mar 24;82(8):917–932. doi: 10.1002/pros.24336

Diptoindonesin G antagonizes AR signaling and enhances the efficacy of anti-androgen therapy in prostate cancer

Fengyi Mao 1, Yifan Kong 1, Jinghui Liu 1, Xiongjian Rao 1, Chaohao Li 1, Kristine Donahue 2, Yanquan Zhang 1, Katelyn Jones 1, Qiongsi Zhang 1, Wei Xu 2, Xiaoqi Liu 1,3,*
PMCID: PMC9035130  NIHMSID: NIHMS1789684  PMID: 35322879

Abstract

The androgen receptor (AR) signaling pathway has been well demonstrated to play a crucial role in the development, progression, and drug resistance of prostate cancer. Although the current anti-androgen therapy could significantly benefit prostate cancer patients initially, the efficacy of the single drug usually lasts for a relatively short period, as drug resistance quickly emerges. Here, we identified that Diptoindonesin G (Dip G), a natural extracted compound, could promote the proteasome degradation of AR and polo-like kinase 1 (PLK1) through modulating the activation of CHIP E3 ligase. Administration of Dip G has shown a profound efficiency in the suppression of AR and PLK1, not only in androgen-dependent LNCaP cells but also in castration-resistant and enzalutamide-resistant cells in a CHIP-dependent manner. Through co-targeting the AR signaling, Dip G robustly improved the efficacy of HSP90 inhibitors and enzalutamide in human prostate cancer cells as well. In parallel, the synergistic effect between HSP90 inhibitor and Dip G has been validated using an in vivo xenograft mouse model. Our results revealed that Dip G-mediated AR degradation would be a promising and valuable therapeutic strategy in the clinic.

Keywords: androgen receptor, prostate cancer, Diptoindonesin G, CHIP E3 ligase, drug resistance

Introduction

In the United States, prostate cancer is most commonly diagnosed in males, the incidence of which could achieve as high as 12.5%, and people who died because of prostate cancer have exceeded 30,000 each year1. Androgen hormone binds to the androgen receptor (AR) and triggers the oncogenic transcription program, contributing to development, progression, and drug resistance in prostate cancer2,3. Consequently, androgen deprivation therapy (ADT) has become the standard therapeutic modality to treat prostate cancer patients initially from the 1940s to the present3,4. Once prostate cancer develops into castration-resistant prostate cancer (CRPC), the second-generation anti-androgen therapies, such as Enzalutamide5, Apalutamide6, and Abiraterone7,8, have been widely used clinically and gain profound efficacy in the treatment of CRPC patients. Unfortunately, the patients eventually progress towards a drug-resistant phenotype in a relatively short period, indicating that novel therapeutic strategies are urgently needed.

Ample evidence from both clinical trials and cell-based experiments has revealed that the development and progression of prostate cancer constantly rely on the activation of AR9. Multiple studies have revealed the tight correlation between drug resistance and AR signaling, including (a) amplification or overexpression of AR gene10–12; (b) point mutations leading to the loss of specificity toward AR antagonists13,14; (c) AR splicing variants (AR-Vs) that constitutively activate AR signaling in a ligand-independent manner15–17; (d) intratumoral androgen biosynthesis18,19; (e) amplification or alteration of AR coactivators19. Overall, AR and AR-Vs have been regarded as the most applicable therapeutic targets in the clinic to treat prostate cancer patients19. To date, except for the transcription suppression of AR signaling, targeting at the proteomic equilibrium of AR has become a valuable strategy to improve the efficiency of current treatment strategies in prostate cancer patients as well20.

C-terminus of HSP70-interacting protein (CHIP) is a well-known E3 ubiquitin ligase, which profoundly participates in the protein quality control process, and is also intimately involved in cellular signaling, DNA damage, immune response, and aging21. Associated with other chaperone proteins, such as HSP7020,22 and HSP9023, CHIP induces the proteasome degradation of several critical oncogenes, containing full-length AR24–26, AR-V20, p53 mutants27, c-Myc28, PLK126 and JMJD1A29. Consequently, modulating the activity of CHIP E3 ligase might be a novel therapeutic strategy to benefit advanced prostate cancer. Recently, Diptoindonesin G (Dip G), a natural compound isolated from tropical plants30, has been identified as a regulator of CHIP’s activity through a compound library screening31. Intriguingly, Dip G results in the CHIP-dependent protein degradation of ERα but not ERβ in breast cancer31. Moreover, Dip G has been found as an effective inhibitor to suppress leukemia and basal-like breast cancer both in vitro and in vivo32,33, making it an innovative and promising drug that might be applicable in the clinic. However, the efficiency and antitumor properties of Dip G in prostate cancer have not been investigated yet.

Herein, we examined the efficacy of Dip G and demonstrated that it could induce AR degradation in a CHIP-dependent manner in the human prostate cancer cells. To support, we then showed that manipulating the expression level of CHIP significantly affected the sensitivity of prostate cancer cells to Dip G treatment. Moreover, Dip G cooperates with both HSP90 inhibitors and Enzalutamide to further enhance the suppression of the AR signaling pathway in human prostate cancer cell lines. Finally, the efficacy of combining Dip G and HSP90 inhibitor Tanespimycin was validated in the 22Rv1-derived xenograft model. Taken together, these results suggest that the application of Dip G could be advantageous to overcome drug resistance and enhance therapeutic efficiency in prostate cancer patients clinically.

Results

Dip G treatment results in AR and PLK1 inhibition

To evaluate the anti-tumor properties of Dip G in prostate cancer, RNA transcriptome sequencing was performed and analyzed in 22Rv1, an aggressive human CRPC cell line. Due to AR’s crucial role in prostate cancer, the regulation of AR signaling pathway was highly emphasized. The heatmap and GSEA analysis of RNA-seq data have suggested that the androgen response signaling pathway was remarkably suppressed (p<0.000, NES=−1.43) upon Dip G treatment in 22Rv1 cells (Figs. 1A and 1B). Subsequently, qRT-PCR towards major downstream targets of AR, such as PSA, NKX3.1, and TMPRSS2, has been performed to validate the RNA-seq results. In agreement, we showed that AR signaling pathway indeed was significantly suppressed by Dip G treatment (Fig. 1C). Importantly, the transcription level of AR remained stable under Dip G treatment compared to the control group, indicating that Dip G did not influence the transcription of AR. Intriguingly, Dip G treatment led to a dramatic inhibition in the expression of AR-V7 on its mRNA level, as well as its preferred downstream target UBE2C. Moreover, the dual-luciferase assay revealed that Dip G significantly downregulated the transcriptional activity at the promoter region of PSA in both androgen-dependent LNCaP and CRPC 22Rv1 cells (Fig. 1D). Furthermore, the protein level of AR was significantly decreased with the treatment of Dip G in a dosage-dependent manner, not only in early-stage LNCaP cells but in the castration- and enzalutamide-resistant cells (Figs. 1E–1I). As previously described, Dip G could mediate the activity of CHIP E3 ligase to influence the proteasome degradation of its substrates31, so we hypothesized that CHIP E3 ligase is involved in the Dip G-induced AR degradation. As such, we also examined the protein levels of other CHIP substrates, PLK1 and HDAC6, and showed that Dip G treatment also resulted in reduced levels of PLK1 and HDAC6 (Figs. 1E–1I). Taken together, our results suggest that Dip G could profoundly downregulate AR and PLK1 in different stages of prostate cancer, indicating its potentially broad application in the clinic.

Figure 1. Dip G administration results in downregulation of both AR and PLK1 in prostate cancer cells.

Figure 1.

Open in a new tab

(A and B) Enrichment of androgen signaling pathway analyzed by GESA. 22Rv1 cells were treated with 10μM Dip G for 24h and then subjected to RNA-seq analysis. (C) mRNA levels of AR-targeted genes were analyzed by qRT-PCR. *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (D) LNCaP (left) and 22Rv1 (right) cells were transfected with luciferase reporters containing the PSA promoter region and treated with Dip G at the indicated concentrations, followed by a dual-luciferase assay. *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (E-I) LNCaP (E), 22Rv1 (F), C4-2 (G), MR49F (H), and C4-2R (I) cells were treated with the indicated concentrations of Dip G for 24h and subjected to western blot to detect the expression levels of AR and PLK1.

Dip G induces proteasome degradation of AR and PLK1 through CHIP E3 ligase

To validate that Dip G induces the proteasome degradation of AR in prostate cancer, we pre-treated 22Rv1 cells with cycloheximide (CHX) to inhibit protein synthesis before incubation with Dip G and showed that the presence of CHX potentiated Dip G-associated degradation of AR and AR-Vs (Fig. 2A). Next, we asked whether Dip G-induced AR degradation is dependent on CHIP E3 ligase by immunoprecipitation (IP) assay in 293T cells. As indicated, we found that Dip G treatment enhanced the binding affinity between AR and CHIP E3 ligase in a dosage-dependent manner (Fig. 2B). In addition, the ubiquitination level of AR was robustly increased as well in the presence of MG132, a proteasome inhibitor, further suggesting dramatically enhanced proteasome degradation of AR upon Dip G treatment (Fig. 2C). Fig 2D also showed a stronger binding affinity between PLK1 and CHIP E3 ligase upon Dip G treatment. In agreement, the enhanced binding of AR and CHIP was detected in Dip G-treated 22Rv1 cells even the AR protein level was dramatically decreased (Fig. 2E). As expected, the addition of MG132 could significantly rescue the protein level of AR, confirming that Dip G largely elevates the ubiquitination level of AR (Fig. 2F). Similarly, Dip G also promoted the proteasome degradation of endogenous PLK1 in 22Rv1 cells (Fig. 2G). Most importantly, knocking down CHIP by shRNA could significantly rescue the Dip G-induced AR degradation in 22Rv1 and C4-2R cells even in the presence of CHX (Figs. 2H and 2I), suggesting that CHIP was the prerequisite for the effect of Dip G in prostate cancer cells. In summary, we have demonstrated that Dip G could activate the CHIP E3 ligase in prostate cancer cells, leading to the proteasome degradation of AR and PLK1.

Figure 2. Dip G enhances the activity of CHIP E3 ligase to degrade AR and PLK1.

Figure 2.

Open in a new tab

(A) 22Rv1 cells were pre-treated with the indicated concentrations of Dip G for 4h, incubated with 50μg/μL cycloheximide (CHX) for 24h, and harvested for western blot to measure the levels of AR and AR-Vs. (B and C) 293T cells were co-transfected with FLAG-CHIP, GFP-AR and Myc-ubiquitin, and treated with different concentrations of Dip G (10μM or 20μM) for 24h, followed by MG132 for 12h. The harvested cells were subjected to immunoprecipitation (IP) to detect either the binding between AR and CHIP (B) or the ubiquitination level of AR (C). (D) 293T cells were co-transfected with FLAG-CHIP, HA-PLK1 and Myc-ubiquitin, and treated with different concentrations of Dip G (10μM or 20μM) for 24h, followed by MG132 treatment for 12h. Then the cells were subjected to IP for either HA or FLAG to detect the binding between PLK1 and CHIP upon Dip G treatment. (E) 22Rv1 cells were incubated with 10μM Dip G for 24h, treated with MG132 for 12h, and then subjected to IP for AR, followed by western blot to examine the binding between AR and CHIP. (F and G) 22Rv1 cells were treated with DMSO or indicated concentrations of Dip G for 24h, followed by the treatment of MG132 and harvested for IP against AR (F) or PLK1 (G), followed by anti-ubiquitin western blot to detect the degradation of AR (F) and PLK1 (G). (H and I) 22Rv1 (H) and C4-2R (I) cells were infected with lentivirus expressing either control or shCHIP to establish stable cell lines. Then the cells were incubated with indicated concentrations of Dip G and CHX for 24h, followed by western blot to detect AR levels. The top panel: cells were only treated with Dip G for 4h.

The level of CHIP affects the efficacy of Dip G in prostate cancer cells

To further validate that CHIP is the key modulator for Dip G’s efficacy, the expression level of CHIP was manipulated in human prostate cancer cell lines. Accordingly, shRNAs targeting Ctrl or CHIP have been packaged with the lentivirus system to infect the human prostate cancer cells to generate stable shCtrl or shCHIP cells. As expected, knocking down of CHIP rendered the cells to be much more resistant to Dip G treatment in 22Rv1 and C4-2R cells (Figs. 3A and 3B). As shown in the cell viability assay, the IC50 of Dip G has vastly increased to 1.23 ~ 1.74 fold in the shCHIP cells in comparison to the shCtrl cells. In parallel, the lower expression of CHIP E3 ligase also led to more stabilized AR upon Dip G treatment in both 22Rv1 and C4-2R cells (Figs. 3C and 3D). On the contrary, CHIP overexpression increased cellular response to Dip G, resulting in a significant reduction of IC50 from 7.394 μM to 4.459 μM in C4-2 cells (Fig. 3E). To support, a higher CHIP protein level correlated to an elevated ratio of cleaved-PARP to full-length PARP, suggesting that the cells underwent more apoptosis upon CHIP overexpression (Fig. 3F). Meanwhile, compared to C4-2 Ctrl cells, C4-2 CHIP cells showed a significant decrease in the protein levels of AR and PLK1, suggesting remarkably enhanced degradation of AR and PLK1 upon Dip G treatment (Figs. 3F and 3G). Altogether, our data demonstrated that CHIP is the crucial mediator in the action of Dip G in prostate cancer.

Figure 3. Dip G suppresses AR and PLK1 in a CHIP-dependent manner.

Figure 3.

Open in a new tab

(A-D) 22Rv1 (A and C) and C4-2R (B and D) cells were infected with lentivirus to stably knockdown CHIP, followed by either cell viability assays (A and B) or western blot (C and D) to detect the role of CHIP in response to Dip G treatment. *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (E-G) C4-2 cells were infected with lentivirus of either empty vector (Ctrl) or CHIP to establish stable cell lines. (E) C4-2 Ctrl or CHIP cells were treated with indicated concentrations of Dip G, followed by measurement of cell viability. *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (F) C4-2 Ctrl or CHIP cells were treated with indicated concentrations of Dip G and subjected to western blot to detect protein levels of PLK1, AR, and cleaved-PARP. (G) The protein level of AR (left) and PLK1 (right) was quantified upon treatment of Dip G.

Dip G cooperates with Enzalutamide in the treatment of prostate cancer cells

Due to the profound effect of Dip G on AR signaling, we were curious whether it could cooperate with other well-known and effective inhibitors in prostate cancer treatment. A second-generation anti-androgen drug, Enzalutamide, has been widely applied as a first-line treatment and displays great benefit to advanced prostate cancer patients clinically5. Unfortunately, due to the quick emergence of drug resistance, the effective period of Enzalutamide is relatively short5,19. To improve and prolong the patients’ lifespans, we were wondering whether Dip G could potentiate the anti-tumor function of Enzalutamide. As expected, the single treatment of Enzalutamide could repress the activity of AR in a dose-dependent manner in early-stage prostate cancer cells (Figs. S1A–S1C). However, its efficacy in late-stage 22RV1 cells was restricted. Surprisingly, we found that the addition of Dip G could robustly decrease the protein level of AR and further suppress its transcriptional activity, in not only androgen-sensitive LNCaP cells but castration-resistant C4-2 and 22Rv1 cells (Figs. 4A–4C and S2A–S2B). In parallel, the protein level of cleaved-PARP increased dramatically, through which we could conclude that the combination therapy had greater efficiency in inducing cell apoptosis compared to mono-therapy. Moreover, even though the single treatment of Dip G or Enzalutamide could slightly repress cell growth, their effectiveness was not as powerful as the combinational therapy (Figs. 4D and 4E). According to the analysis, the cell doubling time remarkably extended upon the co-treatment of Dip G and Enzalutamide, particularly in LNCaP cells. Furthermore, the combination of Dip G and Enzalutamide resulted in the lower numbers and smaller sizes of colonies formed using the 22Rv1 cells (Fig. 4F). Collectively, our results have provided strong evidence that Dip G acts cooperatively with Enzalutamide in human prostate cancer cells.

Figure 4. Dip G could enhance the efficiency of Enzalutamide and Tanespimycin.

Figure 4.

Open in a new tab

(A-C) LNCaP (A), C4-2 (B), and 22Rv1 (C) cells were treated with the indicated drugs, followed by western blot to measure the expression levels of AR, PARP, cleaved-PARP and PSA. (D-E) Growth assays of 22Rv1 (D) and LNCaP (E) cells upon treatment of DMSO, Enzalutamide, Dip G, or the combination of Enzalutamide plus Dip G. *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (F) Representative images of colony formation assay for 22Rv1 cells upon the indicated drug treatment (left). The colony assay was quantified from 3 independent experiments (right). *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (G-H) LNCaP (G) and 22Rv1 (H) cells were treated with the indicated concentrations of Tanespimycin, followed by western blot against AR. (I-J) C4-2R (I) and 22Rv1 (J) cells were treated with the indicated drugs for 24h and subjected to the analysis of AR expression by western blot. (K) Representative images of colony formation assay under the indicated drug treatment (left). The colony formation assay was quantified from 3 independent experiments (right). *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (L) Growth curves of 22Rv1 cells under the indicated drug treatment. *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (M-N) IC50 value of Dip G, Tanespimycin, Onalespib, and corresponded CI (combination index) was calculated in 22Rv1 (M) and C4-2R (N) cells 35–37.

Dip G enhances the efficiency of the HSP90 blockade

In addition to AR, HSP90 has been regarded as a potential therapeutic target in prostate cancer treatment, several inhibitors of which are currently under clinical trials23,26,34. HSP90, a well-known molecular chaperon protein, functions to maintain and regulate the stability of multiple proteins in various cellular processes23,34. Especially in human prostate cancer cells, the inhibition of HSP90 not only induces degradation of full-length AR protein but suppresses the endogenous expression of AR-Vs, suggesting targeting HSP90 may be beneficial and applicable clinically34. Based on these observations, we hypothesized that Dip G might act synergistically with the anti-HSP90 inhibitors. Firstly, the effect of HSP90 inhibitor Tanespimycin was tested in LNCaP and 22Rv1 cells (Figs. 4G and 4H). As indicated in our results, Tanespimycin could lead to the reduction of AR and PSA protein, while its efficiency on either full-length AR or AR-Vs was limited. Notably, the addition of the Dip G exhibited further depletion of the AR and AR-Vs proteins, compared to the single treatment of HSP90 inhibitors, either Tanespimycin or Onalespib (Figs. 4I and 4J). In addition, the colony formation assay and cell proliferation assay also confirmed the strong synergy between Tanespimycin and Dip G in 22Rv1 cells (Figs. 4K and 4L). In contrast to the control or single-treatment, the combination treatment of Tanespimycin and Dip G resulted in fewer colonies and extended cell-doubling time, supporting its repressive efficacy in human prostate cancer cells. Furthermore, to evaluate the efficiency of this drug combination more intuitively, the combination index (CI) had been calculated according to the method by TC Chou and analyzed by their software CompuSyn35–37. Most importantly, the CI value exhibited a descending trend along with the elevation of the drug effect level, as shown in Figs. 4M and 4N. Notably, in 22Rv1 and C4-2R cells, the values of CI50, CI75, and CI90 were less than 0.8, which has further demonstrated the dramatic synergy in the combination of Dip G and anti-HSP90 inhibitors. Interestingly, this synergy could not only be observed in the 22RV1 cell but also the enzalutamide-resistant prostate cancer cell C4-2R, suggesting a broad application of this novel therapeutic strategy. Taken together, we concluded that Dip G functions in strong synergy with anti-HSP90 inhibitors based on our in vitro experiments.

To further validate the therapeutic efficiency and safety profile in vivo, castrated NSG mice bearing 22RV1-derived xenograft tumors were treated with the empty vehicle, Tanespimycin, Dip G, and the combination of Tanespimycin and Dip G, respectively. As shown in the tumor growth curves, the inhibitory effect of either Tanespimycin or Dip G was minor and limited, which was no significant difference found between control and single treatments on the tumor size. However, the dual-treatment of Tanespimycin and Dip G exhibited striking suppression on the tumor volume, compared to control or mono-treatment (Figs. 5A and 5B). Interestingly, similar to the previous publications, lung metastasis has also been observed in our study38. In the control group, the multiple metastatic loci were detected in the lung, while lung loci were partially inhibited under either Tanespimycin or Dip G treatment (Fig. 5C). Meanwhile, the metastasis loci were barely detected in the combinational treated mice (Fig. 5C). Of note, there was no dramatic alteration in the mouse average body weights among the four groups (Fig. 5D), indicating that the toxicity of the combination therapy was negligible. However, the tumor weights were reduced remarkably upon the combination treatment of Tanespimycin and Dip G, as low as about half of the control group (Fig. 5E). Moreover, the serum PSA level of the Dip G group was significantly lower than control and Tanespimycin groups, showing the effectiveness of Dip G in vivo (Fig. 5F). In the meantime, the co-treatment group showed an even more reduction in the serum PSA compared to the Dip G group, further demonstrating the strong synergistic effect between Dip G and Tanespimycin (Fig. 5F). Histologically, the H&E staining of tumors has indicated that the combination treatment led to more collapsed nuclei and condensed cytosol (Fig. 5G). In addition, there was a dramatic reduction of cell proliferation marker Ki-67 and significant induction of apoptotic marker cleaved-Caspase3 in the co-treatment group (Fig. 5G). Meanwhile, the protein levels of AR were also greatly decreased in the mouse tumors, consistent with what we observed in cultured cells (Fig. 5G). In closing, our in vitro and in vivo experiments have fully demonstrated that HSP90 inhibitors could cooperate with Dip G to treat human prostate cancer. Through regulating AR degradation, this novel combination therapy could remarkably induce cell apoptosis and suppress cell proliferation, suggesting that the application of this novel therapy in the clinic may broadly benefit patients with advanced prostate cancer.

Figure 5. Dip G and Tanespimycin function synergistically in 22Rv1-derived xenograft tumors.

Figure 5.

Open in a new tab

(A) Growth curves of 22Rv1-derived tumors. Male NSG mice were pre-castrated, inoculated subcutaneously with 22Rv1 cells (2×106) and administered with Dip G (10 mg/kg body weight, oral gavage, once daily), Tanespimycin (10 mg/kg body weight, oral gavage, every two days), or a combination of both drugs. The sizes of the tumors in each group were measured every 2 days (mean ± SEM; n = 6 mice from each experiment group). *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (B) Representative images of the tumors at the end of the study. (C) Representative images of lungs upon harvest. (D) Body weights of mice at the end of the study. No significance was found by the two-tailed, unpaired Student’s t-test. (E) Tumor weights were measured right after being freshly removed from the bodies. *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (F) Serum PSA was measured by ELISA. *p<0.05, **p<0.01, ***p<0.001 by the two-tailed, unpaired Student’s t-test. (G) Representative images of histologic staining of harvested 22Rv1 tumors.

Overexpression of PLK1 diminishes the effect of Dip G in prostate cancer cells

As we previously demonstrated, PLK1 is also a target of CHIP E3 ligase, and its protein level was also decreased upon Dip G treatment (Figs. 1E–1I). Interestingly, several publications have indicated that PLK1 could facilitate and enhance the activity of AR signaling26,39,40. Considering that PLK1 is also a potential therapeutic target in multiple cancers, we asked whether the expression of PLK1 could influence the Dip G sensitivity in prostate cancer cells. To explore this possibility, we infected C4-2 cells with lentivirus, followed by selection with puromycin to generate cell lines stably expressing PLK1. Compared to the C4-2 Ctrl cells, PLK1 OE cells exhibited an obvious increase in the IC50 of Dip G from 4.680 μM to 6.045 μM, indicating that C4-2 PLK1-OE cells were more tolerant to Dip G treatment (Fig. 6A). Moreover, compared to the control cells, degradation of AR protein was less profound in the PLK1 overexpressing cells, while the expression of AR downstream target PSA also maintained a higher level, indicating that PLK1 could enhance AR signaling and protect it from the Dip G-induced degradation (Figs. 6B and 6C). Of note, our data has suggested that PLK1 is tightly correlated with the activation of AR signaling. In addition, a higher PLK1 expression level contributes to the Dip G resistance in prostate cancer cells, further supporting that PLK1 functions as an oncogene in the progression and development of human prostate cancer. To summarize, Dip G treatment could enhance the binding affinity between the CHIP E3 ligase and its substrates, AR and PLK1, leading to the suppression of multiple human prostate cancer cells. Meanwhile, the combination of Dip G with either anti-androgen or anti-HSP90 inhibitors has shown strong synergy, further suggesting its potential and broad application in the clinic (Fig. 6D).

Figure 6. Overexpression of PLK1 diminishes the effect of Dip G in prostate cancer cells.

Figure 6.

Open in a new tab

(A) C4-2 cells were infected with either empty vector (Ctrl) or PLK1 (PLK1-OE) and selected with puromycin to establish stable cell lines. Upon the 72h treatment of Dip G, cell viability was tested in C4-2 Ctrl or C4-2 PLK1-OE cells. *p<0.05, **p<0.01 by the two-tailed, unpaired Student’s t-test. (B-C) C4-2 Ctrl and C4-2 PLK1-OE cells were treated with the indicated concentrations of Dip G for 24h (B) or 48h (C), followed by the analysis of either AR, PSA, or HDAC6 by western blot. (D) A proposed working model for Dip G in prostate cancer treatment. Dip G could activate the E3 ligase activity of CHIP and induce the proteasome degradation of AR and PLK1, eventually contributing to the suppression of prostate cancer cells. As such, Dip G could act synergistically with both anti-androgens and anti-HSP90 inhibitors to enhance their drug efficiency. Of note, PLK1 could facilitate the AR activity, so overexpression of PLK1 would antagonize Dip G and result in drug resistance. The figure was created with BioRender.com.

Discussion

Our results uncovered that Dip G disrupts the balance of maintaining the AR and PLK1 protein through activation of the CHIP E3 ligase in multiple human prostate cancer cell lines, including androgen-sensitive cells, castration-resistant cells, and Enzalutamide-resistant cells. Interestingly, Dip G treatment greatly suppresses the transcription level of AR-V7 and its downstream signaling as well. However, the underlying regulatory mechanism of AR-V7 is unknown, which requires further investigation. In addition, manipulation of CHIP protein would dramatically impact the cellular sensitivity toward Dip G treatment. Besides, Dip G functions synergistically with anti-androgens and anti-HSP90 inhibitors, in vitro and in vivo, to robustly induce cell apoptosis and remarkably suppress cell proliferation. Intriguingly, the high expression of PLK1 facilitates the activity of AR signaling and contributes to the resistance to Dip G treatment, suggesting PLK1’s crucial role in drug resistance in prostate cancer. Our findings reveal that regulating the stability of AR and PLK1 protein by Dip G is a valuable and potential strategy to overcome drug resistance and improve therapeutic efficacy in the clinic.

Plenty of studies suggested the pivotal role of AR signaling in the survival, development, and progression of prostate cancer19. The current therapeutic strategies targeting AR signaling, such as Enzalutamide and Abiraterone, have shown profound efficiency in prostate cancer patients, while patients eventually gain drug resistance and become incurable5,7,8,19. AR and AR-Vs are the most frequently aberrant genes found in the development of drug resistance, making them the first-line targets on the clinical treatment. Recently, multiple studies reveal the underlying signaling pathways involved in the acquisition of Enzalutamide resistance, such as Notch141, EPHB442, Wnt/β-Catenin43, non-canonical Wnt44, EZH245, and HMGCR46. The inhibition of these pathways/molecules could significantly enhance the efficacy of Enzalutamide through cooperative repression on the AR signaling pathway, further emphasizing that targeting AR and AR-Vs is the dominant therapeutic strategy to treat prostate cancer in the clinic. Of note, except for the inhibition of AR transcriptional activity, the protein equilibrium and proteolysis of AR may be a novel direction to treat advanced prostate cancer to date20,47.

PLK1, the best-studied member of the PLK family, is tightly involved in cell cycle regulation, from the mitotic entry to cytokinesis48. Besides its critical role in mitosis, PLK1 participates in multiple cellular processes and contributes to drug resistance48. For instance, the phosphorylation of PLK1 on microtubule plus end-binding proteins, CLIP-170 and p150Gued, promotes the microtubule dynamics and eventually leads to the taxol-resistance in prostate cancer49,50. Besides, the inhibition of PLK1 could enhance the efficacy of multiple inhibitors in the treatment of prostate cancer, such as metformin51, Wnt inhibitor IWR152, PARP inhibitor Olaparib53, and BRD4 inhibitor JQ154. Most importantly, there is a tight correlation between PLK1 and AR signaling in prostate cancer. Through phosphorylating tumor suppressors TSC1 and PTEN, PLK1 induces the activation of mTORC1 and AKT, which could subsequently induce the activity of AR signaling39,40,55,56. Consistently, as shown in Figs. 6A–6C, the overexpression of PLK1 enhances the AR signaling and induces the drug resistance to Dip G treatment. Above all, the prior research supports the notion that PLK1 is a potential target to treat prostate cancer patients.

It is well-established that the ubiquitin-proteasome system is responsible for the proteolysis process, to maintain the proper protein equilibrium required by normal cellular functions47. CHIP E3 ligase is one of the vital molecules to control protein stability and quality, which mediates the degradation of several key oncogenic proteins in collaboration with chaperon proteins20. Particularly, CHIP could induce the proteasome degradation of AR, AR-V7, and PLK1 in the prostate cancer cells, suggesting that CHIP and its chaperon proteins could be valuable targets clinically20,24,26. Interestingly, Dip G, a naturally extracted compound, could mediate the activity of CHIP E3 ligase31. As reported, Dip G mediates the activity of CHIP reciprocally, through destabilizing ERα while stabilizing ERβ, to modulate the ER dynamics and restore the balance between ERα and ERβ, in malignant breast cancers31. Our study demonstrates that Dip G treatment could induce the proteasome degradation of full-length AR and PLK1 in a dosage-dependent manner. Meanwhile, the mRNA level of AR-V7 and its transcriptional activity robustly decreased upon the Dip G treatment, the mechanism of which is still unclear and needs further investigation. Interestingly, the degradation of PLK1 induced by Dip G could further enhance the efficacy of anti-androgens or anti-HSP90 inhibitors. Therefore, the application of Dip G might be an effective approach to treat prostate cancer patients of different stages.

To summarize, our data demonstrate that CHIP E3 ligase is the major modulator in the Dip G-induced proteasome degradation of AR and PLK1. Besides, Dip G could inhibit the AR-V7 and its downstream signaling as well. Additionally, sufficient evidence has shown that Dip G could enhance the blockade of either Enzalutamide or anti-HSP90 inhibitors, suggesting that it might be applicable and valuable in a wide range. Clinically, the PLK1 expression level is closely correlated with the drug resistance, indicating that it may be a potential biomarker to predict the cancer progression and drug resistance.

Experimental procedures

Cell culture and drugs

While LNCaP, 22Rv1, and 293T cells were purchased from ATCC in 2016, C4-2 cells were obtained from M.D. Anderson Cancer Center. MR49F cells were kindly provided by Dr. Amina Zoubeidi at the Vancouver Prostate Cancer Center. The C4-2R cell line was a gift of Dr. Allen Gao at the University of California at Davis. The human prostate cell lines were cultured in RPMI1640 medium supplemented with 10% (v/v) FBS, 100 Units/mL penicillin, and 10 ug/mL streptomycin at 37°C in 5% CO2. 293T cell was maintained in DMEM medium supplemented with 10% (v/v) FBS, 100 Units/mL penicillin, and 10 ug/mL streptomycin at 37°C in 5% CO2. All the cells were within 50 passages and Mycoplasma was detected every 3 months using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, LT07-705). TanespiMycin, Onalespib, Enzalutamide, MG132, and Cycloheximide were obtained from Medchem Express and Diptoindonesin G was kindly provided by Dr. Wei Xu from the University of Wisconsin.

Antibodies

Antibodies against androgen receptor (5153), PARP (9532), GAPDH (5174), cleaved-Caspase 3 (9661), Ki67 (9027), HDAC6 (7558), PSA (5365), Actin (3700), CHIP (2080), Myc (2276), HSP90 (4877), and HA (3724) were purchased from Cell Signaling Technology. While anti-PLK1 (05-844) was obtained from Millipore, antibodies against FLAG (F9291) and Vinculin (V9131) were purchased from Sigma. Anti-GFP (sc-9996) and anti-Ub (sc-8017) antibodies were ordered from Santa Cruz Biotechnology.

Western blot and immunoprecipitation (IP)

For cultured cells, the samples were washed by PBS twice after harvest and then digested with RIPA lysis buffer (Sigma) with protease inhibitors (Sigma) and phosphatase inhibitors (Sigma). For mouse tumor samples, the tumors were sliced into small pieces and then ground using tissue grinders in the RIPA lysis buffer (Sigma). After sonication, lysates were collected, and protein concentrations were measured by Pierce™ BCA Protein Assay Kit (ThermoFisher). For western blot, the proteins from each group were mixed with SDS-PAGE loading and boiled for 5 min. For IP, protein samples were mixed with indicated antibodies and rotated for 4 h at 4 °C. Then agarose beads (Santa Cruz) were added to each sample and incubated at 4 °C overnight. The beads were washed with TBST following manual protocol, mixed with SDS-PAGE loading, and boiled for 5 min. Upon transferring to polyvinylidene difluoride membranes, proteins were probed with indicated antibodies. The primary antibodies were diluted in 5% milk in a 1:1000 ratio and incubated at 4°C overnight. Then the membrane was washed 3 times X 5 min with TBST and incubated with diluted second antibodies (1:3000) in the room temperate for 1 h. Before exposure, the membrane was washed 3 times X 5 min with TBST, and then the signal will be detected with the Clarity Western ECL Substrate (BIO-RADs).

Cell viability assay

Cells (2 x 103 −1 x 104 per well) were seeded in 96-well plates, cultured overnight, and treated with different concentrations of drugs. After 72h of incubation, cells were treated with AquaBluer (MultiTarget Pharmaceuticals LLC, # 6015) for 4h at 37°C. Then cells were subjected to a plate reader to measure the fluorescence intensity at 540ex/590em. The IC50 values were obtained from the average viability curves generated by four independent measurements of each condition.

Cell growth assay

Cells (1000-5000/well) were seeded in 96-well plates and cultured in medium alone or containing the different drugs. The cell viability was measured every day using Aquabluer MultiTarget Pharmaceuticals LLC, # 6015) for 4h at 37°C. Then cells were subjected to a plate reader to measure the fluorescence intensity at 540ex/590em.

Colony formation assay

Cells (500-5000/well) were seeded in 6-well plates and cultured in medium alone or containing different drugs for 14 days, with the medium change every 2 days. After culturing, cells were fixed in 10% formalin and stained with 0.5% crystal violet for 30 minutes, followed by counting colony numbers.

Combination index

The combination index (CI) was calculated with the T.C. Chou’s method and their software CompuSyn35–37. The IC50 of the two drugs was measured respectively at first. Subsequently, the two drugs were mixed at the (As)50/(Bs)50 ratio to treat the cells, to get the parameters of (Am)50 and (Bm)50 when the mixture achieves a 50% inhibitory effect. Antagonism is indicated when CI > 1, CI = 1 indicates an additive effect, and CI < 1 indicates synergy.

Lentivirus infection and transfection

After cells were infected with the lentivirus containing the indicated gene for 48h, the cells were suspended and cultured in the fresh media containing puromycin (Sigma, P9620) to generate stable cell lines. The lentivirus was generated using MISSION shRNA from Sigma. Plasmid transfection was performed using jetPrime (Polyplus, 114-15), following the manufacturer’s instructions. pEGFP-C1-AR was a gift of Michael Mancini and was purchased from Addgene (28235). pCMV6-Myc-DDK-CHIP was purchased from Origene (RC200310).

RNA isolation, RNA-seq, and quantitative real-time PCR (qRT-PCR)

After 22Rv1 cells were treated with 10μM Dip G for 24h, cells were harvested, washed twice with cold PBS, followed by total RNA extraction using the RNeasy® mini kit (Qiagen). For RNA-seq, the samples were shipped to Novogene Biotechnology Company (CA, USA) and sequenced via the Illumina platforms. Around 30M reads were generated for each sample. The raw data were mapped to the human transcriptome, quantified, normalized, and differential expression analysis was performed by EdgeR R package. For quantitative real-time PCR, the extracted mRNA was subjected to reverse transcription using the QuantiTect Reverse Transcription Kit (Qiagen), following the manufacturer’s protocol. FastStart Universal SYBR Green Master was used to measure the expression level of indicated mRNA and was normalized to β-actin, respectively. The PCR program for qRT-PCR is 95°C for 10min, and then repeat 40 cycles at 95°C for 15 s and 60°C for 30 s. The primers used in the qRT-PCR are listed below.

Gene Forward Reverse
Full-Length AR 57 TCTTGTCGTCTTCGGAAATGT AAGCCTCTCCTTCCTCCTGTA
AR-V7 57 CAGGGATGACTCTGGGAGAA GCCCTCTAGAGCCCTCATTT
PSA 58 CAGTCTGCGGCGGTGTT GCAAGATCACGCTTTTGTTCCT
NKX3.1 59 GGACTGAGTGAGCCTTTTGC CAGCCAGATTTCTCCTTTGC
TMPRSS2 CCTCTAACTGGTGTGATGGCGT TGCCAGGACTTCCTCTGAGATG
CDC25C 42 GAACAGGCCAAGACTGAAGC GCCCCTGGTTAGAATCTTCCTC
UBE2C 42 GGATTTCTGCCTTCCCTGAATCA GATAGCAGGGCGTGAGGAAC
Actin CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT
Open in a new tab

Gene set enrichment analysis (GSEA)

GSEA software (http://software.broadinstitute.org/gsea/index.jsp) was used to analyze the RNA-seq data60,61. Hallmark gene sets - Androgen response pathway was analyzed62.

22Rv1-derived mouse xenograft model

22Rv1 cells (2.5 x 106 cells/mouse) were mixed with an equal volume of Matrigel (Corning, 356234) and inoculated subcutaneously into the right flank of pre-castrated NSG mice. One week later, animals were randomized into 4 groups. Tanespimycin (10mg/kg, twice a week) and Dip G (10mg/kg daily) were dissolved in 10% DMSO and 90% corn oil and administrated through oral gavage. Tumor volumes were estimated from the formula: V = L x W2/2 [V is volume (mm3); L is length (mm); W is width (mm)]. The experiment was approved by the Institutional Animal Care and Use Committee (IACUC) of University of Kentucky. The protocol No. is 2020-3680.

Histology and H&E staining

Freshly harvested tumors were fixed in 10% neutral buffered formalin, paraffin-embedded, and sectioned to 5 mm by the histology research lab. After paraffin-embedded slides were deparaffinized and rehydrated, the slides were stained with Hematoxylin and Eosin Stain kit (Vector Laboratories, H-3502), and the procedures were performed following the protocol of the kit. The representative images were taken with a Nikon microscope.

Immunofluorescence (IF) and Immunohistochemistry (IHC) staining

After paraffin-embedded slides were deparaffinized and rehydrated, antigens were retrieved in antigen unmasking solution (Vector Laboratories, H-3301-250). Samples were then blocked, incubated with indicated primary antibodies in a 1:200 ratio, followed by incubation with secondary antibodies. For IF staining, the slides were mounted by VECTASHIELD® Antifade Mounting Medium with DAPI (Vector Laboratories, H-1200). For IHC staining, the slides were stained with VECTASTAIN® Elite® ABC Universal Plus kit (Vector Laboratories, PK-8200). The representative images were taken with a Nikon microscope.

Serum prostate-specific antigen (PSA) measurement

After blood was collected from tumor-carrying mice, samples were centrifuged at 5000 rpm for 5 min. The supernatants were collected and serum PSA levels were measured by using a PSA ELISA kit (Sigma, RAB0331) following the manufacturer’s protocol.

Luciferase assay

Luciferase reporter pGL4[luc2P/PSA-long/Hygro] (Promega, CS181504), together with internal control plasmid pRL-TK (Promega, E2241), were transfected into the 22Rv1 or LNCaP cells using jetPrime (Polyplus, 114-15). After 24h transfection, the media were changed and Dip G was added into the fresh media for 48h. Luciferase activity was measured using a Dual-Luciferase reporter assay system (Promega, E1910). The firefly luciferase intensity was normalized by the corresponding Renilla luciferase activities and presented as means ± S.D.

Statistical analysis

Data are presented as mean ± standard derivation of the mean (S.D.). Reproducibility was ensured by performing more than three independent experiments. The statistical significance of the results was analyzed by the two-tailed, unpaired Student’s t-test. The statistical analysis was performed with Prism 7 (GraphPad). A P value of less than 0.05 indicates statistical significance.

Supplementary Material

fS1
fS2

Funding information

NIH R01 CA157429 (X. Liu), R01 CA196634 (X. Liu), R01 CA264652 (X. Liu), R01 CA256893 (X. Liu). This research was also supported by the Biospecimen Procurement & Translational Pathology Shared Resource of the University of Kentucky Markey Cancer Center (P30CA177558).

Footnotes

Disclosure of Potential Conflicts of Interest:

No potential conflicts of interest are disclosed by the authors

Data availability

All data are contained within the article.

References

  • 1.Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer Statistics, 2021. CA: a cancer journal for clinicians. 2021;71(1):7–33. [DOI] [PubMed] [Google Scholar]
  • 2.Heinlein CA, Chang C. Androgen receptor in prostate cancer. Endocr Rev. 2004;25(2):276–308. [DOI] [PubMed] [Google Scholar]
  • 3.Carceles-Cordon M, Kelly WK, Gomella L, Knudsen KE, Rodriguez-Bravo V, Domingo-Domenech J. Cellular rewiring in lethal prostate cancer: the architect of drug resistance. Nat Rev Urol. 2020;17(5):292–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Denmeade SR, Isaacs JT. A history of prostate cancer treatment. Nat Rev Cancer. 2002;2(5):389–396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Beer TM, Armstrong AJ, Rathkopf DE, et al. Enzalutamide in metastatic prostate cancer before chemotherapy. N Engl J Med. 2014;371(5):424–433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Smith MR, Saad F, Chowdhury S, et al. Apalutamide Treatment and Metastasis-free Survival in Prostate Cancer. N Engl J Med. 2018;378(15):1408–1418. [DOI] [PubMed] [Google Scholar]
  • 7.Fizazi K, Scher HI, Molina A, et al. Abiraterone acetate for treatment of metastatic castration-resistant prostate cancer: final overall survival analysis of the COU-AA-301 randomised, double-blind, placebo-controlled phase 3 study. Lancet Oncol. 2012;13(10):983–992. [DOI] [PubMed] [Google Scholar]
  • 8.Ryan CJ, Smith MR, de Bono JS, et al. Abiraterone in metastatic prostate cancer without previous chemotherapy. N Engl J Med. 2013;368(2):138–148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Feng Q, He B. Androgen Receptor Signaling in the Development of Castration-Resistant Prostate Cancer. Front Oncol. 2019;9:858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Visakorpi T, Hyytinen E, Koivisto P, et al. In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat Genet. 1995;9(4):401–406. [DOI] [PubMed] [Google Scholar]
  • 11.Azad AA, Volik SV, Wyatt AW, et al. Androgen Receptor Gene Aberrations in Circulating Cell-Free DNA: Biomarkers of Therapeutic Resistance in Castration-Resistant Prostate Cancer. Clin Cancer Res. 2015;21(10):2315–2324. [DOI] [PubMed] [Google Scholar]
  • 12.LaTulippe E, Satagopan J, Smith A, et al. Comprehensive gene expression analysis of prostate cancer reveals distinct transcriptional programs associated with metastatic disease. Cancer Res. 2002;62(15):4499–4506. [PubMed] [Google Scholar]
  • 13.Waltering KK, Urbanucci A, Visakorpi T. Androgen receptor (AR) aberrations in castration-resistant prostate cancer. Mol Cell Endocrinol. 2012;360(1-2):38–43. [DOI] [PubMed] [Google Scholar]
  • 14.Grasso CS, Wu YM, Robinson DR, et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 2012;487(7406):239–243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.van der Steen T, Tindall DJ, Huang H. Posttranslational modification of the androgen receptor in prostate cancer. Int J Mol Sci. 2013;14(7):14833–14859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hu R, Dunn TA, Wei S, et al. Ligand-independent androgen receptor variants derived from splicing of cryptic exons signify hormone-refractory prostate cancer. Cancer Res. 2009;69(1):16–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Armstrong AJ, Halabi S, Luo J, et al. Prospective Multicenter Validation of Androgen Receptor Splice Variant 7 and Hormone Therapy Resistance in High-Risk Castration-Resistant Prostate Cancer: The PROPHECY Study. J Clin Oncol. 2019;37(13):1120–1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Locke JA, Guns ES, Lubik AA, et al. Androgen levels increase by intratumoral de novo steroidogenesis during progression of castration-resistant prostate cancer. Cancer Res. 2008;68(15):6407–6415. [DOI] [PubMed] [Google Scholar]
  • 19.Fujita K, Nonomura N. Role of Androgen Receptor in Prostate Cancer: A Review. World J Mens Health. 2019;37(3):288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Liu C, Lou W, Yang JC, et al. Proteostasis by STUB1/HSP70 complex controls sensitivity to androgen receptor targeted therapy in advanced prostate cancer. Nat Commun. 2018;9(1):4700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Joshi V, Amanullah A, Upadhyay A, Mishra R, Kumar A, Mishra A. A Decade of Boon or Burden: What Has the CHIP Ever Done for Cellular Protein Quality Control Mechanism Implicated in Neurodegeneration and Aging? Front Mol Neurosci. 2016;9:93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Meimaridou E, Gooljar SB, Chapple JP. From hatching to dispatching: the multiple cellular roles of the Hsp70 molecular chaperone machinery. J Mol Endocrinol. 2009;42(1):1–9. [DOI] [PubMed] [Google Scholar]
  • 23.Li J, Soroka J, Buchner J. The Hsp90 chaperone machinery: conformational dynamics and regulation by co-chaperones. Biochim Biophys Acta. 2012;1823(3):624–635. [DOI] [PubMed] [Google Scholar]
  • 24.Sarkar S, Brautigan DL, Parsons SJ, Larner JM. Androgen receptor degradation by the E3 ligase CHIP modulates mitotic arrest in prostate cancer cells. Oncogene. 2014;33(1):26–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sarkar S, Brautigan DL, Larner JM. Aurora Kinase A Promotes AR Degradation via the E3 Ligase CHIP. Mol Cancer Res. 2017;15(8):1063–1072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen L, Li J, Farah E, et al. Cotargeting HSP90 and Its Client Proteins for Treatment of Prostate Cancer. Mol Cancer Ther. 2016;15(9):2107–2118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Muller P, Hrstka R, Coomber D, Lane DP, Vojtesek B. Chaperone-dependent stabilization and degradation of p53 mutants. Oncogene. 2008;27(24):3371–3383. [DOI] [PubMed] [Google Scholar]
  • 28.Paul I, Ahmed SF, Bhowmik A, Deb S, Ghosh MK. The ubiquitin ligase CHIP regulates c-Myc stability and transcriptional activity. Oncogene. 2013;32(10):1284–1295. [DOI] [PubMed] [Google Scholar]
  • 29.Xu S, Fan L, Jeon HY, et al. p300-Mediated Acetylation of Histone Demethylase JMJD1A Prevents Its Degradation by Ubiquitin Ligase STUB1 and Enhances Its Activity in Prostate Cancer. Cancer Res. 2020;80(15):3074–3087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Juliawaty LD, Sahidin Hakim EH, et al. A 2-arylbenzofuran derivative from Hopea mengarawan. Nat Prod Commun. 2009;4(7):947–950. [PubMed] [Google Scholar]
  • 31.Zhao Z, Wang L, James T, et al. Reciprocal Regulation of ERalpha and ERbeta Stability and Activity by Diptoindonesin G. Chem Biol. 2015;22(12):1608–1621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Gao J, Fan M, Xiang G, et al. Diptoindonesin G promotes ERK-mediated nuclear translocation of p-STAT1 (Ser727) and cell differentiation in AML cells. Cell Death Dis. 2017;8(5):e2765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Fan M, Chen J, Gao J, et al. Triggering a switch from basal- to luminal-like breast cancer subtype by the small-molecule diptoindonesin G via induction of GABARAPL1. Cell Death Dis. 2020;11(8):635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ferraldeschi R, Welti J, Powers MV, et al. Second-Generation HSP90 Inhibitor Onalespib Blocks mRNA Splicing of Androgen Receptor Variant 7 in Prostate Cancer Cells. Cancer Res. 2016;76(9):2731–2742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Chou TC, Martin N. CompuSyn for Drug Combinations: PC Software and User’s Guide: A Computer Program for Quantitation of Synergism and Antagonism in Drug Combinations, and the Determination of IC50 and ED50 and LD50 Values. Paramus NJ: ComboSyn Inc; 2005. [Google Scholar]
  • 36.Chou TC. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res. 2010;70(2):440–446. [DOI] [PubMed] [Google Scholar]
  • 37.Chou TC, Talalay P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul. 1984;22:27–55. [DOI] [PubMed] [Google Scholar]
  • 38.Papo N, Seger D, Makovitzki A, et al. Inhibition of tumor growth and elimination of multiple metastases in human prostate and breast xenografts by systemic inoculation of a host defense-like lytic peptide. Cancer Res. 2006;66(10):5371–5378. [DOI] [PubMed] [Google Scholar]
  • 39.Zhang Z, Hou X, Shao C, et al. Plk1 inhibition enhances the efficacy of androgen signaling blockade in castration-resistant prostate cancer. Cancer Res. 2014;74(22):6635–6647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zhang Z, Chen L, Wang H, Ahmad N, Liu X. Inhibition of Plk1 represses androgen signaling pathway in castration-resistant prostate cancer. Cell Cycle. 2015;14(13):2142–2148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Farah E, Li C, Cheng L, et al. NOTCH signaling is activated in and contributes to resistance in enzalutamide-resistant prostate cancer cells. J Biol Chem. 2019;294(21):8543–8554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Li C, Lanman NA, Kong Y, et al. Inhibition of the erythropoietin-producing receptor EPHB4 antagonizes androgen receptor overexpression and reduces enzalutamide resistance. J Biol Chem. 2020;295(16):5470–5483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Zhang Z, Cheng L, Li J, et al. Inhibition of the Wnt/beta-Catenin Pathway Overcomes Resistance to Enzalutamide in Castration-Resistant Prostate Cancer. Cancer Res. 2018;78(12):3147–3162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Chen X, Liu J, Cheng L, et al. Inhibition of noncanonical Wnt pathway overcomes enzalutamide resistance in castration-resistant prostate cancer. The Prostate. 2020;80(3):256–266. [DOI] [PubMed] [Google Scholar]
  • 45.Bai Y, Zhang Z, Cheng L, et al. Inhibition of enhancer of zeste homolog 2 (EZH2) overcomes enzalutamide resistance in castration-resistant prostate cancer. J Biol Chem. 2019;294(25):9911–9923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Kong Y, Cheng L, Mao F, et al. Inhibition of cholesterol biosynthesis overcomes enzalutamide resistance in castration-resistant prostate cancer (CRPC). J Biol Chem. 2018;293(37):14328–14341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Balch WE, Morimoto RI, Dillin A, Kelly JW. Adapting proteostasis for disease intervention. Science. 2008;319(5865):916–919. [DOI] [PubMed] [Google Scholar]
  • 48.Liu X Targeting Polo-Like Kinases: A Promising Therapeutic Approach for Cancer Treatment. Translational oncology. 2015;8(3):185–195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Li H, Liu XS, Yang X, et al. Phosphorylation of CLIP-170 by Plk1 and CK2 promotes timely formation of kinetochore-microtubule attachments. EMBO J. 2010;29(17):2953–2965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Li H, Liu XS, Yang X, Song B, Wang Y, Liu X. Polo-like kinase 1 phosphorylation of p150Glued facilitates nuclear envelope breakdown during prophase. Proc Natl Acad Sci U S A. 2010;107(33):14633–14638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Shao C, Ahmad N, Hodges K, Kuang S, Ratliff T, Liu X. Inhibition of polo-like kinase 1 (Plk1) enhances the antineoplastic activity of metformin in prostate cancer. J Biol Chem. 2015;290(4):2024–2033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Li J, Karki A, Hodges KB, et al. Cotargeting Polo-Like Kinase 1 and the Wnt/beta-Catenin Signaling Pathway in Castration-Resistant Prostate Cancer. Molecular and cellular biology. 2015;35(24):4185–4198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Li J, Wang R, Kong Y, et al. Targeting Plk1 to Enhance Efficacy of Olaparib in Castration-Resistant Prostate Cancer. Mol Cancer Ther. 2017;16(3):469–479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Mao F, Li J, Luo Q, et al. Plk1 Inhibition Enhances the Efficacy of BET Epigenetic Reader Blockade in Castration-Resistant Prostate Cancer. Mol Cancer Ther. 2018;17(7):1554–1565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Li Z, Li J, Bi P, et al. Plk1 phosphorylation of PTEN causes a tumor-promoting metabolic state. Molecular and cellular biology. 2014;34(19):3642–3661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Li Z, Kong Y, Song L, et al. Plk1-Mediated Phosphorylation of TSC1 Enhances the Efficacy of Rapamycin. Cancer Res. 2018;78(11):2864–2875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Liu LL, Xie N, Sun S, Plymate S, Mostaghel E, Dong X. Mechanisms of the androgen receptor splicing in prostate cancer cells. Oncogene. 2014;33(24):3140–3150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Yates DR, Roupret M, Drouin SJ, et al. Quantitative RT-PCR analysis of PSA and prostate-specific membrane antigen mRNA to detect circulating tumor cells improves recurrence-free survival nomogram prediction after radical prostatectomy. The Prostate. 2012;72(12):1382–1388. [DOI] [PubMed] [Google Scholar]
  • 59.Lin Z, Peng R, Li Z, et al. 17-ABAG, a novel geldanamycin derivative, inhibits LNCaP-cell proliferation through heat shock protein 90 inhibition. Int J Mol Med. 2015;36(2):424–432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Subramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102(43):15545–15550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Mootha VK, Lindgren CM, Eriksson KF, et al. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet. 2003;34(3):267–273. [DOI] [PubMed] [Google Scholar]
  • 62.Liberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1(6):417–425. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

fS1
NIHMS1789684-supplement-fS1.tif (1.8MB, tif)
fS2
NIHMS1789684-supplement-fS2.tif (1.9MB, tif)

Data Availability Statement

All data are contained within the article.

RESOURCES