Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Apr 27.
Published in final edited form as: Cell Microbiol. 2020 Dec 22;23(4):e13298. doi: 10.1111/cmi.13298

Cryptosporidium parvum infection induces autophagy in intestinal epithelial cells

Shubha Priyamvada 1, Dulari Jayawardena 1, Jeet Bhalala 1, Anoop Kumar 1, Arivarasu N Anbazhagan 1, Waddah A Alrefai 1,2, Alip Borthakur 3,♣,*, Pradeep K Dudeja 1,2,♣
PMCID: PMC9045210  NIHMSID: NIHMS1649606  PMID: 33237610

Abstract

Autophagy, a process of degradation and recycling of macromolecules and organelles to maintain cellular homeostasis, has also been shown to help eliminate invading pathogens. Conversely, various pathogens including parasites have been shown to modulate/exploit host autophagy facilitating their intracellular infectious cycle. In this regard, Cryptosporidium parvum (CP), a protozoan parasite of small intestine is emerging as a major global health challenge. However, the pathophysiology of cryptosporidiosis is mostly unknown. We have recently demonstrated CP-induced epithelial barrier disruption via decreasing the expression of specific tight junction (TJ) and adherens junction (AJ) proteins such as occludin, claudin-4 and E-cadherin. Therefore, we utilized confluent Caco-2 cell monolayers as in vitro model of intestinal epithelial cells (IECs) to investigate the potential role of autophagy in the pathophysiology of cryptosporidiosis. Autophagy was assessed by increase in the ratio of LC3II (microtubule associated protein 1 light chain 3) to LC3I protein and decrease in p62/SQSTM1 protein levels. CP treatment of Caco-2 cells for 24h induced autophagy with a maximum effect observed with 0.5 x 106 oocyst/well. CP decreased mTOR (mammalian target of rapamycin, a suppressor of autophagy) phosphorylation, suggesting autophagy induction via mTOR inactivation. Measurement of autophagic flux utilizing the lysosomal inhibitor chloroquine (CQ) showed more pronounced increase in LC3II level in cells co-treated with CP+CQ as compared to CP or CQ alone, suggesting that CP-induced increase in LC3II was due to enhanced autophagosome formation rather than impaired lysosomal clearance. CP infection did not alter ATG7, a key autophagy protein. However, the decrease in occludin, claudin-4 and E-cadherin by CP was partially blocked following siRNA silencing of ATG7, suggesting the role of autophagy in CP-induced decrease in these TJ/AJ proteins. Our results provide novel evidence of autophagy induction by CP in host IECs that could alter important host cell processes contributing to the pathophysiology of cryptosporidiosis.

Keywords: Cellular homeostasis, enteric parasite, LC3II, autolysosome, autophagy flux

1. INTRODUCTION

Autophagy is an evolutionarily conserved catabolic recycling pathway in which long-lived cellular proteins and some dysfunctional organelles are degraded by the lysosome to maintain cellular homeostasis (Glick, Barth, & Macleod, 2010; Kaur & Debnath, 2015; Saha, Panigrahi, Patil, & Bhutia, 2018; Yin, Pascual, & Klionsky, 2016). The process of autophagy involving more than 40 proteins is regulated by nutrient availability, and by various stress-sensing signaling pathways. During autophagy, cytoplasmic LC3 protein is lipid conjugated and recruited to the autophagosomes. The autophagosome then fuses with the lysosome to form the autolysosome, where the breakdown of the autophagosome vesicle and its contents occurs (Glick et al., 2010; Kaur & Debnath, 2015; Li, He, & Ma, 2020).

In the intestinal mucosa, autophagy has been shown to play important roles in maintaining anti-microbial defense, epithelial barrier integrity and mucosal immune response (Haq, Grondin, Banskota, & Khan, 2019). Dysregulated autophagy, therefore, could impair intestinal epithelial homeostasis causing various pathological conditions. For example, genome-wide association studies (GWAS) have linked polymorphisms in several autophagy genes to the development of inflammatory bowel diseases (IBD) (Hampe et al., 2007; Iida, Onodera, & Nakase, 2017; Lassen & Xavier, 2018). In addition to the absorptive cells of the intestinal epithelium, recent studies have emphasized critical role of autophagy in the regulation of secretory functions of Paneth and goblet cells (Haq et al., 2019).

In recent years, it has also been widely reported that autophagy plays a critical role in both innate and adaptive immune defense mechanisms against viral, bacterial, and parasitic infections (Choy & Roy, 2013; Deretic, Saitoh, & Akira, 2013; Tao & Drexler, 2020). Autophagy-mediated intracellular pathogen elimination, a process in which invading pathogens are targeted to lysosomes for degradation, has been reported for bacterial species such as Salmonella, Streptococcus, Shigella and Listeria, utilizing both in vitro and in vivo models of infection (Hu et al., 2020; Jo, Yuk, Shin, & Sasakawa, 2013). On the other hand, pathogens may induce autophagy in host IECs or subvert host autophagy to facilitate their own intracellular survival, multiplication, and infectivity in host cells (Escoll, Rolando, & Buchrieser, 2016; Hu et al., 2020; McEwan, 2017; Miller & Celli, 2016; Xiong, Yang, Li, & Wu, 2019). For example, toxin B (TcdB) secreted by the diarrheal pathogen Clostridium difficile has been shown to trigger a strong autophagy response in vitro in IECs to enhance the pathogenic process (He et al., 2017). Similarly, several protozoan parasites have been shown to manipulate host autophagy to their advantage to escape cellular elimination and/or support intracellular survival. Toxoplasma gondii, a protozoan parasite of the Apicomplexa phylum escape lysosomal degradation via induction of host signaling pathways that inhibit fusion of autophagosome with lysosome, the final step of the autophagy process (Muniz-Feliciano et al., 2013; Portillo et al., 2017). Trypanosoma cruzi, another intracellular protozoan parasite that causes Chagas’ disease, also escapes host elimination via inhibition of autolysosome formation in host autophagy (Onizuka et al., 2017).

Cryptosporidium parvum (CP) is a protozoan parasite of the Apicomplexa phylum that infects epithelial cells of the small intestine to cause cryptosporidiosis, a widespread diarrheal disease (Checkley et al., 2015; Gerace, Lo Presti, & Biondo, 2019; Innes, Chalmers, Wells, & Pawlowic, 2020; Ward, 2017). In immunocompetent hosts, CP infection causes self-limiting acute diarrhea. However, in immunosuppressed individuals such as HIV patients, CP infection is known to cause chronic life-threatening diarrhea (Checkley et al., 2015; Gerace et al., 2019; Ward, 2017). The pathophysiology of cryptosporidiosis is mostly unknown limiting the scope for identifying novel targets for intervention. We have recently shown CP-induced dysregulation of intestinal barrier function (Kumar et al., 2018) and ion transport (Kumar et al., 2019), which could be important contributors to CP-induced diarrhea. In the current study, we provide evidence for induction of autophagy in response to CP infection in IECs, which could, via manipulation of host signaling, have an important role in its pathogenesis.

2. RESULTS

2.1. Localization of C. parvum inside Caco-2 cells

Spores of C. parvum (CP) inside Caco-2 cells following 24 h treatment were visualized by direct immunofluorescence labeling of the parasite with Sporo-Glo reagent (Waterborne Inc, New Orleans, LA) as described previously (Kumar et al., 2018). The parasite spores are stained green and wheat germ agglutinin (WGA) stained red demarcates the individual cells (Figure 1). As shown in the Z stack (left panel) and 3D (right panel) images, the parasite is well distributed inside the individual cells of the Caco2 monolayer at 24 h after infection.

Figure 1. Cellular localization of C. parvum at 24 h post infection in Caco-2 monolayes.

Figure 1.

Open in a new tab

Post-confluent Caco-2 cell monolayers grown on 12-well Transwell inserts were treated from apical surface with 0.5 x 106 excysted oocysts of CP for 24 h. Monolayers were washed 3-4 times with 1 x PBS to remove the oocysts that did not enter the cells. Intracellular spores were then detected by direct immunofluorescence labeling with Sporo-Glo reagent. Wheat germ agglutinin (WGA) staining was used to determine the cell boundary. Representative images of 3 independent experiments are shown.

2.2. C. parvum infection increases LC3II/I ratio in Caco-2 cells

LC3 is the mammalian homolog of the yeast autophagy protein Atg8. LC3 is expressed in two post-translationally modified forms, LC3-I and LC3-II. LC3-I is found in the cytosol while LC3-II localizes to autophagosome membranes (Glick et al., 2010; Kabeya et al., 2000). In addition to acting as a marker of autophagosomes, conversion of LC3-I to LC3-II is widely used to demonstrate induction of autophagy. Therefore, we measured LC3II/I ratio in cells infected with CP for 24 h. As shown in Figure 2A, CP infection at a dose of 0.5x106 oocysts/well (24-well plate) for 24 h significantly increased LC3 II/I ratio indicating induction of autophagy, which, however, seemed to decrease at higher doses of the parasite. We also measured LC3II level by immunofluorescence. As shown in Figure 2B, there was substantial increase in LC3II immunostaining following CP infection for 24 h.

Figure 2. C. parvum infection increases LC3II/I ratio in Caco-2 cells.

Figure 2.

Figure 2.

Open in a new tab

(A) Caco-2 cells grown as post-confluent monolayers on 24-well plastic supports were treated with excysted oocysts of CP (0.25-1.0 x 106 sporozoytes/well) for 24 h. Cellular proteins in the lysate (30 μg/sample) from control and treated cells were solubilized in SDS-gel loading buffer and separated on a 4-20% SDS-polyacrylamide gradient gel, transferred onto a PVDF membrane, and probed with anti-LC3 antibodies as described in Methods. GAPDH was used as the internal control. A representative blot of 5 independent experiments is shown (Upper panel). Densitometric analyses of band intensities (lower panel) (**P<0.05 vs. control). (B) Caco-2 Monolayers treated with C. parvum (0.5x106 oocysts/well) from apical surface for 24 h were processed for immunofluorescence staining with LC3B (green) and phalloidin (red). Representative image of 3 independent experiments is shown.

2.3. C. parvum decreases p62 levels

The ubiquitin-associated protein p62, which binds to LC3, is also used to monitor autophagic flux. p62 is a receptor for cargo destined to be degraded by autophagy, including ubiquitinated protein aggregates destined for clearance. The p62 protein binds to ubiquitin as well as to LC3, thereby targeting the autophagosome and facilitating clearance of ubiquitinated proteins. Since p62 is also degraded in the process, decrease in its level indicates progress of autophagy (Bjorkoy et al., 2009). Our current studies also showed significant decrease in p62 protein level (Figure 3) following CP infection for 24 h.

Figure 3. C. parvum infection decreases p62 levels.

Figure 3.

Open in a new tab

Cellular proteins in the lysate (30 μg/sample) from control and CP (0.25-1.0 x 106 sporozoytes/well)-treated Caco-2 cells (24 h) were separated on a 4-20% SDS-polyacrylamide gradient gel and probed with anti-p62 antibody in immunoblotting as described in Methods. GAPDH was used as the internal control. A representative blot of 5 independent experiments is shown (Upper panel). Densitometric analyses of band intensities (lower panel) (**P< 0.05 vs. control; ***P<0.001 vs. control).

2.4. Measurement of autophagy flux

LC3II facilitates autophagosome formation that subsequently fuses with lysosome to degrade the materials inside, degrading LC3-II as well at the same time (Kabeya et al., 2000). Therefore, turnover of LC3-II, rather than levels of LC3-II, is a more precise indicator of progress of autophagy that can be assessed by measuring autophagic flux (difference in LC3II levels in presence and absence of a lysosomal inhibitor). Therefore, we utilized the lysosomal inhibitor chloroquine (CQ) (which is known to inhibit late autophagy by blocking autophagosome-lysosome fusion and autophagosome degradation) (Mauthe et al., 2018; Shintani & Klionsky, 2004) to monitor autophagic flux in the presence or absence of CP infection. As shown in Figure 4 (upper panel), CQ treatment increased LC3II levels (lanes 3,4) compared to their respective controls (lanes 1,2), Further, densitometric analysis and calculation of autophagy flux (difference in LC3II levels in presence and absence of CQ), have shown that (Figure 4, lower panel) autophagy flux (LC3II turnover) was more pronounced in response to CP treatment suggesting that CP-induced increase in LC3II was a consequence of enhanced autophagosome formation rather than impaired lysosomal clearance.

Figure 4. C. parvum effects on autophagy flux.

Figure 4.

Open in a new tab

For measuring autophagy flux, cells were pretreated with the autophagy inhibitor chloroquine (CQ, 20 μM) for 1h or vehicle alone and then co-incubated with CP (0.5x106 oocysts/well, 24 h) for additional 24 h. Cellular proteins in the lysate (30 μg/sample) from each group (control, CP, CQ and CP+CQ) were subjected to SDS-PAGE and probed with LC3 and p62 antibodies. p62 was measured to show that autophagy alters its level but CQ has no effect. GAPDH was used as the internal control. A representative blot of 5 independent experiments is shown (upper panel). Autophagy flux values [LC3II/GAPDH (+CQ) – LC3II/GAPDH (−CQ)] in presence or absence of CP were calculated by densitometric analyses of band intensities (lower panel) (**P<0.05 vs. control).

2.5. C. parvum decreases mTOR phosphorylation

Mammalian target of rapamycin complex 1 (mTORC1) is a key regulator of autophagy. mTOR1 activation, involving phosphorylation at multiple sites, inhibits autophagy, whereas mTOR1 inhibition triggers autophagy. Therefore, we investigated whether CP induces autophagy by decreasing mTOR1 phosphorylation. As shown in Figure 5, CP infection of Caco-2 cells for 24 h significantly decreases phosphor-mTOR with no alterations in the level of total mTOR, suggesting that CP-induced autophagy and that induced by other cellular stresses such as nutrient starvation could proceed via similar mechanisms.

Figure 5. C. parvum decreases mTOR phosphorylation.

Figure 5.

Open in a new tab

Cellular proteins in the lysate (30 μg/sample) from control and CP (0.5 x 106 sporozoytes/well, 24 h)-treated Caco-2 cells were subjected to SDS-PAGE and probed with mTOR and phospho-mTOR antibodies in immunoblotting. A representative blot of 5 independent experiments is shown (Upper panel). Densitometric analyses of band intensities of phosphor-mTOR vs. total mTOR (lower panel) (**P<0.05 vs. control).

2.6. C. parvum-induced autophagy is associated with decreased expression of the TJ proteins occludin, claudin-4 and AJ protein E-cadherin:

Our recent in vitro and in vivo studies have shown that CP infection disrupts intestinal epithelial barrier function via downregulation of key tight junction and adherens junction proteins occludin, claudin-4 and E-cadherin. (Kumar et al., 2018). Our studies further showed that CP-induced downregulation of occludin, a key TJ protein governing epithelial permeability, could be via CP-induced autophagy, as the parasite effects on occludin were abrogated in presence of bafilomycin A, a lysosomal inhibitor. Therefore, we sought to further confirm the role of CP-induced autophagy in the downregulation of expression of these specific TJ/AJ proteins. We measured their protein levels in CP-infected cells following siRNA knockdown of ATG7, a key autophagy protein. As shown in Figure 6A, CP infection in control (scrambled siRNA treated) cells showed significant increase in LC3II/I ratio, suggesting autophagy induction, whereas there was no significant increase in this ratio in ATG7 silenced cells. In parallel (Figure 6B), CP infection significantly downregulated occludin protein level in control (scrambled siRNA treated) cells, but not in cells with siRNA knockdown of ATG7 (causing inhibition of autophagy). These results suggest the potential role of autophagy in CP-induced decrease in occludin protein levels. Involvement of CP-induced autophagy in downregulating occludin is further supported by increased colocalization of occludin with LC3, a marker of autophagosome, in CP-infected cells as compared to uninfected controls (Figure 6E). Similar to the results obtained for occludin (Figure 6B), CP infection significantly downregulated claudin-4 (Figure 6C) and E-cadherin (Figure 6D) protein levels in control (scrambled siRNA treated) cells, but not in ATG7 silenced cells, suggesting the potential role of autophagy in CP-induced decrease in the protein levels of these three key TJ/AJ proteins. However, CP-induced downregulation of the adaptor protein ZO1 did not appear to be via induction of autophagy, as ATG7 silencing (autophagy inhibition) did not alter CP effects on ZO1 expression (data not shown).

Figure 6. C. parvum-induced autophagy is associated with decreased protein levels of occludin, claudin-4 and E-cadherin.

Figure 6.

Figure 6.

Figure 6.

Figure 6.

Figure 6.

Open in a new tab

Autophagy in Caco-2 cells was inhibited by siRNA silencing of ATG7 as described in Methods. Control and ATG7 deficient cells were treated with CP (0.5 x 106 sporozoytes/well, 24 h). Cellular proteins in the lysates from different groups were subjected to SDS-PAGE and probed with the appropriate antibodies. (A) A representative blot showing protein levels of ATG7, LC3I, LC3II in different groups with GAPDH as loading control (upper panel). Densitometric analysis of band intensities of LC3I and II is shown in the lower panel to measure autophagy (LC3II/I ratio) in different groups. (B-D) Representative blots showing protein levels of ATG7 and the corresponding occludin (B), claudin-4 (C) and E-cadherin (D) in different groups with GAPDH as loading control (upper panels). Densitometric analyses of band intensities of occludin (B), claudin-4 (C) and E-cadherin (D) with respect to GAPDH are shown in the lower panels (**P<0.05 treated scrambled siRNA vs. untreated scrambled siRNAcontrol). (E) Immunofluorescence measurement of colocalization of occludin (red) and LC3 II (green) in control and CP infected Caco-2 cells.

3. DISCUSSION

In this study, we have demonstrated induction of autophagy in intestinal epithelial cells in response to infection by Cryptosporidium parvum (CP) that causes cryptosporidiosis, a widespread diarrheal disease. Induction of autophagy in response to pathogen infection plays a critical role in both innate and adaptive immune defense mechanisms against viral, bacterial, and parasitic infections as well as help elimination of the pathogen via lysosomal degradation (Choy & Roy, 2013; Deretic et al., 2013; Hu et al., 2020; Jo et al., 2013). Conversely, via subversion of the host homeostatic autophagy pathway, pathogens not only can escape elimination, but also can exploit the process to the invading pathogen’s own advantage (Choy & Roy, 2013; Deretic et al., 2013; Onizuka et al., 2017; Portillo et al., 2017).

Manipulation of host autophagy to facilitate survival, multiplication and infectivity has been shown as a novel mechanism of infection for various pathogens including the protozoan parasites of the Apicomplexa phylum Toxoplasma gondii (Muniz-Feliciano et al., 2013; Portillo et al., 2017) and Trypanosoma cruzi (Onizuka et al., 2017). Cryptosporidiosis caused by CP infection is increasingly being recognized as a global health problem. However, effective therapeutic development for cryptosporidiosis has been extremely limited because the mechanisms of infection by this parasite that leads to diarrhea are mostly unknown. We have recently shown that CP infection disrupts epithelial barrier function via decreasing the expression of key tight junction proteins, which could be one of the key factors causing this diarrheal disease (Kumar et al., 2018). Data from this recent study also suggested that decrease in the level of occludin, a key TJ protein, could be via parasite-induced protein degradation pathways, such as autophagy. This important observation, together with several earlier studies showing the role of autophagy in the pathogenic mechanisms of other protozoan parasites (Muniz-Feliciano et al., 2013; Onizuka et al., 2017; Portillo et al., 2017), prompted us to examine whether CP induces autophagy in intestinal epithelial cells (IECs). Since CP primarily infects and invades the epithelial cells of the small intestine, we used human intestinal epithelial Caco-2 cells as the in vitro model, that has previously been reported to morphologically and functionally mimic the small intestinal epithelium when grown as post-confluent monolayers (Hidalgo, Raub, & Borchardt, 1989; Pignata, Maggini, Zarrilli, Rea, & Acquaviva, 1994). Our results showed robust induction of autophagy in Caco-2 cells in response to CP infection for 24 h, as assessed by increased LC3II/I ratio and decreased p62. LC3II, which is formed via lipid conjugation of LC3I, is vital for the formation of autophagosome. Although LC3II is considered as the marker of autophagosome formation, however, it is unreasonable to quantify autophagy based on increased LC3II/LC3I ratio alone. Autophagy is a dynamic process, with autophagosomes constantly being formed and degraded via fusion with lysosome. Therefore, increased LC3II/LC3I ratio could have two possible inferences. The increase in LC3II represents more formation of autophagosome signifying induction of autophagy. However, it could also mean decreased or incomplete autophagy due to inhibition of formation and/or degradation of autolysosome by some intrinsic or external factor(s), that will lead to LC3II accumulation. For example, it has been shown that Trypanosoma cruzi, the parasite causing Chagas’ disease, escapes cellular elimination by host autophagy via inhibiting autolysosome formation resulting in accumulation of LC3II (Onizuka et al., 2017). Therefore, to ascertain whether CP-induced autophagy is leading to autolysosome formation, we measured autophagy flux that virtually measures LC3II turnover during autophagy. Autophagy flux is measured by determining the LC3II levels in the presence and absence of a lysosomal inhibitor. We used chloroquine (CQ) that inhibits autophagy via raising the lysosomal pH thereby inhibiting both fusion of autophagosome with lysosome and lysosomal degradation (Mauthe et al., 2018; Shintani & Klionsky, 2004) and measured LC3II levels in response to CP alone or CP+CQ treatments. We obtained similar results under both conditions, indeed, relatively and significantly greater level of LC3II in response to CP+CQ treatments, suggesting that CP-induced increase in LC3II/I ratio was a consequence of enhanced autophagosome formation rather than inhibition of autolysosome formation as shown previously for other parasites ((Onizuka et al., 2017).

There was significant decrease in the level of phosphor-mTOR at 24 h post-infection, suggesting that onset of autophagy by CP occurred via mTOR inactivation, like autophagy induction in response to intrinsic stress signals such as nutrient deprivation. Indeed, pathogen infection itself may cause nutrient deprivation. For example, S. Typhimurium has been shown to rapidly deplete intracellular amino acid pools, resulting in transient inhibition of mTOR and induction of autophagy (Tattoli et al., 2012). However, further studies are needed to understand if CP induction of autophagy is secondary to nutrient depletion by the parasite.

We and others have shown that CP infection causes disruption of intestinal epithelial barrier function (de Sablet et al., 2016; Kumar et al., 2018). We have also shown extensive downregulation of key epithelial tight junction (TJ) and adherens junction (AJ) proteins speculated to contribute to disruption of barrier function (Kumar et al., 2018). While investigating the mechanisms underlying the parasite effects on TJ proteins, we have also speculated the role of protein degradation pathways, such as autophagy, in mediating CP effects on occludin, a key TJ protein that has been reported to have important regulatory, rather than structural, role in maintaining barrier function (France & Turner, 2017). Earlier studies have shown the role of autophagy in enhancing epithelial barrier function via modulation of TJ protein expression (France & Turner, 2017; Wong et al., 2019). Our current studies, for the first time, demonstrated a parasite infection-induced autophagy to modulate the expression of occludin and claudin-4, two key TJ proteins, and of the AJ protein E-cadherin. Our results suggest that triggering degradation of specific host proteins via induction of autophagy could be a novel mechanism of either infectivity of CP due to weakened gut barrier or it may be a host defense mechanism contributing to diarrhea to clear the parasite. In immunocompetent hosts, CP infection causes self-limiting acute diarrhea. However, in immunosuppressed individuals such as HIV patients, CP infection-induced diarrhea is profuse, chronic and could be life-threatening. Therefore, it will be important to investigate whether in immunocompromised hosts CP induces unique signaling pathways to subvert autophagy preventing elimination of the parasite and allowing longer period of infectivity.

In summary, results of our current studies provide novel evidence that modulation of host cell autophagy by CP could result in alterations of pivotal host cell processes e.g. expression of epithelial junctional proteins. This pathway, therefore, could be a critical element in the pathophysiology of cryptosporidiosis.

4. EXPERIMENTAL PROCEDURES

4.1. Antibodies and reagents

Primary antibodies used in this study included occludin (cat. no. 33-1500; Invitrogen, Carlsbad, CA), LC3 (cat. no. 12741), LC3B (cat. no. 2775), P62 (cat. no. 7695), ATG7 (cat. no. 8558), mTOR (cat. no. 2972), phospho-mTOR (cat. no. 5536) from Cell Signaling Technology (Beverly, MA), GAPDH (cat. no. G9545; Sigma, St. Louis, MO) and rhodamine-phalloidin (cat. no.; Invitrogen). The secondary antibodies HRP-conjugated goat anti-mouse (cat. no. W4021) and HRP-conjugated goat anti-rabbit IgG (H+L) (cat. no. W4011) were purchased from Promega (Madison, WI). Autophagy inhibitor chloroquine was procured from Sigma. All other chemicals were of at least reagent grade and were obtained from either Sigma Aldrich (St. Louis, MO) or Fisher Scientific (Pittsburgh, PA).

4.2. Cell culture

Caco-2 cells and Eagle’s Minimum Essential medium (EMEM) were procured from ATCC (American Type Culture Collection, Manassas, VA). The complete medium used for culturing the cells consisted of EMEM supplemented with 100 units/ml penicillin, 100 μg/ml streptomycin, 2 mg/L gentamicin and 10% fetal bovine serum. Cells were grown routinely in T-150 cm2 plastic flasks in 5% CO2-95% air at 37°C. Cells between passages 30 and 45 were used for the present study. For studying the effects of Cryptosporidium parvum (CP) treatment on different markers of autophagic pathway Caco-2 cells were plated on 24 well plates (Costar, Corning, NY) at a density of 2×104 cells/well. Fully differentiated Caco-2 monolayers (14 days post plating) were treated with Cryptosporidium oocysts for 24 h in serum-free cell culture medium. To monitor the autophagy flux under CP treatment, cells were pretreated with autophagy inhibitor chloroquine (CQ, 20 μM) for 1h and then co-incubated with CP for another 24 h. For immunofluorescence studies, 4×103 cells cultured on transwell inserts for 10 days to form a monolayer and were then used for immunostaining post CP treatment.

4.3. Preparation of Cryptosporidium oocysts

The present study utilized the species Cryptosporidium parvum to examine the effects in modulating the process of autophagy in Caco-2 cells. CP oocysts for treatment were obtained from Waterborne Inc. (New Orleans, LA). Caco-2 cells were treated with live oocysts for 24h as previously described by us (Kumar et al., 2018; Kumar et al., 2019). Briefly, excystation was performed by incubating the oocysts in 20% bleach solution (4:1 vol/vol) for 10 min at room temperature. The solution was then centrifuged, and the supernatant was discarded. The pellet obtained was washed three times with HBSS to remove traces of bleach. For treatment, the pellet was finally suspended in EMEM containing 0.2% taurocholate to assist the liberation of infectious sporozoites from the oocysts.

4.4. siRNA transfection

For small RNA interference studies involving silencing of ATG7, Caco-2 cells were plated on six well plates at a density of 1×105 cells/well, 24 h before transfection. After 24 h, Caco-2 cells were transfected with ATG7 specific siRNA (100 pmole, the target sequence of Hs_ATG7L_5 FlexiTube siRNA (Cat no. SI02655373): ATCAGTGGATCTAAATCTCAA and scrambled (control) siRNA (100 pmole) (Qiagen, Valencia, CA) utilizing Lipofectamine 2000 transfection reagent (Invitrogen) as recommended by the manufacturer. These siRNA-transfected cells were subjected to transfection two more times at an interval of 48 h each. After 96 h from the first transfection, cells were treated with CP for 24 h. Total protein was extracted as described below and silencing of ATG7 was validated by immunoblotting.

4.5. Cell lysates and western blotting

For preparation of protein lysates control and CP treated Caco-2 cells were washed with ice-cold 1X-PBS to remove residual media. Total protein was extracted by suspending the cell pellet in cell lysis buffer (Cell Signaling, Danvers, MA) supplemented with protease inhibitor cocktail (Roche, Indianapolis, IN) and phosphatase inhibitor (Sigma Aldrich (St. Louis, MO). The cells were lysed by sonication (three pulses for 20 s each) and the lysate were centrifuged at 7000 rpm for 7 min at 4°C to remove cell debris. Pellet was discarded and the supernatant containing the total cell proteins was saved at −80°C until further use. Protein concentration of the extract was determined using Bradford reagent (Bio-Rad, Hercules, CA). Equal amounts of protein lysates (30 μg/sample) from control and treated cells were solubilized in SDS-gel loading buffer and boiled for 7 min. Lysates were run on a 4-20% SDS-polyacrylamide gradient gel and then transferred onto a PVDF membrane. The membranes were then incubated in blocking buffer (3% BSA in 1X-Tris Buffered Saline, TBS) for 1 h followed by incubation with appropriate primary antibody in 1%BSA-1XTBS-0.1% Tween-20, overnight at 4°C. The membrane was washed five times with the wash buffer (1X-TBS and 0.1% Tween-20) for 5 min and probed with HRP-conjugated goat anti-rabbit/mouse antibody (1:10,000 dilution) for 1 h followed by ECL (enhanced chemiluminescence, from Bio-Rad, Hercules, CA) detection.

4.6. Immunofluorescence staining and confocal microscopy

Caco-2 cells grown on transwell inserts were exposed to CP for 24 h. After treatment the monolayers were washed with PBS-CaCl2 buffer (pH 7.4) twice, fixed with 2% paraformaldehyde in PBS for 10 min, permeabilized in 0.08% saponin in PBS for 10 min followed by blocking in 5% normal goat serum for 2 h at room temperature. Monolayers were then incubated with appropriate antibodies [LC3II antibody (1:1000); occludin antibody (1:100) for 2 h followed by washes for 5 min with 1X-PBS containing CaCl2 and saponin. Cells were finally incubated in Alexa Fluor 488-conjugated goat anti-rabbit secondary antibody at 1:100 dilution (Invitrogen) and/or rhodamine-phalloidin (1:100 dilution; Invitrogen) for 60 min at room temperature. The inserts were mounted onto slides using mounting medium, Slowfade gold antifade reagent containing DAPI solution (Invitrogen). Confocal microscopy was performed using Carl Zeiss 710 microscope. Images were processed using ZenLite imaging software (Carl Zeiss).

4.7. Statistical Analyses

Results are expressed as means ± SEM of three to five independent experiments. Student’s t-test or one-way ANOVA with Tukey’s test was used for statistical analysis. Differences between control and treated groups were considered significant at P value of 0.05 or less.

Take Away.

  • Induction of autophagy is a novel sequel of gut infection by Cryptosporidium.

  • Key proteins of gut epithelial barrier may be degraded via inducing autophagy.

  • Disrupted barrier function may underlie Cryptosporidium-induced diarrhea.

Acknowledgments:

These studies were supported by NIH (NIDDK/NIAID/NIGMS): DK-54016, DK-92441 (PKD), DK-109709 (WAA); AI130790, P20GM121299-01A1 (AB); VA merit review grants: BX 002011 (PKD), BX 000152 (WAA); Senior Research Career Scientist Award (PKD, 1IK6BX005242-01), and Career Research Scientist Award (WAA, IK6BX005243); Students Research Grant, UIC Honors College (JB)

Footnotes

Conflict of Interests: All authors declare that there are no conflicts of interest.

REFERENCES

  1. Bjorkoy G, Lamark T, Pankiv S, Overvatn A, Brech A, & Johansen T (2009). Monitoring autophagic degradation of p62/SQSTM1. Methods Enzymol, 452, 181–197. doi: 10.1016/S0076-6879(08)03612-4 [DOI] [PubMed] [Google Scholar]
  2. Campoy E, & Colombo MI (2009). Autophagy in intracellular bacterial infection. Biochim Biophys Acta, 1793(9), 1465–1477. doi: 10.1016/j.bbamcr.2009.03.003 [DOI] [PubMed] [Google Scholar]
  3. Checkley W, White AC Jr., Jaganath D, Arrowood MJ, Chalmers RM, Chen XM, … Houpt ER (2015). A review of the global burden, novel diagnostics, therapeutics, and vaccine targets for cryptosporidium. Lancet Infect Dis, 15(1), 85–94. doi: 10.1016/S1473-3099(14)70772-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Choy A, & Roy CR (2013). Autophagy and bacterial infection: an evolving arms race. Trends Microbiol, 21(9), 451–456. doi: 10.1016/j.tim.2013.06.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. de Sablet T, Potiron L, Marquis M, Bussiere FI, Lacroix-Lamande S, & Laurent F (2016). Cryptosporidium parvum increases intestinal permeability through interaction with epithelial cells and IL-1beta and TNFalpha released by inflammatory monocytes. Cell Microbiol, 18(12), 1871–1880. doi: 10.1111/cmi.12632 [DOI] [PubMed] [Google Scholar]
  6. Deretic V, Saitoh T, & Akira S (2013). Autophagy in infection, inflammation and immunity. Nat Rev Immunol, 13(10), 722–737. doi: 10.1038/nri3532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Escoll P, Rolando M, & Buchrieser C (2016). Modulation of Host Autophagy during Bacterial Infection: Sabotaging Host Munitions for Pathogen Nutrition. Front Immunol, 7, 81. doi: 10.3389/fimmu.2016.00081 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. France MM, & Turner JR (2017). The mucosal barrier at a glance. J Cell Sci, 130(2), 307–314. doi: 10.1242/jcs.193482 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Gerace E, Lo Presti VDM, & Biondo C (2019). Cryptosporidium Infection: Epidemiology, Pathogenesis, and Differential Diagnosis. Eur J Microbiol Immunol (Bp), 9(4), 119–123. doi: 10.1556/1886.2019.00019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Glick D, Barth S, & Macleod KF (2010). Autophagy: cellular and molecular mechanisms. J Pathol, 221(1), 3–12. doi: 10.1002/path.2697 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hampe J, Franke A, Rosenstiel P, Till A, Teuber M, Huse K, … Schreiber S (2007). A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat Genet, 39(2), 207–211. doi: 10.1038/ng1954 [DOI] [PubMed] [Google Scholar]
  12. Haq S, Grondin J, Banskota S, & Khan WI (2019). Autophagy: roles in intestinal mucosal homeostasis and inflammation. J Biomed Sci, 26(1), 19. doi: 10.1186/s12929-019-0512-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. He R, Peng J, Yuan P, Yang J, Wu X, Wang Y, & Wei W (2017). Glucosyltransferase Activity of Clostridium difficile Toxin B Triggers Autophagy-mediated Cell Growth Arrest. Sci Rep, 7(1), 10532. doi: 10.1038/s41598-017-11336-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hidalgo IJ, Raub TJ, & Borchardt RT (1989). Characterization of the human colon carcinoma cell line (Caco-2) as a model system for intestinal epithelial permeability. Gastroenterology, 96(3), 736–749. [PubMed] [Google Scholar]
  15. Hu W, Chan H, Lu L, Wong KT, Wong SH, Li MX, … Zhang L (2020). Autophagy in intracellular bacterial infection. Semin Cell Dev Biol, 101, 41–50. doi: 10.1016/j.semcdb.2019.07.014 [DOI] [PubMed] [Google Scholar]
  16. Iida T, Onodera K, & Nakase H (2017). Role of autophagy in the pathogenesis of inflammatory bowel disease. World J Gastroenterol, 23(11), 1944–1953. doi: 10.3748/wjg.v23.i11.1944 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Innes EA, Chalmers RM, Wells B, & Pawlowic MC (2020). A One Health Approach to Tackle Cryptosporidiosis. Trends Parasitol, 36(3), 290–303. doi: 10.1016/j.pt.2019.12.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jo EK, Yuk JM, Shin DM, & Sasakawa C (2013). Roles of autophagy in elimination of intracellular bacterial pathogens. Front Immunol, 4, 97. doi: 10.3389/fimmu.2013.00097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, … Yoshimori T (2000). LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J, 19(21), 5720–5728. doi: 10.1093/emboj/19.21.5720 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kaur J, & Debnath J (2015). Autophagy at the crossroads of catabolism and anabolism. Nat Rev Mol Cell Biol, 16(8), 461–472. doi: 10.1038/nrm4024 [DOI] [PubMed] [Google Scholar]
  21. Kumar A, Chatterjee I, Anbazhagan AN, Jayawardena D, Priyamvada S, Alrefai WA, … Dudeja PK (2018). Cryptosporidium parvum disrupts intestinal epithelial barrier function via altering expression of key tight junction and adherens junction proteins. Cell Microbiol, 20(6), e12830. doi: 10.1111/cmi.12830 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kumar A, Jayawardena D, Anbazhagan AN, Chatterjee I, Priyamvada S, Alrefai WA, … Dudeja PK (2019). Decreased SLC26A3 expression and function in intestinal epithelial cells in response to Cryptosporidium parvum infection. Am J Physiol Cell Physiol, 317(6), C1205–C1212. doi: 10.1152/ajpcell.00278.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lassen KG, & Xavier RJ (2018). Mechanisms and function of autophagy in intestinal disease. Autophagy, 14(2), 216–220. doi: 10.1080/15548627.2017.1389358 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li X, He S, & Ma B (2020). Autophagy and autophagy-related proteins in cancer. Mol Cancer, 19(1), 12. doi: 10.1186/s12943-020-1138-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mauthe M, Orhon I, Rocchi C, Zhou X, Luhr M, Hijlkema KJ, … Reggiori F (2018). Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy, 14(8), 1435–1455. doi: 10.1080/15548627.2018.1474314 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. McEwan DG (2017). Host-pathogen interactions and subversion of autophagy. Essays Biochem, 61(6), 687–697. doi: 10.1042/EBC20170058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Miller C, & Celli J (2016). Avoidance and Subversion of Eukaryotic Homeostatic Autophagy Mechanisms by Bacterial Pathogens. J Mol Biol, 428(17), 3387–3398. doi: 10.1016/j.jmb.2016.07.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mizushima N (2007). Autophagy: process and function. Genes Dev, 21(22), 2861–2873. doi: 10.1101/gad.1599207 [DOI] [PubMed] [Google Scholar]
  29. Muniz-Feliciano L, Van Grol J, Portillo JA, Liew L, Liu B, Carlin CR, … Subauste CS (2013). Toxoplasma gondii-induced activation of EGFR prevents autophagy protein-mediated killing of the parasite. PLoS Pathog, 9(12), e1003809. doi: 10.1371/journal.ppat.1003809 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Onizuka Y, Takahashi C, Uematsu A, Shinjo S, Seto E, & Nakajima-Shimada J (2017). Inhibition of autolysosome formation in host autophagy by Trypanosoma cruzi infection. Acta Trop, 170, 57–62. doi: 10.1016/j.actatropica.2017.02.021 [DOI] [PubMed] [Google Scholar]
  31. Pignata S, Maggini L, Zarrilli R, Rea A, & Acquaviva AM (1994). The enterocyte-like differentiation of the Caco-2 tumor cell line strongly correlates with responsiveness to cAMP and activation of kinase A pathway. Cell Growth Differ, 5(9), 967–973. [PubMed] [Google Scholar]
  32. Portillo JC, Muniz-Feliciano L, Lopez Corcino Y, Lee SJ, Van Grol J, Parsons SJ, … Subauste CS (2017). Toxoplasma gondii induces FAK-Src-STAT3 signaling during infection of host cells that prevents parasite targeting by autophagy. PLoS Pathog, 13(10), e1006671. doi: 10.1371/journal.ppat.1006671 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Saha S, Panigrahi DP, Patil S, & Bhutia SK (2018). Autophagy in health and disease: A comprehensive review. Biomed Pharmacother, 104, 485–495. doi: 10.1016/j.biopha.2018.05.007 [DOI] [PubMed] [Google Scholar]
  34. Shintani T, & Klionsky DJ (2004). Autophagy in health and disease: a double-edged sword. Science, 306(5698), 990–995. doi: 10.1126/science.1099993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tao S, & Drexler I (2020). Targeting Autophagy in Innate Immune Cells: Angel or Demon During Infection and Vaccination? Front Immunol, 11, 460. doi: 10.3389/fimmu.2020.00460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tattoli I, Sorbara MT, Vuckovic D, Ling A, Soares F, Carneiro LA, … Girardin SE (2012). Amino acid starvation induced by invasive bacterial pathogens triggers an innate host defense program. Cell Host Microbe, 11(6), 563–575. doi: 10.1016/j.chom.2012.04.012 [DOI] [PubMed] [Google Scholar]
  37. Ward HD (2017). New Tools for Cryptosporidium Lead to New Hope for Cryptosporidiosis. Trends Parasitol, 33(9), 662–664. doi: 10.1016/j.pt.2017.07.004 [DOI] [PubMed] [Google Scholar]
  38. Wong M, Ganapathy AS, Suchanec E, Laidler L, Ma T, & Nighot P (2019). Intestinal epithelial tight junction barrier regulation by autophagy-related protein ATG6/beclin 1. Am J Physiol Cell Physiol, 316(5), C753–C765. doi: 10.1152/ajpcell.00246.2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Xiong Q, Yang M, Li P, & Wu C (2019). Bacteria Exploit Autophagy For Their Own Benefit. Infect Drug Resist, 12, 3205–3215. doi: 10.2147/IDR.S220376 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yin Z, Pascual C, & Klionsky DJ (2016). Autophagy: machinery and regulation. Microb Cell, 3(12), 588–596. doi: 10.15698/mic2016.12.546 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES