ABSTRACT
We retrospectively investigated 326 samples that were collected from goose farms in Hainan Province, China, in 2017. A total of 33 carbapenem-resistant Klebsiella pneumoniae (CRKP) isolates were identified from 326 samples, and the 33 CRKP isolates were characterized based on whole-genome sequencing (WGS) data from the Illumina and Oxford Nanopore Technologies (ONT) platforms. All of these 33 CRKP isolates possessed blaNDM-5, and a single isolate coharbored mcr-1 and blaNDM-5, while 4 isolates carried multiple virulence and metal tolerance gene clusters. One CRKP strain (CMG-35-2) was selected for long sequence reading. A hybrid plasmid carrying the virulence, resistance, and metal resistance gene in the strain was found. It possessed 2 backbones [IncFIB(K)-IncFII(K)] within a single plasmid that were closely related to K. pneumoniae plasmids from a human-associated habitat in the United States and from a human isolate in Hong Kong. A mouse abdominal infection model indicated that that strain was of the moderate virulence phenotype. This study revealed that K. pneumoniae on goose farms is an important reservoir for blaNDM-5 and these bacteria are represented by a diversity of sequence types. The heterozygous multiple drug resistance genes carried on plasmids highlighted the genetic complexity of CRKP and the urgent need for continued active surveillance.
IMPORTANCE CRKP is one of the most important pathogens, which can cause infection not only in humans but also in waterfowl. The discovery of blaNDM-5-producing K. pneumoniae in waterfowl farms in recent years suggests that waterfowl are an important reservoir for blaNDM-5-producing Enterobacteriaceae. However, there are few studies on the spread of blaNDM-5-producing bacteria in waterfowl farms. Our study showed that the IncX3 plasmid carrying blaNDM-5 in goose farms is widely present in K. pneumoniae isolates and a large number of resistance genes are accumulated in it. We found a transferable IncFIB-FII hybrid plasmid that combines virulence, resistance, and metal resistance genes, which allow transfer of these traits between bacteria in different regions. The results of this study contribute to a better understanding of the prevalence and transmission of carbapenem-resistant K. pneumoniae in goose farms.
KEYWORDS: Klebsiella pneumoniae, heterozygous plasmids, blaNDM-5 carbapenemase, virulence genes, multidrug resistant, multidrug resistance
INTRODUCTION
Klebsiella pneumoniae has emerged as an important cause of antimicrobial-resistant infections in humans, livestock, and wildlife as well as pets, insects, and the environment (1). Some strains can cause invasive infections and are termed hypervirulent K. pneumoniae (hvKP), especially the emergence of carbapenem-resistant hypervirulent K. pneumoniae (CP-hvKP), which has increasingly caused serious global public health concern (2). They have been found in different sequence types (STs) of K. pneumoniae, including ST11 (3), ST25 and ST65 (4), ST29 (5), and ST36 (6). This suggests that these conjugative plasmids are able to rapidly adapt and coexist in genetically distinct strains (7, 8). So far, metal-β-lactamase (NDM)-producing K. pneumoniae has been found in livestock and poultry production. However, there are few reports about NDM-producing K. pneumoniae in goose farms. In previous reports, many studies have reported that blaNDM-5 was widespread in waterfowl, especially in waterfowl breeding provinces in China (9–11). That may indicate that blaNDM−5 was widely distributed among Enterobacteriaceae in poultry farms (12).
In the current study, we retrospectively investigated the prevalence of blaNDM-5 and virulence of K. pneumoniae isolated from waterfowl breeding farms in Hainan province. We verified the virulence phenotype of one strain and discovered the presence of hybrid plasmids of environmental and human origin in these strains that were taken from the animals. The emergence of such hybrid plasmids may further lead to the dissemination of these plasmid types between humans and animals, posing a grave threat to public health.
RESULTS AND DISCUSSION
Bacterial isolation and detection of carbapenemase genes.
Hainan Island is the southernmost provincial administrative unit in China, with a total land area of 35,400 square kilometers. It is one of the important waterfowl farming provinces in coastal cities. Hainan Island's waterfowl industry is estimated to be worth $0.39 million, according to an unpublished survey report in 2018, making it an ideal location to study the prevalence of carbapenem-resistant Enterobacteriaceae (CRE) among waterfowl (13).
For sample collection, the feces were randomly collected from the goose farm by the five-point method, the water was collected from the sewage outlet, and the swabs were collected from the healthy-looking geese. We collected 326 samples from goose farms in Hainan province that included 190 feces samples, 28 water samples, 25 soil samples, 60 nose and 3 anal swabs, and 20 dust samples, and CRKP was identified in 33 of these. MIC tests indicated that these 33 K. pneumoniae isolates were multidrug resistant (MDR) to carbapenems (meropenem, imipenem, and ertapenem) as well as cefotaxime, fosfomycin, ciprofloxacin, gentamicin, trimethoprim-sulfamethoxazole, florfenicol, ceftazidime, tetracycline, colistin, and cefoxitin (with a few exceptions) (Table 1). However, only two strains were resistant to amikacin and four were resistant to tigecycline (see Table S1 in the supplemental material).
TABLE 1.
Characteristics of 33 blaNDM-5-producing K. pneumoniae isolates from geese in Hainan province, China, in May 2017
| Strain | Source | Other resistance phenotypesa | Major resistance genes |
|---|---|---|---|
| CMG-1-1 | Goose | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-1-2 | Goose | CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | mcr-1, blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-5-2 | Goose | CTX, CS, CAZ, CIP, SXT, FFC, TET, FOS | blaNDM-5, aadA, oqxAB, tet |
| CMG-7-1 | Goose | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-7-2h | Goose | GEN, CTX, CS, TIG, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, aadA, oqxAB, tet |
| CMG-8-2 | Goose | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-11-1 | Goose | GEN, CTX, FOS, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-11-2 | Goose | GEN, CTX, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-12-2 | Goose | GEN, CTX, FOS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-12-3 | Goose | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-20-1 | Goose | CTX, CS, TIG, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-21-1 | Goose | CTX, FOS, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-22-1 | Goose | CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-22-3 | Goose | AMK, GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-24-2 | Goose | CTX, CS, TIG, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-26-3 | Goose | CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-27-1 | Goose | GEN, CTX, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-28-1 | Goose | GEN, CTX, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-28-2 | Goose | CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-29-2 | Goose | GEN, CTX, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-30-1 | Goose | CTX, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-30-2 | Goose | GEN, CTX, CAZ, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-30-3 | Goose | GEN, CTX, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-32-1 | Goose | GEN, CTX, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMG-33-1 | Goose | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, aadA, oqxAB, tet |
| CMG-33-2 | Goose | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB |
| CMG-34-2 | Goose | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMGW-2-1 | Goose | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMGW-3-3 | Water | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMGW-5-2 | Water | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMGS-1-1 | Soil | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
| CMGS-3-2 | Soil | AMK, GEN, CTX, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, aadA, oqxAB, tet |
| CMGS-5-3 | Soil | GEN, CTX, CS, CAZ, CIP, SXT, FFC, TET, FOX, FOS | blaNDM-5, blaCTX-M, aadA, oqxAB, tet |
SXT, trimethoprim-sulfamethoxazole; FFC, florfenicol; GEN, gentamicin; AMK, amikacin; CTX, cefotaxime; CAZ, ceftazidime; TET, tetracycline; FOX, cefoxitin; CIP, ciprofloxacin; FOS, fosfomycin; CS, colistin; TIG, tigecycline. Other resistance phenotypes included meropenem, imipenem, and ertapenem, to which all 33 isolates were resistant.
Phylogenetic analysis of blaNDM-5-positive K. pneumoniae.
We established a phylogenetic tree of the 33 blaNDM-5-positive K. pneumoniae isolates to determine relatedness using the core genome single nucleotide polymorphisms (SNPs) and identified 11 different sequence types (STs). In particular, ST11 isolates from goose (CMG-33-1) and sewage (CMG-3-2) shared 145 SNPs with isolates (GCA_000349285.2 and GCA_000364385.3) from hospitalized patients with urinary tract infection in the United States (Fig. 1). The spread of ST11 K. pneumoniae between humans and animals has been reported elsewhere (14) and is associated with elevated risks of antimicrobial treatment failures both in humans and in companion animals (15).
FIG 1.
Phylogenic tree for 33 K. pneumoniae isolates using a midpoint-rooted tree generated from core genomic sequences of the blaNDM-5-positive K. pneumoniae isolates identified in this study and the coexistence of blaNDM-5 and mcr-1 genomes deposited in the NCBI Pathogen database. Colored squares indicate plasmid type (blue), ARGs (green), and virulence factors (red).
We conducted a comprehensive antimicrobial analysis on all of the 33 K. pneumoniae isolates that revealed the presence of the β-lactam resistance genes (blaNDM-5, blaCTX-M-3, blaOKP-B, and blaTEM-1) and other important resistance determinants conferring resistance to quinolones (qnrS1, qnrB, and oqxAB), aminoglycosides (aadA, ant, aph, and aac), fosfomycin (fosA), chloramphenicol-florfenicol (floR), sulfonamides (sul1/2), macrolide [mph(A)], rifampicin (arr-3), tetracycline [tet(A)], and trimethoprim (dfrA27 and dfrA1). This analysis indicated that blaNDM-5 could spread between different STs and that the genetic makeup of blaNDM-5-containing strains was diverse. Despite a national ban on the use of carbapenems in livestock and poultry, the discovery of blaNDM in goose farms, along with a large number of other resistance genes, suggests that inappropriate drug use may be occurring locally. To reduce the occurrence of carbapenemases, the government may implement a policy that includes serious investigation of farms where carbapenemases are frequently found and the rationality of their drug use. Interestingly, all but one of these 33 strains carried IncX3 and Inc-F replicons, indicating the prevalence of K. pneumoniae carrying blaNDM-5 and MDR, which may be due to the wide spread of these resistome genes in goose farms via the water system, which is consistent with previous reports (11), and the use of β-lactams for treatment may promote the dissemination of the blaNDM gene (9). Unfortunately, we lack evidence of drug use in local goose farms.
We also identified a single strain (CMG-1-2) that harbored a blaNDM-5- and an mcr-1-bearing plasmid (see Fig. S1 in the supplemental material). This pattern of plasmid coexistence was previously reported in Escherichia coli and K. pneumoniae clinical strains (16, 17). mcr and NDM antimicrobial resistance genes (ARGs) confer resistance to colistins and carbapenems, which are antimicrobials often used as a last resort in hospitals (18).
Genomic characteristics of blaNDM-5-bearing plasmids.
All of our group of blaNDM-5-positive isolates were successfully transferred to E. coli strain C600str by conjugation. Since the first discovery of blaNDM-5 in China in 2014, blaNDM-5 has been identified in a variety of Enterobacteriaceae that carry blaNDM-5 on IncX3 plasmids (19). In 32 of our 33 isolates, this gene was also present on IncX3 plasmids. We found a total of 6 genomic contexts (types I to VI) in the 33 blaNDM-carrying K. pneumoniae isolates. All the type I, IV, and V contexts were novel and not represented in the GenBank database. However, the core sequence for these 33 strains, tat-trpF-blaMBL-blaNDM-5, was unchanged and was nearly identical to that of a blaNDM-5-carrying plasmid isolated from other carbapenem-resistant Enterobacteriaceae (20). The type I arrangement was IS30-IS91-orf-IS30 and was inserted upstream of InsH6. However, the type III context revealed deletion of IS30, indicating that this insertion sequence (IS) possessed active and transferable characteristics. In the type IV contexts, the tet genes carried by IS256 and IS701 were inserted downstream of InsH6 [IS256-tet(M)-IS701]. A comparison with a previous isolate, BA10835_pIncFII (NZ_CP053768), indicated that the IS6 that was located upstream of the type V blaNDM-5 was replaced by two IS91 elements (Fig. 2).
FIG 2.
Genomic alignments of the blaNDM-5 gene from environmental isolates from the NCBI database generated using Easyfig. Regions of homology are marked by shading. Arrows indicate orientations of open reading frames.
MDR and virulence hybrid plasmids.
In our group of K. pneumoniae isolates, 4 (CMG-35-2, CMG-34-2, CMGS-1-1, and CMGW-2-1) displayed the hypermucoviscosity phenotype and possessed string lengths of >50 mm (see Fig. S3). All 4 were grouped in the same cluster (ST734) and were isolated from the same farm, although the sample types differed and included feces, water, and soil. We selected CMG-35-2 for long-range whole-genome sequencing (WGS) analysis and found that it contained 3 plasmids. The blaNDM-5 gene was contained within pCMG-35-2-IncX3 (46,161 bp, 47% GC), which possessed 49 open reading frames (ORFs). This is the first report of an IncX3 plasmid carrying blaNDM-5 in an ST734 strain, although IncX3 plasmids are frequently found in K. pneumoniae (14). The second plasmid, pCMG35-2-IncFIA (66,391 bp, 47% GC), was 80% identical to IncFIA plasmid pKPN-b0b (accession number NZ_CP007736) and lacked any known ARGs. The third plasmid was a novel IncFIB(K)-IncFII(K) hybrid conjugative plasmid, pCMG-35-2-350kb (350 kb, 52% GC), and possessed 2 backbones (119 and 140 kb) that were closely related to the K. pneumoniae plasmids pKPN-332 (NZ_CP014763) (65% query coverage and 99.24% identity), from a human-associated habitat in the United States, and pHKU49-CIP (NZ_MN543570) (99% query coverage and 99.17% identity), from a human isolate in Hong Kong (Fig. 3).
FIG 3.
Alignments with highly homologous sequences available in NCBI and generation of plasmid maps were performed with BRIG (a) and Easyfig (b). Regions of homology are marked by shading. Arrows indicate orientations of open reading frames.
The backbone region of pCMG-35-2-350kb was flanked by two variable regions carrying a large number of mobile genetic elements including IS1 (4), IS2 (4), IS3 (3), IS5 (6), IS6 (1), IS66 (4), IS110 (1), IS1202 (1), ISL3 (1), and ISH (1). The 200-kb fragment IncFII(K) of pCMG-35-2-350kb contained a large MDR region (41,178 bp) containing 10 ARGs flanked by IS6 and associated tra genes. The IncFII(K) portion of the plasmid included the pMG-35-2-350kb 119-kb backbone region and primarily carried heavy metal resistance genes (MRGs) including silAEP, cosBCFRS, copCDG, and pcoABESR and the type III pilus (mrkABCDFJ) virulence factor that were flanked by IS911 and IS1 elements (Fig. 3). MRG presence is an indication of soil and water contamination by heavy metals such as zinc and copper that are regularly used as feed supplements for waterfowl (21, 22). MDR and virulent K. pneumoniae coharboring MRGs in aquatic environments have also been reported (23, 24). In addition, MDR K. pneumoniae strains carrying MRGs have already been reported in human and animal samples, although their coexistence on plasmids is still rare (25, 26). Therefore, in the natural environment, fusion of plasmids carrying multiple functions can occur in environments possessing multiple selection pressures and, in the present case, was a facilitating factor for the fusion between environmental and human-derived isolates. This process would also facilitate the spread of such hybrids between humans and animals.
Virulence phenotype and genotype.
We further assessed virulence phenotypes of our isolates using mouse lethality assays. A random strain (CMG-35-2), one of the four suspected strains with a high hypermucoviscosity phenotype mentioned above, was selected for study in a mouse virulence model. The group receiving 108 CFU per mouse had 50% mortality after 24 h, and low (ATCC 700603)- and high (VH1-2)-virulence control strains displayed 100% and 0% survival at 120 and 12 h, respectively. Infection of mice with 107 CFU of VH1-2, CMG-35-2, and ATCC 700603 led to 100, 0, and 0% mortality at 18, 120, and 120 h, respectively (see Fig. S2). These data demonstrated that CMG-35-2 was of lower virulence than the control VH1-2 strain but still more virulent than the standard negative-control strain.
The strain CMG-35-2 contained 7 known virulence factors including genes for enterobactin synthesis and transport (entABCDE, fepABCDG, fes), type I fimbriae (fimABCDEFGHI), allantoin utilization (allABCDRS), type 3 fimbriae (mrkABCDEFHIK), drug efflux (AcrAB), capsule synthesis (rcsAB, manBC, ugd, galf, wzi, and cpsACP), and a type VI secretion system (yag/ecp). Interestingly, our virulence tests above indicated a moderate virulence phenotype. One possible reason for this was the absence of the genes peg-344 (drug permease), iroB (enterobactin glucosylation), iucA (aerobactin synthesis), and rmpA/A2 (capsule synthesis) (27) in this strain.
Conclusions.
In summary, these blaNDM-5-positive K. pneumoniae strains represented 11 different STs including one new ST (ST734) and 10 unknown STs, and this reflected the host diversity of the plasmids carrying blaNDM-5. The long sequence reading revealed that the MDR plasmid we found contained two regions. Each region is enclosed by multiple movement elements, including IS1, IS2, IS3, IS5, IS6, IS66, IS110, IS1202, ISL3, and ISH. These results suggest that pCMG-35-2-350kb probably formed through the integration of the IncFII(K) plasmid into the IncFIB(K) plasmid backbones mediated by these mobile elements. One plasmid originated in a human-associated habitat in the United States, and the other was a from human clinical isolate in Hong Kong. The spread of hybrid plasmids from environmental and human sources to animal sources suggests that MDR is expanding its reservoir of resistance genes. However, the emergence of such highly plastic plasmids has made it possible for MDR, MRGs, and type 3 pili to spread between humans and animals. The transfer of virulence genes to plasmids has been reported, but this still does not receive enough attention in the veterinary clinic and there exists the possibility of transfer to humans. This is a potential threat to clinical treatments, and enhanced surveillance efforts are thus warranted to monitor and control the spread of these hybrid plasmids.
MATERIALS AND METHODS
Bacterial isolation, identification, and antimicrobial susceptibility.
Fresh fecal, water, and soil samples were collected from goose farms in Hainan province, China. Samples were spread plated on MacConkey agar in the presence of 2 mg/L meropenem incubated for 18 h at 37°C. K. pneumoniae isolates were identified by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry (Shimadzu-Biotech, Kyoto, Japan) and 16S rRNA sequencing. Carbapenemase-producing isolates were verified using the Carba NP test (28). PCR amplification was used to determine the presence of the carbapenemase genes including blaNDM, blaIMP, blaVIM, blaKPC, and blaOXA as previously described (primers are shown in Table 2) (29, 30).
TABLE 2.
PCR primers used in this study
| Primera | Sequence (5′–3′) | Gene | Size (bp) | Reference |
|---|---|---|---|---|
| IMP-Fb | ATGAGCAAGTTATCTTAGTATTC | bla IMP | 765 | 43 |
| IMP-Rb | GCTGCAACGACTTGTTAG | |||
| VIM-F | GATGGTGTTTGGTCGCATA | bla VIM | 390 | 44 |
| VIM-R | CGAATGCGCAGCACCAG | |||
| NDM-F | GGTTTGGCGATCTGGTTTTC | bla NDM | 621 | 44 |
| NDM-R | CGGAATGGCTCATCACGATC | |||
| KPC-F | CGTCTAGTTCTGCTGTCTTG | bla KPC | 798 | 44 |
| KPC-R | CTTGTCATCCTTGTTAGGCG | |||
| OXA-F | GCGTGGTTAAGGATGAACAC | bla OXA-48 | 438 | 44 |
| OXA-R | CATCAAGTTCAACCCAACCG |
F, sense primer; R, antisense primer.
Primers used for PCR product sequencing.
MIC testing of all K. pneumoniae isolates was performed with amikacin, gentamicin, meropenem, imipenem, ertapenem, cefotaxime, fosfomycin, colistin, tigecycline, cefotaxime, ciprofloxacin, trimethoprim-sulfamethoxazole, florfenicol, tetracycline, and cefoxitin, and E. coli ATCC 25922 served as the quality control. Antimicrobial susceptibility was interpreted using both CLSI and EUCAST guidelines (31, 32).
S1-PFGE and Southern blotting.
The presence of blaNDM-5-harboring plasmids in K. pneumoniae isolates was determined using S1 nuclease pulsed-field gel electrophoresis (PFGE) and Southern blotting (33). In brief, genomic DNA was digested with S1 nuclease in situ and electrophoresis conditions were used as previously described (34). Southern blotting was performed on the S1-PFGE gel using digoxigenin-labeled DNA probes specific for blaNDM-5 and the colistin resistance gene mcr-1 (except for CMG-1-2, other data in Fig. S2 in the supplemental material mentioned below are not included in this study).
Conjugation assays.
The transferability of blaNDM-5 in K. pneumoniae isolates was tested with conjugation experiments using E. coli C600str as the recipient strain. Transconjugants were selected on MacConkey agar plates supplemented with 1 mg/L meropenem and 1,500 mg/L streptomycin. Transconjugants were confirmed by PCR as previously described (35).
WGS.
K. pneumoniae isolates were subjected to whole-genome sequencing (WGS) using the Illumina MiSeq system (Illumina, San Diego, CA, USA), and paired-end Illumina reads were assembled using SPAdes v3.6.2 (36). The ftp://ftp.ncbi.nlm.nih.gov/genomes/ database was used for whole-genome comparisons of WGS data. Multilocus sequence types (MLSTs) were analyzed using the online database (https://cge.cbs.dtu.dk/services/MLST/). ResFinder (https://cge.cbs.dtu.dk/services/ResFinder/) was used for ARG identification. PlasmidFinder (https://cge.cbs.dtu.dk/services/PlasmidFinder/) was used to identify plasmid incompatibility types. The virulence factor database VFDB (http://www.mgc.ac.cn/VFs/main.htm) was used to identify virulence factors. Single nucleotide polymorphism (SNP) assignments were determined using Snippy v4.4.5 (https://github.com/tseemann/snippy), and Snippy-core was used to determine core SNPs. RAxML v8.2.12 was the source for general time reversible substitution with gamma-distributed rate variation (GTRGAMMA) models and was used to construct the tree that was visualized using FigTree v1.4.2 and iTOL v4 (37, 38). Potentially recombinant SNP clusters (>5 SNPs per kb) and SNPs located on poorly assembled contigs were excluded. The public database for K. pneumoniae is at ftp://ftp.ncbi.nlm.nih.gov/genomes/.
Virulence phenotypes.
The string test was used to identify the hypermucoviscous phenotype, and the virulence of the K. pneumoniae strain was tested in mice using the abdominal infection model as previously described (39, 40). The hvKP strain VH1-2 (41) and avirulent strain ATCC 700603 served as positive and negative controls, respectively.
Briefly, male NIH mice 4 weeks old were randomly allocated into different groups, with 10 mice per group, and intraperitoneally injected with bacterial suspensions at 1 × 107 and 1 × 108 CFU of each K. pneumoniae strain in 0.1 mL phosphate-buffered saline (PBS) as previously described (42). Mortality was observed over the next 120 h. Animal experiments were repeated at least twice to determine data consistency. Survival curves were generated using Prism 7 (GraphPad, San Diego, CA, USA). All animal experiments were approved by the South China Agriculture University animal ethics committee.
Ethics statement.
This mouse study was approved by the Institutional Review Board of South China Agricultural University (SCAU-IRB) (ID: 2020C023). All experiments were conducted in full compliance with the guidelines of Guangdong Laboratory Animal Welfare and Ethics and the Institutional Animal Care and Use Committee of the South China Agricultural University.
Data availability.
All WGS data have been deposited in the NCBI BioProject database under accession no. PRJNA752932.
ACKNOWLEDGMENTS
This work was jointly supported by Innovation Team Project of Guangdong University (grant no. 2019KCXTD001), Local Innovative and Research Teams Project of Guangdong Pearl River Talents Program (grant no. 2019BT02N054), and Program for Changjiang Scholars and Innovative Research Team in University of Ministry of Education of China (grant no. IRT_17R39).
The authors declare no conflict of interest.
Author contributions were as follows: S.B., conceptualization, data curation, formal analysis, investigation, visualization, writing - original draft; Y.Y., J.S. and Y.L., conceptualization, data curation, review and editing; X.K., X.Li, M.W., and R.S., lab assistance, investigation; X.Liao, project administration, resources, writing - review and edit.
We thank Da-Tong Cai and Si-Lin Zheng for lab assistance and help with investigation.
Footnotes
Supplemental material is available online only.
Contributor Information
Xiaoping Liao, Email: xpliao@scau.edu.cn.
Christopher A. Elkins, Centers for Disease Control and Prevention
REFERENCES
- 1.Logan LK, Weinstein RA. 2017. The epidemiology of carbapenem-resistant Enterobacteriaceae: the impact and evolution of a global menace. J Infect Dis 215:S28–S36. 10.1093/infdis/jiw282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Zhang Y, Zeng J, Liu W, Zhao F, Hu Z, Zhao C, Wang Q, Wang X, Chen H, Li H, Zhang F, Li S, Cao B, Wang H. 2015. Emergence of a hypervirulent carbapenem-resistant Klebsiella pneumoniae isolate from clinical infections in China. J Infect 71:553–560. 10.1016/j.jinf.2015.07.010. [DOI] [PubMed] [Google Scholar]
- 3.Gu D, Dong N, Zheng Z, Lin D, Huang M, Wang L, Chan EW-C, Shu L, Yu J, Zhang R, Chen S. 2018. A fatal outbreak of ST11 carbapenem-resistant hypervirulent Klebsiella pneumoniae in a Chinese hospital: a molecular epidemiological study. Lancet Infect Dis 18:37–46. 10.1016/S1473-3099(17)30489-9. [DOI] [PubMed] [Google Scholar]
- 4.Yao B, Xiao X, Wang F, Zhou L, Zhang X, Zhang J. 2015. Clinical and molecular characteristics of multi-clone carbapenem-resistant hypervirulent (hypermucoviscous) Klebsiella pneumoniae isolates in a tertiary hospital in Beijing, China. Int J Infect Dis 37:107–112. 10.1016/j.ijid.2015.06.023. [DOI] [PubMed] [Google Scholar]
- 5.Yuan Y, Li Y, Wang G, Li C, Chang Y-F, Chen W, Nian S, Mao Y, Zhang J, Zhong F, Zhang L. 2019. blaNDM-5 carried by a hypervirulent Klebsiella pneumoniae with sequence type 29. Antimicrob Resist Infect Control 8:140. 10.1186/s13756-019-0596-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Feng Y, Lu Y, Yao Z, Zong Z. 2018. Carbapenem-resistant hypervirulent Klebsiella pneumoniae of sequence type 36. Antimicrob Agents Chemother 62:e02644-17. 10.1128/AAC.02644-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Tsui CKM, Sundararaju S, Mana HA, Hasan MR, Tang P, Perez-Lopez A. 2020. Plasmid-mediated colistin resistance encoded by mcr-1 gene in Escherichia coli co-carrying blaCTX-M-15 and blaNDM-1 genes in pediatric patients in Qatar. J Glob Antimicrob Resist 22:662–663. 10.1016/j.jgar.2020.06.029. [DOI] [PubMed] [Google Scholar]
- 8.Tian X, Fang R, Wu Q, Zheng X, Zhao Y, Dong G, Wang C, Zhou T, Cao J. 2020. Emergence of a multidrug-resistant ST 27 Escherichia coli co-harboring blaNDM-1, mcr-1, and fosA3 from a patient in China. J Antibiot (Tokyo) 73:636–641. 10.1038/s41429-020-0306-5. [DOI] [PubMed] [Google Scholar]
- 9.Ma Z, Liu J, Yang J, Zhang X, Chen L, Xiong W, Zeng Z. 2020. Emergence of blaNDM-carrying IncX3 plasmid in Klebsiella pneumoniae and Klebsiella quasipneumoniae from duck farms in Guangdong Province, China. J Glob Antimicrob Resist 22:703–705. 10.1016/j.jgar.2020.07.001. [DOI] [PubMed] [Google Scholar]
- 10.Cen DJ, Sun RY, Mai JL, Jiang YW, Wang D, Guo WY, Jiang Q, Zhang H, Zhang JF, Zhang RM, Sun J, Liao XP, Liu YH, Fang LX. 2021. Occurrence and transmission of blaNDM-carrying Enterobacteriaceae from geese and the surrounding environment on a commercial goose farm. Appl Environ Microbiol 87:e00087-21. 10.1128/AEM.00087-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Liu Z, Xiao X, Li Y, Liu Y, Li R, Wang Z. 2019. Emergence of IncX3 plasmid-harboring blaNDM-5 dominated by Escherichia coli ST48 in a goose farm in Jiangsu, China. Front Microbiol 10:2002. 10.3389/fmicb.2019.02002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wang MG, Zhang RM, Wang LL, Sun RY, Bai SC, Han L, Fang LX, Sun J, Liu YH, Liao XP. 2021. Molecular epidemiology of carbapenemase-producing Escherichia coli from duck farms in south-east coastal China. J Antimicrob Chemother 76:322–329. 10.1093/jac/dkaa433. [DOI] [PubMed] [Google Scholar]
- 13.Yang H, Rehman MU, Zhang S, Yang J, Li Y, Gao J, Gu L, Wang M, Jia R, Chen S, Liu M, Zhu D, Zhao X, Wu Y, Yang Q, Huan J, Zhang L, Liu Y, Tian B, Pan L, Cheng X, Cheng A. 2019. High prevalence of CTX-M belonging to ST410 and ST889 among ESBL producing E. coli isolates from waterfowl birds in China’s tropical island, Hainan. Acta Trop 194:30–35. 10.1016/j.actatropica.2019.03.008. [DOI] [PubMed] [Google Scholar]
- 14.Zhang Z, Lei L, Zhang H, Dai H, Song Y, Li L, Wang Y, Xia Z. 2021. Molecular investigation of Klebsiella pneumoniae from clinical companion animals in Beijing, China, 2017-2019. Pathogens 10:271. 10.3390/pathogens10030271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wyres KL, Holt KE. 2016. Klebsiella pneumoniae population genomics and antimicrobial-resistant clones. Trends Microbiol 24:944–956. 10.1016/j.tim.2016.09.007. [DOI] [PubMed] [Google Scholar]
- 16.Du H, Chen L, Tang Y-W, Kreiswirth BN. 2016. Emergence of the mcr-1 colistin resistance gene in carbapenem-resistant Enterobacteriaceae. Lancet Infect Dis 16:287–288. 10.1016/S1473-3099(16)00056-6. [DOI] [PubMed] [Google Scholar]
- 17.Ma K, Feng Y, Liu L, Yao Z, Zong Z. 2020. A cluster of colistin- and carbapenem-resistant Klebsiella pneumoniae carrying blaNDM-1 and mcr-8.2. J Infect Dis 221(Suppl 2):S237–S242. 10.1093/infdis/jiz519. [DOI] [PubMed] [Google Scholar]
- 18.Yu H, Qu F, Shan B, Huang B, Jia W, Chen C, Li A, Miao M, Zhang X, Bao C, Xu Y, Chavda KD, Tang YW, Kreiswirth BN, Du H, Chen L. 2016. Detection of the mcr-1 colistin resistance gene in carbapenem-resistant Enterobacteriaceae from different hospitals in China. Antimicrob Agents Chemother 60:5033–5035. 10.1128/AAC.00440-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Yang P, Xie Y, Feng P, Zong Z. 2014. blaNDM-5 carried by an IncX3 plasmid in Escherichia coli sequence type 167. Antimicrob Agents Chemother 58:7548–7552. 10.1128/AAC.03911-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Shen Z, Hu Y, Sun Q, Hu F, Zhou H, Shu L, Ma T, Shen Y, Wang Y, Li J, Walsh TR, Zhang R, Wang S. 2018. Emerging carriage of NDM-5 and MCR-1 in Escherichia coli from healthy people in multiple regions in China: a cross sectional observational study. EClinicalMedicine 6:11–20. 10.1016/j.eclinm.2018.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Seiler C, Berendonk TU. 2012. Heavy metal driven co-selection of antibiotic resistance in soil and water bodies impacted by agriculture and aquaculture. Front Microbiol 3:399. 10.3389/fmicb.2012.00399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Adamse P, van Egmond HJ, van Polanen A, Bikker P, de Jong J. 2011. Trend analysis of copper and zinc in animal feed. Report. Rikilt–Institute of Food Safety, Wageningen University, Wageningen, Netherlands. https://edepot.wur.nl/185095.
- 23.Furlan JPR, Savazzi EA, Stehling EG. 2020. Genomic insights into multidrug-resistant and hypervirulent Klebsiella pneumoniae co-harboring metal resistance genes in aquatic environments. Ecotoxicol Environ Saf 201:110782. 10.1016/j.ecoenv.2020.110782. [DOI] [PubMed] [Google Scholar]
- 24.van Alen S, Kaspar U, Idelevich EA, Kock R, Becker K. 2018. Increase of zinc resistance in German human derived livestock-associated MRSA between 2000 and 2014. Vet Microbiol 214:7–12. 10.1016/j.vetmic.2017.11.032. [DOI] [PubMed] [Google Scholar]
- 25.Wu F, Ying Y, Yin M, Jiang Y, Wu C, Qian C, Chen Q, Shen K, Cheng C, Zhu L, Li K, Xu T, Bao Q, Lu J. 2019. Molecular characterization of a multidrug-resistant Klebsiella pneumoniae strain R46 isolated from a rabbit. Int J Genomics 2019:5459190. 10.1155/2019/5459190. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Wang L, Fang H, Feng J, Yin Z, Xie X, Zhu X, Wang J, Chen W, Yang R, Du H, Zhou D. 2015. Complete sequences of KPC-2-encoding plasmid p628-KPC and CTX-M-55-encoding p628-CTXM coexisted in Klebsiella pneumoniae. Front Microbiol 6:838. 10.3389/fmicb.2015.00838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Russo TA, Olson R, Fang CT, Stoesser N, Miller M, MacDonald U, Hutson A, Barker JH, La Hoz RM, Johnson JR. 2018. Identification of biomarkers for differentiation of hypervirulent Klebsiella pneumoniae from classical K. pneumoniae. J Clin Microbiol 56:e00776-18. 10.1128/JCM.00776-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Jia L, Han L, Cai HX, Cui ZH, Yang RS, Zhang RM, Bai SC, Liu XW, Wei R, Chen L, Liao XP, Liu YH, Li XM, Sun J. 2020. AI-Blue-Carba: a rapid and improved carbapenemase producer detection assay using Blue-Carba with deep learning. Front Microbiol 11:585417. 10.3389/fmicb.2020.585417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Bogaerts P, Rezende de Castro R, de Mendonca R, Huang TD, Denis O, Glupczynski Y. 2013. Validation of carbapenemase and extended-spectrum beta-lactamase multiplex endpoint PCR assays according to ISO 15189. J Antimicrob Chemother 68:1576–1582. 10.1093/jac/dkt065. [DOI] [PubMed] [Google Scholar]
- 30.Ellington MJ, Kistler J, Livermore DM, Woodford N. 2007. Multiplex PCR for rapid detection of genes encoding acquired metallo-beta-lactamases. J Antimicrob Chemother 59:321–322. 10.1093/jac/dkl481. [DOI] [PubMed] [Google Scholar]
- 31.CLSI. 2018. M100-ED28: 2018 performance standards for antimicrobial susceptibility testing, 28th ed. Clinical and Laboratory Standards Institute, Wayne, PA. [Google Scholar]
- 32.EUCAST. 2019. Breakpoint tables for interpretation of MICs and zone diameters. European Committee on Antimicrobial Susceptibility Testing, Växjö, Sweden. [Google Scholar]
- 33.Yang F, Shen C, Zheng X, Liu Y, El-Sayed Ahmed MAE, Zhao Z, Liao K, Shi Y, Guo X, Zhong R, Xu Z, Tian GB. 2019. Plasmid-mediated colistin resistance gene mcr-1 in Escherichia coli and Klebsiella pneumoniae isolated from market retail fruits in Guangzhou, China. Infect Drug Resist 12:385–389. 10.2147/IDR.S194635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33:2233–2239. 10.1128/jcm.33.9.2233-2239.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Sun J, Yang RS, Zhang Q, Feng Y, Fang LX, Xia J, Li L, Lv XY, Duan JH, Liao XP, Liu YH. 2016. Co-transfer of blaNDM-5 and mcr-1 by an IncX3-X4 hybrid plasmid in Escherichia coli. Nat Microbiol 1:16176. 10.1038/nmicrobiol.2016.176. [DOI] [PubMed] [Google Scholar]
- 36.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19:455–477. 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Letunic I, Bork P. 2019. Interactive Tree Of Life (iTOL) v4: recent updates and new developments. Nucleic Acids Res 47:W256–W259. 10.1093/nar/gkz239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688–2690. 10.1093/bioinformatics/btl446. [DOI] [PubMed] [Google Scholar]
- 39.Xie Y, Tian L, Li G, Qu H, Sun J, Liang W, Li X, Wang X, Deng Z, Liu J, Ou H-Y. 2018. Emergence of the third-generation cephalosporin-resistant hypervirulent Klebsiella pneumoniae due to the acquisition of a self-transferable blaDHA-1-carrying plasmid by an ST23 strain. Virulence 9:838–844. 10.1080/21505594.2018.1456229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Yang X, Wai-Chi Chan E, Zhang R, Chen S. 2019. A conjugative plasmid that augments virulence in Klebsiella pneumoniae. Nat Microbiol 4:2039–2043. 10.1038/s41564-019-0566-7. [DOI] [PubMed] [Google Scholar]
- 41.Liu BT, Zhang XY, Wan SW, Hao JJ, Jiang RD, Song FJ. 2018. Characteristics of carbapenem-resistant Enterobacteriaceae in ready-to-eat vegetables in China. Front Microbiol 9:1147. 10.3389/fmicb.2018.01147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Zhang P, Mao D, Gao H, Zheng L, Chen Z, Gao Y, Duan Y, Guo J, Luo Y, Ren H. 2021. Colonization of gut microbiota by plasmid-carrying bacteria is facilitated by evolutionary adaptation to antibiotic treatment. ISME J. 10.1038/s41396-021-01171-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Toleman MA, Biedenbach D, Bennett DM, Jones RN, Walsh TR. 2005. Italian metallo-beta-lactamases: a national problem? Report from the SENTRY Antimicrobial Surveillance Programme. J Antimicrob Chemother 55:61–70. 10.1093/jac/dkh512. [DOI] [PubMed] [Google Scholar]
- 44.Poirel L, Walsh TR, Cuvillier V, Nordmann P. 2011. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 70:119–123. 10.1016/j.diagmicrobio.2010.12.002. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1 to S4 and Table S1. Download aem.02457-21-s0001.pdf, PDF file, 0.7 MB (721.8KB, pdf)
Data Availability Statement
All WGS data have been deposited in the NCBI BioProject database under accession no. PRJNA752932.



