Skip to main content
Microbiology Spectrum logoLink to Microbiology Spectrum
. 2022 Mar 14;10(2):e02176-21. doi: 10.1128/spectrum.02176-21

Specific Detection of SARS-CoV-2 Variants B.1.1.7 (Alpha) and B.1.617.2 (Delta) Using a One-Step Quantitative PCR Assay

Oran Erster a,✉, Ella Mendelson a,b, Areej Kabat a, Virginia Levy a, Batya Mannasse a, Hadar Assraf a, Roberto Azar a, Yaniv Ali a, Efrat Bucris a, Dana Bar-Ilan a, Orna Mor a,b, Michal Elul a, Michal Mandelboim a,b, Danit Sofer a, Shay Fleishon a, Neta S Zuckerman a,#, Itay Bar-Or a,#
Editor: Miguel Angel Martinezc
PMCID: PMC9045307  PMID: 35285705

ABSTRACT

In this report, we describe the development of a reverse transcription-quantitative PCR (RT-qPCR) assay, termed Alpha-Delta assay, which can detect all severe acute respiratory syndrome coronavirus 2 (SC-2) variants and distinguish between the Alpha (B.1.1.7) and Delta (B.1.617.2) variants. The Alpha- and Delta-specific reactions in the assay target mutations that are strongly linked to the target variant. The Alpha reaction targets the D3L substitution in the N gene, and the Delta reaction targets the spike gene 156 to 158 mutations. Additionally, we describe a second Delta-specific assay that we use as a confirmatory test for the Alpha-Delta assay that targets the 119 to 120 deletion in the Orf8 gene. Both reactions have similar sensitivities of 15 to 25 copies per reaction, similar to the sensitivity of commercial SC-2 detection tests. The Alpha-Delta assay and the Orf8119del assay were successfully used to classify clinical samples that were subsequently analyzed by whole-genome sequencing. Lastly, the capability of the Alpha-Delta assay and Orf8119del assay to identify correctly the presence of Delta RNA in wastewater samples was demonstrated. This study provides a rapid, sensitive, and cost-effective tool for detecting and classifying two worldwide dominant SC-2 variants. It also highlights the importance of a timely diagnostic response to the emergence of new SC-2 variants with significant consequences on global health.

IMPORTANCE The new assays described herein enable rapid, straightforward, and cost-effective detection of severe acute respiratory syndrome coronavirus 2 (SC-2) with immediate classification of the examined sample as Alpha, Delta, non-Alpha, or non-Delta variant. This is highly important for two main reasons: (i) it provides the scientific and medical community with a novel diagnostic tool to rapidly detect and classify any SC-2 sample of interest as Alpha, Delta, or none and can be applied to both clinical and environmental samples, and (ii) it demonstrates how to respond to the emergence of new variants of concern by developing a variant-specific assay. Such assays should improve our preparedness and adjust the diagnostic capacity to serve clinical, epidemiological, and research needs.

KEYWORDS: SARS-COV-2, RT-qPCR, Alpha (B.1.1.7), Delta (B.1.617.2), classification, diagnostic assay, SC-2 surveillance

INTRODUCTION

The emergence of new severe acute respiratory syndrome coronavirus 2 (SC-2) variants has been a major concern due to their potential to increase morbidity and mortality, thereby causing further difficulty in fighting and containing the worldwide coronavirus disease 2019 (COVID-19) pandemic (1–3). Since the end of 2020, more than 20 SC-2 variants with distinct genomic signatures have been identified worldwide, and some of these variants divided into additional subclades (https://covariants.org/ and https://cov-lineages.org/lineage_list.html). Some of them were characterized by markedly increased infectivity, which led to recurring outbreaks and a “take-over” effect of specific variants, such as B.1.1.7 (Alpha), in a matter of 4 to 5 weeks (1). Other variants, such as B.1.351 (Beta) and P1 (Gamma), spread rapidly and showed a significant potential to become dominant (4, 5) but were eventually pushed aside by others. Variant B.1.617, initially identified in India in late 2020, spread rapidly, and one of its sublineages (B.1.617-2) became a globally dominant variant within a few months. The transmission pattern of Alpha and Delta variants suggests that they both spread from their country of origin, rapidly reaching North and South America, Europe, Africa, and Australia (4, 5). In Israel, two large morbidity waves were associated with the introduction of new variants. The first wave was the Alpha variant high-morbidity wave, which started in mid-December 2020 and declined by mid-March 2021 following the successful nation-wide immunization campaign with two doses of the BNT162-b2 vaccine (6). The current high-morbidity wave dominated by the Delta variant followed, which started in July 2021 in parallel to vaccine waning immunity and continues (7). Immunological studies demonstrated that some of the emerging variants have the potential to evade, at least partially, the neutralizing effect of both convalescent patients and vaccinated individuals (2, 3, 7–9). The spreading of such variants may therefore compromise the effectiveness of global vaccination efforts aimed to contain the COVID-19 pandemic.

A fundamental pillar of the campaign against COVID-19 is the ability to detect the presence and identity of SC-2 RNA in both infected individuals and environmental samples. This pressing need led to an unprecedented number of commercial detection kits based on molecular and serological principles, with various degrees of sensitivity, throughput, reliability, and turnaround time (see references 10–12 and references therein). Due to their epidemiological and medical importance, the rapid identification of circulating variants becomes a central tool in the fight against the pandemic.

In addition to the diagnosis of clinical samples, the monitoring of SC-2 RNA in environmental samples, mostly, but not exclusively, wastewater, proved as an important tool (6, 13, 14). Detection of SC-2 RNA in such samples is exceptionally challenging due to their very low abundance and the presence of PCR inhibitors, which render this approach even more difficult. Several reports describe the successful identification of SC-2 RNA in environmental samples, and some describe the classification of the examined samples using sequencing (6, 15, 16). Classification of samples using sequencing requires sufficient quality and quantity, which are often not available with environmental samples. Moreover, this approach is currently much more expensive than PCR-based assays and cannot be scaled-up readily to facilitate rapid screening of a large number of samples efficiently.

In order to address the need for rapid classification of SC-2-positive samples, several manufacturers released sets of molecular tests that specifically detect key mutations that are associated with increased transmissibility or vaccine resistance (Seegene, Thermo Fisher, and Kogene Biotech). However, most of these mutations are common to multiple variants and can therefore not be used to assign a sample of interest to a certain lineage with a high degree of confidence using a single test. We recently developed quantitative PCR (qPCR)-based molecular tests that target mutations that are strongly associated with variants Alpha and Beta, thereby enabling rapid classification of such samples with high confidence. We demonstrated that the selected target mutations successfully reflect the lineage of the examined sample, as confirmed by Sanger and whole-genome sequencing (17). In this report, we describe the development and utilization of two qPCR tests that target mutations that are, thus far, unique to variant B.1.617 (Delta lineage). We combined one of these reactions with the ND3L reaction that detects the Alpha variant and the inclusive E-sarbeco reaction (18) we described previously to a new selective multiplex assay. This assay can determine if the examined samples are of lineage Alpha, Delta, or neither. We show that the new multiplex assay, which we term “Alpha-Delta assay,” is rapid, sensitive, and reliable, as confirmed by sequencing. Finally, we demonstrate the capability of the new assay to detect and classify SC-2 RNA extracted from environmental samples.

RESULTS

Design of the S157del and Orf8119del reactions.

Alignment of genomes identified as the Delta lineage from the Global Initiative on Sharing All Influenza Data (GISAID) database (https://www.gisaid.org/) with SC-2 reference sequence NC_045512 showed that all Delta sequences contained a substitution and a deletion in nucleotide positions 22045 to 22050, which translates into amino acid E-to-G substitution in position 156 and deletions in positions 157 to 158 in the spike protein (Fig. 1A). Accordingly, a specific reaction was designed to detect that deletion, denoted S157del reaction hereafter, by using a probe that can only bind to the mutated sequence (21987 probe) (Fig. 1B). In order to establish that the selected mutations were indeed unique to the Delta lineage, global analysis of SC-2 genomes was performed using the NextStrain website (https://nextstrain.org/) using the deletion in positions 22045 to 22050 as a search term. The resulting dendrogram showed that the double deletion was indeed unique to the Delta lineage and was absent from other known lineages (Fig. S1A in the supplemental material).

FIG 1.

FIG 1

Identification of the B.1.617-specific spike gene deletion. (A) Alignment of 32 genomic sequences of lineage B.1.617 samples with reference sequence NC_045512 showed a deletion in nucleotide positions 22045 to 22050, corresponding to amino acid positions 156 to 157 in the protein sequence. The 156-to-157 deletion gap is marked with brackets. (B) Global analysis of SC-2 genomes available in the NextStrain database (https://nextstrain.org/sars-cov-2/) showing that this 6-bp deletion is present only in the Delta lineage (highlighted in purple).

The Delta genome alignment showed a second unique deletion mapped to nucleotide positions 28248 to 28253 in reference sequence NC_045512 at the C-terminal end of Orf8, spanning amino acids 119 to 120 of the protein (Fig. 2A). Global genome analysis performed as described for the 22045-to-22050 deletion showed that the deletion at positions 28248 to 28253 was also unique for the Delta lineage (Fig. 2B). A specific probe was designed to identify the deletion-containing sequence (28199). Secondary structure simulation suggested that the original probe sequence is likely to generate a strong stem-loop structure, thereby significantly reducing the reaction efficiency. In order to avoid this undesired outcome, a single G-to-T substitution was incorporated at position 10 (Fig. S1). Two primers were then designed to amplify the deletion region and complete the reverse transcription-quantitative PCR (RT-qPCR) assay. The sequences of the Orf8119-120del primers and probe are detailed in Table 1. Sequencing of the C-terminal domain (CTD) of the Orf8 gene from the same four samples classified by the S157del assay as Delta confirmed the presence of the Orf8 119 to 120 deletion, which is the target of the Orf8119del reaction (Fig. 2B). Additional confirmation for the accuracy of the two reactions was performed by sequencing four samples that were identified as Delta suspected. Each sample was sequenced in the S157del region and the Orf8119del region. As shown in Fig. S2, all samples contained both deletions.

FIG 2.

FIG 2

Identification of the B.1.617-specific Orf8 gene deletion. (A) Alignment of 32 genomic sequences of lineage B.1.617 samples with reference sequence NC_045512 showed a deletion in nucleotide positions 28248 to 28253, corresponding to amino acid positions 119 to 120 at the C-terminal end of the protein sequence. The 119-to-120 deletion gap is marked with brackets. (B) Global analysis of SC-2 genomes available in the NextStrain database (https://nextstrain.org/sars-cov-2/) showing that this 6-bp deletion is present only in the Delta lineage (highlighted in purple).

TABLE 1.

Details of the primers and probes used for the S157del and Orf8119del assays

Name Sequence 5′→3′ and modificationsa Position in sequence NC_045512
S157del reaction
22003 Fwd GTGTTTATTACCACAAAAACAACAA 22,003
21987 probe TexasRed-GATGGACAGTGGAGTTTATTCTAGTG-BHQ2 22,040
22075 Rev GGCTGAGAGACATATTCAAAAGTGC 22,075 on reverse strand
T7 21494 Fwd TAATACGACTCACTATAGGGGACTTATAATTAGAGAAAACAACAG b 21,494
Cov19 22475 GTTTCTGAGAGAGGGTCAAGTGCAC 22,459 on reverse strand
Orf8 cloning and detection primers
28225 Fwd GAAGACTTTTTAGAGTATCATGAC 28,209
28232 Rev TTTTGGGGTCCATTATCAGAC 28,297 on reverse strand
28199 probe HEX-CGTGTTGTTGTAATCTAAACGAACAAAC-BHQ1 28,242
pT7 27945 Fwd TAATACGACTCACTATAGGGCCATATGTAGTTGATGACCCGTGTC b 27,981
28525 Rev CCATCTTGGACTGAGATCTTTCATTTTAC 28,598 on reverse strand
E-sarbeco reaction
E_Sarbeco_F1b GTTAATAGCGTACTTCTTTTTCTTGC 26,284
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 26,382 on reverse strand
E_Sarbeco_P1 6-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 26,332
N-D3L reaction
28257D3L Fwd TAAACGAACAAACTAAATGTCTCTA 28,257
CoV19_N1-R TCTGGTTACTGCCAGTTGAATCTG 28,359 on reverse strand
CoV19_N1-P HEX-ACCCCGCATTACGTTTGGTGGACC-BHQ1 28,309
RNAse P Sequence 5′→3′ and modifications Position in sequence NM_001104546
RNase P-Fwd AGATTTGGACCTGCGAGCG 28
RNase P-Rev GAGCGGCTGTCTCCACAAGT 49
RNase P-P Cy5-TTCTGACCTGAAGGCTCTGCGCG-BHQ-2 93
a

BHQ, black hole quencher.

b

Minimal T7 promoter sequence is in bolded letters.

Development and evaluation of the Alpha-Delta assay.

In order to facilitate detection of SC-2 RNA regardless of the lineage and identify the Alpha or Delta lineages in a single test, the three SC-2-targeting reactions (i.e., E-sarbeco, ND3L, and S157del) were combined in one multiplex assay termed “Alpha-Delta assay.” A control reaction detecting the human RNAse P gene was also included in the multiplex assay for an endogenous control, as was performed previously (17). Analytical sensitivity of the Alpha-Delta assay was evaluated using serial dilutions of mixed RNA targets of the four reactions combined in the assay. Each dilution was examined as follows: dilutions down to 5 × 103 copies/reaction were tested in ten replicates. Dilutions of 5 × 102 to 5 × 100 copies/reaction were run in 20 repeats (Table S2). In order to ensure that the calculated number of the in vitro transcribed target molecules (IVT standards) provides a reliable estimation of the actual viral genome copies, serial dilutions of commercial SC-2 RNA were tested together with the IVT standards in the E-sarbeco reaction. The combined calibration curve confirmed that the results obtained with the IVT standards are consistent with those obtained with the commercial SC-2 RNA standard (red circled data points, Fig. S3A). The limit of detection (LOD) for the SC-2 targets was determined to be 12 copies/reaction for the E-sarbeco reaction, 50 copies for the ND3L reaction, and less than 10 copies for the S157del reaction. The LOD for the human RNAse P reaction was 50 copies/reaction (Fig. S3). The Orf8119del reaction was developed as a confirmatory assay for inconclusive Delta-suspected samples. This reaction was used in combination with the E-sarbeco reaction that served as an inclusive SC-2 control reaction to ensure the presence of the SC-2 RNA. The analytical LOD of that reaction was determined to be 24 copies/reaction (Fig. S3). The specificity of the Delta-specific reactions was tested using RNA extractions from lineages 19A/19B (Wuhan lineage), Alpha, Beta, and Gamma. As detailed in Table S3, all lineages were negative for both the S157del and Orf8119del reactions. Analytical sensitivity of the multiplex reaction in wastewater was evaluated as described previously (19), and the minimum detection values were close to those obtained with standard sampling material (19, Erster and Bar-Or, unpublished data). Analysis of the amplification curves of the different Delta assay variations showed that in some samples, mostly with a high RNA concentration (quantification cycle [Cq] ≤ 22), a weak signal in the 6-carboxy-2,3,3,5,7,7-hexachlorofluorescein (HEX) channel was observed, presumably resulting from low-affinity ND3L reaction (Fig. 3D). However, in these cases, the Cq values of the E-sarbeco reaction and the S157del reaction (in Delta samples) were always at least 10 cycles earlier than those of the ND3L reaction, thereby clearly indicating that the sample was not of the Alpha lineage. Both the S157del and the Orf8119del reactions were very specific and did not give a positive signal in non-Delta samples (Fig. 3). In order to exclude a possible mutual effect of the four reactions combined together, serial dilutions of Delta RNA from cultured cells were tested, showing similar sensitivity of both the E-sarbeco and S157del reactions, thus confirming the maintained sensitivity of the Alpha-Delta multiplex (Fig. S3).

FIG 3.

FIG 3

Amplification curves of the Alpha-Delta and Orf8 assays. (A) Non-B.1.1.7, non-B.1.617 sample with no background signal. (B) Non-B.1.1.7, non-B.1.617 sample with ND3L reaction background. (C) B.1.617 sample with no background signal. (D) B.1.617 sample with ND3L reaction background. (E) B.1.617 sample reaction. (F) B.1.617 E-sarbeco + Orf8199del reaction.

Examination of clinical samples using the Alpha-Delta assay followed by whole-genome sequencing (WGS) analysis.

Between January and May 2021, the prevalent lineage in Israel was Alpha. The Delta lineage began spreading in the country during mid-June 2021. The Alpha-Delta assay was therefore used to classify clinical samples whose lineage attribution was unknown in order to enable rapid epidemiological investigations and to aid public health decision-making regarding WGS prioritization. This assay was then used as a routine test at the Israel Central Virology Laboratory. From June to August 2021, over 1,400 clinical samples were classified as Delta, Alpha, or neither using this assay. This classification was subsequently confirmed by Illumina WGS analysis. The details of 62 such samples selected randomly are listed in Tables 2 and 3. All samples classified by the Alpha-Delta qPCR assay as suspected Delta were either identified as such by the WGS analysis or classified as “no lineage” (Table 2). Those who were designated “no lineage” were mostly with Cq values higher than 32 and were all with 70% or less sequencing coverage (Table 3). These samples, which were classified as “Delta-suspected” by the Alpha-Delta assay, were positive for the Orf8 119 to 120 deletion, but the S157del region was not fully sequenced. Comparison of the PCR results with the Illumina WGS analysis showed that of the 62 samples randomly selected, 19 were not classified by the WGS analysis but were positive for the Delta-specific deletions (the S157del, Orf8119del, or both) (Table 2). Examination of the Cq values obtained for the WGS nonclassified samples showed that two samples had values of 27 and 29 (14,957 and 14,968, respectively), and all others were higher than 30 (Table 2). The sequence coverage of the unclassified samples ranged between 20.9% and 70% (Table 3). These data suggest that the positive identification of both the Orf8119del and the S157del mutations by the qPCR assay enable a more definite classification of these samples, even in the absence of a complete sequencing coverage. The assay also detected a small number of Alpha lineage samples (two in the samples presented in Tables 2 and 3), where the ND3L mutation was detected by both the qPCR assay and the WGS analysis (Tables 2 and 3).

TABLE 2.

Cq values and classification of the Alpha-Delta assay compared with the Pangolin classification (https://cov-lineages.org/resources/pangolin.html) as determined by the WGS analysis of 62 representative samplesa

Sample CoV19 E ND3L S157del ORF8119del Pangolin clade RT-PCR classification
14918 25   27 26 B.1.617.2 Suspected B.617.2
14920 36   38 40 None Suspected B.617.2
14921 26   28 26 B.1.617.2 Suspected B.617.2
14922 23   25 23 B.1.617.2 Suspected B.617.2
14923 17   19 18 B.1.617.2 Suspected B.617.2
14924 27   30 27 B.1.617.2 Suspected B.617.2
14925 36   37 34 None Suspected B.617.2
14926 22   24 22 B.1.617.2 Suspected B.617.2
14928 37   NA 39 None Suspected B.617.2
14929 20   22 20 B.1.617.2 Suspected B.617.2
14931 31   33 30 B.1.617.2 Suspected B.617.2
14932 34   40 33 None Suspected B.617.2
14933 21   23 21 B.1.617.2 Suspected B.617.2
14934 29   31 29 None Suspected B.617.2
14936 35   40 33 None Suspected B.617.2
14937 21   23 21 B.1.617.2 Suspected B.617.2
14938 34   42 34 None Suspected B.617.2
14939 33   35 32 None Suspected B.617.2
14940 28   30 28 B.1.617.2 Suspected B.617.2
14941 24.68 25.51 NA NA B.1.1.7 Suspected B.1.1.7
14945 29   31 30 None Suspected B.617.2
14946 25   28 26 B.1.617.2 Suspected B.617.2
14947 25   27 26 B.1.404 Suspected B.617.2
14948 33   35 33 None Suspected B.617.2
14949 22   24 23 B.1.617.2 Suspected B.617.2
14950 27   29 28 B.1.617.2 Suspected B.617.2
14951 36   37 35 None Suspected B.617.2
14952 24   26 25 B.1.617.2 Suspected B.617.2
14953 22   24 22 B.1.617.2 Suspected B.617.2
14954 25   28 21 B.1.617.2 Suspected B.617.2
14955 25   27 26 B.1.617.2 Suspected B.617.2
14957 25   27 26 None Suspected B.617.2
14958 22   23 22 B.1.617.2 Suspected B.617.2
14960 27   29 27 B.1.617.2 Suspected B.617.2
14963 32   34 32 None Suspected B.617.2
14965 23   25 23 B.1.617.2 Suspected B.617.2
14966 23   15 23 B.1.617.2 Suspected B.617.2
14967 31   33 31 None Suspected B.617.2
14968 27   29 28 None Suspected B.617.2
14969 26   28 27 B.1.617.2 Suspected B.617.2
14970 25   28 26 B.1.617.2 Suspected B.617.2
14971 24   26 24 B.1.617.2 Suspected B.617.2
14972 32   39 32 None Suspected B.617.2
14973 28   29 28 B.1.617.2 Suspected B.617.2
14975 23   25 24 B.1.617.2 Suspected B.617.2
14978 21   21 21 B.1.617.2 Suspected B.617.2
14980 26   28 27 B.1.617.2 Suspected B.617.2
14999 27 NA 29 29 B.1.617.2 Suspected B.617.2
15006 28 NA 30 29 B.1.617.2 Suspected B.617.2
15012 28 NA 30 29 B.1.617.2 Suspected B.617.2
15014 31 NA 32 33 None  Suspected B.617.2
15019 25 NA 28 26 B.1.617.2 Suspected B.617.2
15024 31 NA 32 32 None Suspected B.617.2
15036 30 NA 31 31 B.1.617.2 Suspected B.617.2
15043 35 NA 36 36 None Suspected B.617.2
15046 27 NA 28 28 B.1.617.2 Suspected B.617.2
15048 29 28 NA NA B.1.1 Suspected B.1.1.7
15051 28 NA 30 29 B.1.617.2 Suspected B.617.2
15053 28 NA 29 28 B.1.617.2 Suspected B.617.2
15085 33 NA 33 32 None Suspected B.617.2
a

CoV19 E, CoV19 inclusive E-sarbeco reaction; NA, no amplification.

TABLE 3.

WGS coverage, deletions sequenced by WGS analysis, and classification of clinical samples examined using the Alpha-Delta assay

Samplea Amino acid deletions Coverage (%) Pangolin clade
14918 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.87 B.1.617.2
14920 E619-(S); V620-(S); P621-(S); V622-(S); A623-(S) 56.46 None
14921 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 97.67 B.1.617.2
14922 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.64 B.1.617.2
14923 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.04 B.1.617.2
14924 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 97.58 B.1.617.2
14925 D119-(ORF8); F120-(ORF8) 41.58 None
14926 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.64 B.1.617.2
14928 D119-(ORF8); F120-(ORF8) 22.57 None
14929 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.95 B.1.617.2
14931 D119-(ORF8); F120-(ORF8); R158-(S)   B.1.617.2
14932 D119-(ORF8); F120-(ORF8) 57.41 None
14933 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.83 B.1.617.2
14934 D119-(ORF8); F120-(ORF8)   None
14936 D119-(ORF8); F120-(ORF8) 56.55 None
14937 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.79 B.1.617.2
14938   57.23 None
14939 D119-(ORF8); F120-(ORF8) 68.74 None
14940 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 97.29 B.1.617.2
14941 S3675-(ORF1a); G3676-(ORF1a); F3677-(ORF1a); H69-(S); V70-(S); Y144-(S) 99.78 B.1.1.7
14945 D119-(ORF8); F120-(ORF8) 69.39 None
14946 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.18 B.1.617.2
14947 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 98.34 B.1.404
14948 D119-(ORF8); F120-(ORF8) 60.82 None
14949 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.83 B.1.617.2
14950 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 98.94 B.1.617.2
14951 D119-(ORF8); F120-(ORF8) 36.15 None
14952 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 98.97 B.1.617.2
14953 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.82 B.1.617.2
14954 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.45 B.1.617.2
14955 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.72 B.1.617.2
14957   20.91 None
14958 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.8 B.1.617.2
14960 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99 B.1.617.2
14963 D119-(ORF8); F120-(ORF8) 69.01 None
14965 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.73 B.1.617.2
14966 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.61 B.1.617.2
14967 D119-(ORF8); F120-(ORF8) 70.23 None
14968 D119-(ORF8); F120-(ORF8)   None
14969 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S)   B.1.617.2
14970 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 98.53 B.1.617.2
14971 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.9 B.1.617.2
14972 C1732-(ORF1b); L1733-(ORF1b); C1734-(ORF1b) 36.73 None
14973 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 97.09 B.1.617.2
14975 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.55 B.1.617.2
14978 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.68 B.1.617.2
14980 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 99.82 B.1.617.2
14999 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 98.63 B.1.617.2
Sample Amino acid deletions Coverage (%) Pangolin clade
15006 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 97.86 B.1.617.2
15012 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 94.57 B.1.617.2
15014 D119-(ORF8); F120-(ORF8)   None 
15019 L206-(M); D119-(ORF8); F120-(ORF8); F157-(S); R158-(S)   B.1.617.2
15024 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 94.55 B.1.617.2
15036 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 97.86 B.1.617.2
15043 D119-(ORF8); F120-(ORF8) 47.82 None
15046 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 97.87 B.1.617.2
15048 H69-(S); V70-(S); Y144-(S) 98.28 B.1.1
15051 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 98.38 B.1.617.2
15053 D119-(ORF8); F120-(ORF8); F157-(S); R158-(S) 91.98 B.1.617.2
15085 D119-(ORF8); F120-(ORF8) 33.42
a

Alpha samples are highlighted in gray.

Detection of the Alpha and Delta lineage in wastewater samples.

The capability of the Alpha-Delta and confirmatory Orf8119del assays to detect the presence of the Delta lineage RNA in sewage samples was evaluated using samples from different periods of the COVID-19 pandemic, from December 2020 to mid-June 2021. As detailed in Table 4, the assay correctly identified the samples from 2020 as non-Alpha and non-Delta. Samples collected during the peak of the third morbidity wave in Israel were all identified as positive for the Alpha variant, and samples collected from July 2021 were all identified as positive for the Delta variant (Table 4). The Cq values of the ND3L and S157del reactions, when positive, were comparable to those of the E-sarbeco reaction, demonstrating sufficient sensitivity of these reactions with RNA extraction of wastewater. These results indicated that the Alpha-Delta assay is sufficiently sensitive to detect the presence of SC-2 in wastewater and determine whether the Alpha or Delta lineages or both are circulating in the examined regions. In order to evaluate the capability of the ORF8119del reaction to correctly detect the Delta linage RNA in wastewater samples, it was applied to samples that were previously identified as non-Alpha, non-Delta, or as Delta positive. Samples selected randomly from 2020 were all negative for the presence of the ORF8119del mutation, while recent samples from July 2021 were all identified as positive for the mutation (Table 5). Although the Cq values obtained with the ORF8119del reaction were 2 to 3 cycles higher than those of the S157del reaction in this test, all samples were correctly identified. Collectively, these results show that both the Alpha-Delta multiplex assay and the confirmatory ORF8119del test can be used for examination of identification of the Alpha and Delta lineages in wastewater samples.

TABLE 4.

Detection of Alpha and Delta lineage in wastewater samples using the Alpha-Delta assay

Sample CoV19 E ND3L S157del
September to December 2020a,b
S-2299 35 NA NA
S-2302 32 NA NA
S-2307 32 NA NA
S-2310 30 NA NA
S-2314 31 NA NA
S-2318 30 NA NA
S-2328 31 NA NA
S-2332 31 NA NA
S-2336 31 NA NA
S-2340 32 NA NA
S-2344 30 NA NA
S-2349 33 NA NA
S-2353 32 NA NA
S-2357 32 NA NA
S-2382 30 NA NA
S-2386 31 NA NA
S-2390 30 NA NA
S-2394 34 NA NA
S-2399 31 NA NA
S-2402 32 NA NA
S-2407 31 NA NA
S-2424 30 NA NA
S-2457 32 NA NA
S-2461 34 NA NA
S-2480 32 NA NA
S-2493 33 NA NA
S-2498 30 NA NA
S-2501 29 NA NA
S-2505 31 NA NA
S-2509 33 NA NA
February to March 2021a,b
S-7369 31.50 32.74 NA
S-7419 31.36 33.01 NA
S-7451 31.79 33.40 NA
S-7455 31.01 33.16 NA
S-7459 30.63 31.79 NA
S-7463 30.83 32.03 NA
S-7467 31.26 32.39 NA
S-7592 31.21 32.19 NA
S-7600 31.11 32.39 NA
S-7604 31.76 33.44 NA
S-7613 32.14 33.61 NA
S-7678 32.75 34.74 NA
S-7699 29.06 30.15 NA
S-7718 32.71 34.16 NA
S-7722 31.89 33.72 NA
S-7727 31.78 33.10 NA
S-7734 32.72 33.49 NA
S-7742 32.71 33.92 NA
S-7754 32.02 33.40 NA
S-7762 32.07 33.69 NA
S-7369 31.50 32.74 NA
S-7419 31.36 33.01 NA
S-7451 31.79 33.40 NA
S-7455 31.01 33.16 NA
S-7459 30.63 31.79 NA
S-7463 30.83 32.03 NA
S-7467 31.26 32.39 NA
S-7592 31.21 32.19 NA
July 2021a,b
S-12689 28 NA 29
S-12694 28 NA 29
S-12698 30 NA 31
S-12733 28 NA 29
S-12737 26 NA 27
S-12741 28 NA 28
S-12745 29 NA 30
S-12754 27 NA 28
S-12762 30 NA 30
S-12766 29 NA 29
Env_128 31 NA 29
Env_129 33 NA 31
Env_130 31 NA 30
Env_134 33 NA 30
Env_138 32 NA 29
Env_140 30 NA 28
Env_143 31 NA 30
Env_144 29 NA 28
Env_145 30 NA 29
Env_146 36 NA 33
Env_152 35 NA 30
Env_163 29 NA 30
Env_168 32 NA 29
Env_172 33 NA 32
Env_173 30 NA 31
Env_177 30 NA 32
Env_186 30 NA 31
Env_197 29 NA 29
Env_198 30 NA 30
S-12686 31 NA 31
a

Samples were collected during September to December 2020, February to March 2021, and July 2021, and the Cq values for each reaction are shown.

b

NA, no amplification.

TABLE 5.

Detection of Delta lineage in wastewater samples using the Orf8119del test

Sample CoV19 E S157del Orf8119del
September to December 2020a,b
S-2480 32 NA NA
S-2493 33 NA NA
S-2498 30 NA NA
S-2501 29 NA NA
S-2505 31 NA NA
S-2509 33 NA NA
July to August 2021a,b
12689 28 29 31
12694 28 29 31
12698 30 31 32
12733 28 29 31
12737 26 27 30
12741 28 28 31
12745 29 30 32
12754 27 28 30
12762 30 30 32
12766 29 29 32
Env_128 31 29 32
Env_129 33 31 34
Env_130 31 30 32
Env_134 33 30 34
Env_138 32 29 31
Env_140 30 28 31
Env_143 31 30 33
Env_144 29 28 30
Env_145 30 29 31
Env_146 36 33 33
Env_152 35 30 33
Env_163 29 30 32
Env_168 32 29 32
Env_172 33 32 35
Env_173 30 31 34
Env_177 30 32 34
Env_186 30 31 34
Env_197 29 29 32
Env_198 30 30 33
S-12686 31 31 34
a

Randomly selected wastewater samples that were previously tested with the Alpha-Delta assay were subsequently examined using the confirmatory Orf8119del test, and the Cq values for each reaction are shown.

b

NA, no amplification.

DISCUSSION

The emergence of SC-2 variants that have the potential to affect both COVID-19 spread and vaccine evasion poses additional challenges for current intensive diagnostic efforts worldwide. The primary goal of diagnostic SC-2 tests was initially to detect the presence of SC-2 RNA, either in clinical or environmental samples. However, the need for rapid classification of SC-2 samples for their lineage, once a sample is determined as SC-2 positive, becomes essential when attempting to monitor emergence or incursion of new variants into a country, a geographic region, or a community. Surveillance through sequencing is currently the ultimate tool to identify the emergence of new and potentially important variants (20). However, whole-genome sequencing (WGS) is expensive and time-consuming, requires exceptionally skilled personnel, and cannot be readily scaled-up for high-throughput testing compared to rapid molecular tests (16, 21). In this dynamic situation of emerging variants, rapid, cost-effective, and high-throughput identification of circulating SC-2 variants is required.

We recently reported on the development and utilization of a rapid multiplex RT-qPCR assay that successfully classified SC-2 samples as Alpha, Beta, or neither. We demonstrated that it could be readily scaled-up to accommodate high-throughput testing (17). Here, we describe a new assay that combines general detection of SC-2, together with specific classification of the two major variants Alpha and Delta. Previous reports of in-house-selective assays, as well as commercial variant detection kits, rely mostly on the identification of common mutations that are not specific to a particular variant (22–24). Other variant of concern (VOC) detection approaches rely on multistep expensive procedures (25, 26). Such assays are not suitable for rapid determination of the identity of an examined sample based on a single assay. Confirmation of the Alpha-Delta assay results by Sanger and Illumina sequencing reinforced its importance as a first-line rapid and reliable tool for classification of major VOCs, obviating the need for further examination. The identification of both Orf8 and spike gene Delta-specific deletions in samples with insufficient sequencing coverage demonstrated the usefulness of the Alpha-Delta assay in determining the identity of “sequencing-resistant” samples. Such problems can result from low RNA quantity (as evident by the Cq values detailed in Table 2) or other factors that inhibit the sequencing procedure. This is particularly important in classification of wastewater-derived samples, where the target RNA is a pool from multiple individuals, is diluted, and the samples contain chemical inhibitors. The Alpha-Delta assay successfully detected the presence of the Delta variant even in very low RNA concentration, thereby enabling sensitive monitoring of the circulation of this variant during its incursion into Israel. This assay was also used for screening international arrivals, which is particularly important when attempting to prevent the spreading of new variants. While other reported approaches to detect SC-2 variants in international travelers rely on lengthy multistep procedures (25, 26), this assay is rapid (∼70 min from extraction to answer) and can be implemented in most standard laboratories that perform routine PCR tests. This is especially advantageous when an accelerated epidemiological investigation or other actions need to be commenced and complete genomic analysis is not available.

The Orf8119del reaction was used in this study as a confirmatory assay, complementing the first-line Alpha-Delta assay. This is useful to confirm ambiguous results and to provide additional support for lineage classification when sequencing analysis is not available or insufficient. The S157del and the Orf8119del reactions showed similar performance in both clinical and wastewater samples and can therefore be used in the current situation where both deletions are unique for the Delta variant. However, if a new variant will emerge where one of these mutations is present, reassessment of the multiplex combination should be performed in order to adjust the reactions to the required assay specificity. The ability to assemble different reactions into a single multiplex assay is advantageous with respect to the intended use of the assay, as we show here. When the Beta variant was introduced in Israel, we used the combination of the Alpha Beta and inclusive E reactions to classify the examined samples. Upon introduction of the Delta variant, we modified the assay and added a confirmatory reaction to address the pressing need to identify the Delta and Alpha variants but also identify non-Alpha- and non-Delta-positive samples, all in a single 80-min standard RT-qPCR assay. The implementation of such a self-developed method is limited to laboratories that are able to combine research with diagnostic routine rather than high-throughput diagnostic laboratories. Another limitation is the rapid pace in which novel variants are emerging, which, in some cases, may obviate the need to implement such selective assays in routine diagnostic work. The inability to predict which emerging variants will become widespread poses a major obstacle when having to decide which assays to develop.

Nevertheless, this study demonstrates that in addition to implementation of a useful diagnostic tool, the approach of developing a tailor-made variant-specific qPCR assay can improve the SC-2 diagnostic capability in any qPCR-qualified laboratory. Moreover, it can complement variant classification when WGS analysis either fails or is not available. Such an assay can therefore be valuable for epidemiological studies, enabling a quick and affordable assessment of the circulation of major variants in a community or in a geographic region of interest. It is conceivable that the emergence of future SC-2 variants, and possibly other infectious viruses, will warrant further development of such diagnostic tools.

MATERIALS AND METHODS

Ethics statement.

The study was conducted according to the guidelines of the Declaration of Helsinki and was approved by the Institutional Review Board of the Sheba Medical Center (7045-20-SMC). Patient consent was waived as the study used remains of clinical samples, and the analysis used anonymous clinical data.

Preparation of clinical and environmental samples.

Clinical samples were prepared during the laboratory diagnostic routine from nasopharyngeal swabs, as described before (17). RNA was extracted using either the MagNA Pure 96 system (Roche) or the PPS MagLEAD system. The extractions were used for routine clinical diagnostics and were incubated at −80°C for long-term storage prior to the novel assay development. Environmental samples were processed as described before (6, 19). Briefly, sewage samples were centrifuged and filtered before extraction with either Nuclisense EasyMag (bioMérieux) or EMag extraction systems. Immediately after extraction, all samples were preserved at −80°C until PCR testing was performed.

Cell culture.

All SC-2 culturing experiments were performed under biosafety level 3 (BSL3) conditions according to the Sheba Medical Center biosafety guidelines. In order to culture positive SC-2 samples, the medium from the selected collection tubes was filtered using a 0.22-μm filter (Millipore) and used for inoculation of Vero E6 cells. The cells were allowed to reach 70% confluency and were then incubated for 1 h at 37°C with 300 μL of the filtered medium. After 1 h, the medium was removed, and the cells were incubated in modified Eagle medium (MEM-EAGLE) with 2% fetal calf serum (FCS). Cells were monitored daily for the presence of cytopathic effect (CPE). Upon CPE onset, the culture medium was collected, and viral RNA was extracted. Resulting RNA extractions were kept at −80°C until use.

Design of the B.1.671-specific RT-qPCR assays.

Sequences classified as B.1.617 were obtained from the GISAID database (https://www.epicov.org/epi3/frontend#2d1c1e) and were analyzed by alignment with reference sequence NC_045512 to identify mutated regions that can be used for differential analysis. Uniqueness of the selected mutations was confirmed by performing global analysis for the selected mutations in the NextStrain website to identify other lineages with identical mutations (https://nextstrain.org/ncov/gisaid/global). Corresponding primers and probes that detect only the mutated sequences were designed for each region and examined in silico for secondary structure formation, specificity, and compatibility with qPCR assays using Geneious software and the NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The primers and probes used in this study are detailed in Table 1.

RT-qPCR assay.

MDX106 inhibitor-tolerant RT-qPCR mix was from Bioline. Primers and probes were either from Metabion or from Merk-Sigma Israel. Reaction components were assembled as described in Table 6 using the MDX106 inhibitor-tolerant mix. The reactions were run in a CFX-96 thermal cycler (Bio-Rad) using the following parameters: 45°C for 10 min 10 s, 45 cycles of 95°C for 2 min 20 s, 95°C for 4 s, and 60°C for 22 s. Fluorescence was recorded at 60°C at the end of each amplification cycle. Results were analyzed using the CFX Maestro software (Bio-Rad).

TABLE 6.

Reaction mix composition for the S157del and Orf8119del assays

S157del assay
E + S157del + ND3L+ RNase P multiplex mix Final concn Vol/reaction (μL)
Meridian MDX 4× mix 1× 5
H2O 3.73
22003 Fwd 40 μM 500 nM 0.3
22075 Rev 40 μM 500 nM 0.3
21987 probe 20 μM 250 nM 0.3
E-Sarbeco-F1b 40 μM 400 nM 0.25
E-Sarbeco-R 40 μM 400 nM 0.25
E-Sarbeco-P FAM 20 μM 200 nM 0.3
28257 N VOC Fwd 40 μM 600 nM 0.3
2019-nCoV_N1-R 40 μM 600 nM 0.3
2019-nCoV_N1-P HEX 20 μM 300 nM 0.3
RNasP-F 300 nM 0.25
RNasP-R 300 nM 0.25
RNasP-P/Cy5 300 nM 0.17
Total master mix vol   12
RNA sample 8
Total reaction vol 20
Orf8119del assay
E + Orf8119del multiplex mix Final concn Vol/reaction (μL)
Meridian MDX 4× mix 1× 5
H2O 5.65
28225 Fwd 500 nM 0.25
28232 Rev 40 μM 500 nM 0.25
28199 Probe HEX 20 μM 250 nM 0.25
E-Sarbeco-F1b 40 μM 400 nM 0.2
E-Sarbeco-R 40 μM 400 nM 0.2
E-Sarbeco-P FAM 20 μM 200 nM 0.2
Total master mix vol   12
RNA sample 8
Total reaction vol 20

Sanger sequencing of culture-derived and clinical samples.

The N-terminal domain (NTD) of the SC-2 spike gene and the C-terminal domain (CTD) of SC-2 Orf8 were amplified using the primer pairs detailed in Table 1. Primer pair T7-21494 Fwd + Cov19 22475 was used for the spike region amplification, and primer pair pT7 27945 Fwd + 28525 Rev was used for the Orf8 region amplification. PCR was performed using the PCRBIO 1-step go reverse transcription-PCR (RT-PCR) kit according to the manufacturer’s instructions. The PCR products were resolved by 1.2% agarose gel electrophoresis to confirm adequate amplification. Each product was then used as the template for the dye labeling reaction using the BigDye kit according to the manufacturer’s instructions. Sequencing was performed using the ABI 3500 genetic analyzer.

Generation of in vitro transcribed standard RNA.

RNA standards of the reaction targets were designed and synthesized as described before (17). The primers for the amplification of the S157del and Orf8119del reaction targets are detailed in Table 1. RT-PCR was performed with Fwd primers containing the minimal T7 promoter sequence. Resulting PCR products were purified using the Macherey-Nagel NucleoSpin gel and PCR clean-up kit according to the manufacturer’s instructions. The purified products were then used for in vitro transcription with the T7-Megascript kit according to the manufacturer’s instructions (Thermo Fisher). The concentration of the resulting RNA was measured using a NanoDrop spectrophotometer. All reaction products were kept at −80°C until use.

Evaluation of analytical and clinical sensitivity of the Alpha-Delta assay.

In order to facilitate rapid classification of the examined sample, four reactions were combined in a single assay, as detailed below. The inclusive E-sarbeco, which detects SC-2 RNA regardless of the variant (6-carboxyfluorescein [FAM] fluorophore), ND3L reaction, which detects the Alpha variant (HEX channel), S157del reaction, which detects the Delta variant (Texas Red channel), and an endogenous control reaction for the human RNase P gene (Cy5 channel). The details of the E, ND3L, and RNase P reactions were described previously (17). The combined multiplex was termed Alpha-Delta assay. The analytical sensitivity of the Alpha-Delta assay was evaluated using serial dilutions of the in vitro transcribed targets (IVT) of each reaction. All four targets were mixed together in an initial concentration of 10−4 ng/μL, and 10-fold dilutions were prepared in nuclease-free Tris-EDTA (TE) buffer, pH 7.5 (IDT). Validation of the IVT standards was performed by running the E-sarbeco reaction with IVT dilutions together with dilutions of a commercial SC-2 RNA standard (Vircell). The analytic sensitivity of wastewater samples was evaluated by spiking IVT pool dilutions into SC-2-negative wastewater extraction, as described previously (19).

The clinical sensitivity was evaluated by serially diluting positive samples in an extraction of a SC-2-negative sample. Conversion of each in vitro transcribed RNA product from nanograms to copies was performed using the SciencePrimer website calculator (http://www.scienceprimer.com/) according to the RNA molecule size (Fig. S1 in the supplemental material). For target concentration of 500 copies or higher per reaction, 10 repeats were tested. For less than 500 copies per reaction, at least 20 repeats were tested for each target.

Collection and preparation of wastewater samples.

Wastewater collection was based on composite automated sampling for 24 h located in different wastewater treatment plants. The samples were transferred under cold conditions to the lab and were processed within 24 h. Prior to further processing, culture-derived, inactivated Coronavirus OC43 strain (COV OC43) was added to the medium as described previously (6, 19). This was then used as an internal control for the concentration and extraction stages using the OC43 qPCR assay described previously (27). The concentration process uses 20 mL of raw sewage in duplicates. The raw sewage was centrifuged at 4,700 × g for 5 min. The supernatant was transferred to a new tube containing 0.5 g MgCl2 (0.26 M). The tube was gently shaken for 5 min and then filtered through 0.45-μm pore-size, 47-mm diameter electronegative mixed cellulose ester membranes (MCE) membranes (Merck Millipore Ltd.). The membrane was immediately transferred to a new tube containing 3 mL of lysis buffer (NucliSENS easyMAG). The tube was gently shaken to extract the trapped RNA virus. Total nucleic acids were extracted using the NucliSENS easyMAG system (bioMérieux, Marcyl'Etoile, France) according to the manufacturer’s instructions. Extracted nucleic acids were eluted in 55 μL of elution buffer and stored at −70°C until sequencing. All samples were tested for the presence of COV OC43 to verify proper concentration and extraction and absence of significant PCR inhibitors.

Whole-genome sequencing.

A COVID-seq kit was used for library preparation as per the manufacturer’s instructions (Illumina). Library validation and mean fragment size were determined by Tapestation 4200 via a DNA HS D1000 kit (Agilent). Libraries were pooled, denatured, and diluted to 10 pM and sequenced on a NovaSeq system (Illumina).

Data availability.

The nucleotide sequence data of the SARS-CoV-2 variants were deposited in GenBank under accession numbers OM766203 to OM766210.

ACKNOWLEDGMENTS

We wish to acknowledge the members of the Central Virology Laboratory for their technical assistance and helpful discussion of the results obtained in this study.

Footnotes

Supplemental material is available online only.

SUPPLEMENTAL FILE 1
Supplemental material. Download SPECTRUM02176-21_Supp_1_seq1.pdf, PDF file, 1.0 MB (1.1MB, pdf)

Contributor Information

Oran Erster, Email: oran.erster@sheba.health.gov.il.

Miguel Angel Martinez, Fundacio irsiCaixa.

REFERENCES

  • 1.Davies NG, Abbott S, Barnard RC, Jarvis CI, Kucharski AJ, Munday JD, Pearson CAB, Russell TW, Tully DC, Washburne AD, Wenseleers T, Gimma A, Waites W, Wong KLM, van Zandvoort K, Silverman JD, CMMID COVID-19 Working Group, COVID-19 Genomics UK (COG-UK) Consortium, Diaz-Ordaz K, Keogh R, Eggo RM, Funk S, Jit M, Atkins KE, Edmunds WJ. 2021. Estimated transmissibility and impact of SARS-CoV-2 lineage B.1.1.7 in England. Science 372:eabg3055. doi: 10.1126/science.abg3055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Mlcochova P, Kemp S, Dhar MS, Papa G, Meng B, Ferreira IATM, Datir R, Collier DA, Albecka A, Singh S, Pandey R, Brown J, Zhou J, Goonawardane N, Mishra S, Whittaker C, Mellan T, Marwal R, Datta M, Sengupta S, Ponnusamy K, Radhakrishnan VS, Abdullahi A, Charles O, Chattopadhyay P, Devi P, Caputo D, Peacock T, Wattal DC, Goel N, Satwik A, Vaishya R, Agarwal M, Indian SARS-CoV-2 Genomics Consortium (INSACOG), Genotype to Phenotype Japan (G2P-Japan) Consortium, CITIID-NIHR BioResource COVID-19 Collaboration, Mavousian A, Lee JH, Bassi J, Silacci-Fegni C, Saliba C, Pinto D, Irie T, Yoshida I, Hamilton WL, Sato K, Bhatt S, Flaxman S, James LC, Corti D, Piccoli L, Barclay WS, Rakshit P, Agrawal A, Gupta RK. 2021. SARS-CoV-2 B.1.617.2 Delta variant replication and immune evasion. Nature 599:114–119. doi: 10.1038/s41586-021-03944-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zhou D, Dejnirattisai W, Supasa P, Liu C, Mentzer AJ, Ginn HM, Zhao Y, Duyvesteyn HME, Tuekprakhon A, Nutalai R, Wang B, Paesen GC, Lopez-Camacho C, Slon-Campos J, Hallis B, Coombes N, Bewley K, Charlton S, Walter TS, Skelly D, Lumley SF, Dold C, Levin R, Dong T, Pollard AJ, Knight JC, Crook D, Lambe T, Clutterbuck E, Bibi S, Flaxman A, Bittaye M, Belij-Rammerstorfer S, Gilbert S, James W, Carroll MW, Klenerman P, Barnes E, Dunachie SJ, Fry EE, Mongkolsapaya J, Ren J, Stuart DI, Screaton GR. 2021. Evidence of escape of SARS-CoV-2 variant B.1.351 from natural and vaccine-induced sera. Cell 184:2348–2361. doi: 10.1016/j.cell.2021.02.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chakraborty C, Sharma AR, Bhattacharya M, Agoramoorthy G, Lee S-S. 2021. Evolution, mode of transmission, and mutational landscape of newly emerging SARS-CoV-2 variants. mBio 12:e01140-21. doi: 10.1128/mBio.01140-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Rossman H, Shilo S, Meir T, Gorfine M, Shalit U, Segal E. 2021. COVID-19 dynamics after a national immunization program in Israel. Nat Med 27:1055–1061. doi: 10.1038/s41591-021-01337-2. [DOI] [PubMed] [Google Scholar]
  • 6.Bar-Or I, Weil M, Indenbaum V, Bucris E, Bar-Ilan D, Elul M, Levi N, Aguvaev I, Cohen Z, Shirazi R, Erster O, Sela-Brown A, Sofer D, Mor O, Mendelson E, Zuckerman NS. 2021. Detection of SARS-CoV-2 variants by genomic analysis of wastewater samples in Israel. Sci Total Environ 789:148002. doi: 10.1016/j.scitotenv.2021.148002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cele S, Gazy I, Jackson L, Hwa SH, Tegally H, Lustig G, Giandhari J, Pillay S, Wilkinson E, Naidoo Y, Karim F, Ganga Y, Khan K, Bernstein M, Balazs AB, Gosnell BI, Hanekom W, Moosa MS, Network for Genomic Surveillance in South Africa, COMMIT-KZN Team, Lessells RJ, de Oliveira T, Sigal A. 2021. Escape of SARS-CoV-2 501Y.V2 from neutralization by convalescent plasma. Nature 593:142–146. doi: 10.1038/s41586-021-03471-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Lustig Y, Nemet I, Kliker L, Zuckerman N, Yishai R, Alroy-Preis S, Mendelson E, Mandelboim M. 2021. Neutralizing response against variants after SARS-CoV-2 infection and one dose of BNT162b2. N Engl J Med 384:2453–2454. doi: 10.1056/NEJMc2104036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dejnirattisai W, Zhou D, Supasa P, Liu C, Mentzer AJ, Ginn HM, Zhao Y, Duyvesteyn HME, Tuekprakhon A, Nutalai R, Wang B, López-Camacho C, Slon-Campos J, Walter TS, Skelly D, Costa Clemens SA, Naveca FG, Nascimento V, Nascimento F, Fernandes da Costa C, Resende PC, Pauvolid-Correa A, Siqueira MM, Dold C, Levin R, Dong T, Pollard AJ, Knight JC, Crook D, Lambe T, Clutterbuck E, Bibi S, Flaxman A, Bittaye M, Belij-Rammerstorfer S, Gilbert SC, Carroll MW, Klenerman P, Barnes E, Dunachie SJ, Paterson NG, Williams MA, Hall DR, Hulswit RJG, Bowden TA, Fry EE, Mongkolsapaya J, Ren J, Stuart DI, Screaton GR. 2021. Antibody evasion by the P.1 strain of SARS-CoV-2. Cell 184:2939–2954. doi: 10.1016/j.cell.2021.03.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Graham M, Ballard SA, Pasricha S, Lin B, Hoang T, Stinear T, Druce J, Catton M, Sherry N, Williamson D, Howden BP. 2021. Use of emerging testing technologies and approaches for SARS-CoV-2: review of literature and global experience in an Australian context. Pathology 53:689–699. doi: 10.1016/j.pathol.2021.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Pavia CS, Plummer MM. 2021. The evolution of rapid antigen detection systems and their application for COVID-19 and other serious respiratory infectious diseases. J Microbiol Immunol Infect 54:776–786. doi: 10.1016/j.jmii.2021.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Qasem A, Shaw AM, Elkamel E, Naser SA. 2021. Coronavirus disease 2019 (COVID-19) diagnostic tools: a focus on detection technologies and limitations. Curr Issues Mol Biol 43:728–748. doi: 10.3390/cimb43020053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Randazzo W, Cuevas-Ferrando E, Sanjuán R, Domingo-Calap P, Sánchez G. 2020. Metropolitan wastewater analysis for COVID-19 epidemiological surveillance. Int J Hyg Environ Health 230:113621. doi: 10.1016/j.ijheh.2020.113621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ahmed W, Angel N, Edson J, Bibby K, Bivins A, O'Brien JW, Choi PM, Kitajima M, Simpson SL, Li J, Tscharke B, Verhagen R, Smith WJM, Zaugg J, Dierens L, Hugenholtz P, Thomas KV, Mueller JF. 2020. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: a proof of concept for the wastewater surveillance of COVID-19 in the community. Sci Total Environ 728:138764. doi: 10.1016/j.scitotenv.2020.138764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Yaniv K, Ozer E, Shagan M, Lakkakula S, Plotkin N, Bhandarkar NS, Kushmaro A. 2021. Direct RT-qPCR assay for SARS-CoV-2 variants of concern (Alpha, B.1.1.7 and Beta, B.1.351) detection and quantification in wastewater. Environ Res 201:111653. doi: 10.1016/j.envres.2021.111653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.John G, Sahajpal NS, Mondal AK, Ananth S, Williams C, Chaubey A, Rojiani AM, Kolhe R. 2021. Next-generation sequencing (NGS) in COVID-19: a tool for SARS-CoV-2 diagnosis, monitoring new strains and phylodynamic modeling in molecular epidemiology. Curr Issues Mol Biol 43:845–867. doi: 10.3390/cimb43020061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Erster O, Mendelson E, Levy V, Kabat A, Mannasse B, Asraf H, Azar R, Ali Y, Shirazi R, Bucris E, Bar-Ilan D, Mor O, Mandelboim M, Sofer D, Fleishon S, Zukerman NS. 2021. Rapid And high throughput RT-qPCR assay for identification and differentiation between SARS-CoV-2 variants B.1.1.7 and B.1.351. medRxiv. doi: 10.1128/Spectrum.00506-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, Bleicker T, Brünink S, Schneider J, Schmidt ML, Mulders DG, Haagmans BL, van der Veer B, van den Brink S, Wijsman L, Goderski G, Romette JL, Ellis J, Zambon M, Peiris M, Goossens H, Reusken C, Koopmans MP, Drosten C. 2020. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill 25:2000045. doi: 10.2807/1560-7917.ES.2020.25.3.2000045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bar-Or I, Indenbaum V, Weil M, Elul M, Levi N, Aguvaev I, Cohen Z, Levy V, Azar R, Mannasse B, Shirazi R, Buchris E, Zuckerman NS, Sela Brown A, Sofer D, Mor O, Mendelson E, Erster O. 2021. National scale real-time surveillance of SARS-Cov-2 variants dynamics by wastewater monitoring in Israel. medRxiv doi: 10.1101/2021.12.26.21268420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Robishaw JD, Alter SM, Solano JJ, Shih RD, DeMets DL, Maki DG, Hennekens CH. 2021. Genomic surveillance to combat COVID-19: challenges and opportunities. Lancet Microbe 2:e481–e484. doi: 10.1016/S2666-5247(21)00121-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.van Dorp L, Acman M, Richard D, Shaw LP, Ford CE, Ormond L, Owen CJ, Pang J, Tan CCS, Boshier FAT, Ortiz AT, Balloux F. 2020. Emergence of genomic diversity and recurrent mutations in SARS-CoV-2. Infect Genet Evol 83:104351. doi: 10.1016/j.meegid.2020.104351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Migueres M, Lhomme S, Trémeaux P, Dimeglio C, Ranger N, Latour J, Dubois M, Nicot F, Miedouge M, Mansuy JM, Izopet J. 2021. Evaluation of two RT-PCR screening assays for identifying SARS-CoV-2 variants. J Clin Virol 143:104969. doi: 10.1016/j.jcv.2021.104969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lu RJ, Zhao L, Huang BY, Ye F, Wang WL, Tan WJ. 2021. Real-time reverse transcription-polymerase chain reaction assay panel for the detection of severe acute respiratory syndrome coronavirus 2 and its variants. Chin Med J (Engl) 134:2048–2053. doi: 10.1097/CM9.0000000000001687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zelyas N, Pabbaraju K, Croxen MA, Lynch T, Buss E, Murphy SA, Shokoples S, Wong A, Kanji JN, Tipples G. 2021. Precision response to the rise of the SARS-CoV-2 B.1.1.7 variant of concern by combining novel PCR assays and genome sequencing for rapid variant detection and surveillance. Microbiol Spectr 9:e0031521. doi: 10.1128/Spectrum.00315-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Williams GH, Llewelyn A, Brandao R, Chowdhary K, Hardisty KM, Loddo M. 2021. SARS-CoV-2 testing and sequencing for international arrivals reveals significant cross border transmission of high risk variants into the United Kingdom. EClinicalMedicine 38:101021. doi: 10.1016/j.eclinm.2021.101021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Tierling S, Kattler K, Vogelgesang M, Pfuhl T, Lohse S, Lo Porto C, Schmitt B, Nastasja S, Salhab A, Smola S, Walter J. 2021. Rapid base-specific calling of SARS-CoV-2 variants of concern using combined RT-PCR melting curve screening and SIRPH technology. Open Forum Infect Dis 8:ofab364. doi: 10.1093/ofid/ofab364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Dare RK, Fry AM, Chittaganpitch M, Sawanpanyalert P, Olsen SJ, Erdman DD. 2007. Human coronavirus infections in rural Thailand: a comprehensive study using real-time reverse-transcription polymerase chain reaction assays. J Infect Dis 196:1321–1328. doi: 10.1086/521308. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SUPPLEMENTAL FILE 1

Supplemental material. Download SPECTRUM02176-21_Supp_1_seq1.pdf, PDF file, 1.0 MB (1.1MB, pdf)

Data Availability Statement

The nucleotide sequence data of the SARS-CoV-2 variants were deposited in GenBank under accession numbers OM766203 to OM766210.


Articles from Microbiology Spectrum are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES