Abstract
A multidrug-resistant Salmonella enterica serotype [4,5,12:i:−] clone carried a class 1 integron harboring dfrA12 and aadA2 gene cassettes and blaTEM-1, aac(3)-IV, cmlA1, and tetA genes located in large plasmids of about 140 kb (carrying spv) or 120 kb (lacking spv). Several segregants, lacking multidrug resistance, contained a plasmid smaller than the parental one and no longer hybridized with probes for the lost resistances. The genes mediating resistance to ampicillin, chloramphenicol, and tetracycline in the [4,5,12:i:−] clone are different from those found in the pentadrug-resistant serotype Typhimurium DT104 clone.
Multidrug-resistant Salmonella enterica serotype [4,5,12:i:−] isolates emerged in 1997 in Spain (5). DNA fingerprinting analysis of 29 isolates (27 collected in the Principality of Asturias between May 1997 and April 2000 and the reference strains CNM4IC and CNM9IC) had shown that they fall into a single genetic lineage or clone which seems to be closely related to some contemporary serotype Typhimurium lineages causing human salmonellosis (reference 10 and unpublished data). All [4,5,12:i:−] isolates expressed resistance to ampicillin (AMP), chloramphenicol (CHL), gentamicin (GEN), streptomycin (STR), sulfadiazine (SUL), tetracycline (TET), and trimethoprim (TMP) except two isolates which were TET susceptible. These isolates harbored two or three small cryptic plasmids and one large plasmid carrying (pUO-SVR3 [plasmid of University of Oviedo-Salmonella virulence resistance]) or lacking (pUO-SR4) spv loci (10) (Table 1). The objective of this study was to investigate the molecular basis of the multidrug resistance in serotype [4,5,12:i:−] and ascertain the relations between resistance genes, integrons, and plasmids. For this, several experimental approaches were made, and the results were compared with those obtained for Typhimurium DT104 LSP14/92 (9), used as the type strain of a pentadrug-resistance epidemic clone of concern in many countries (3, 7, 8, 9, 11, 15).
TABLE 1.
Features of multidrug-resistant Salmonella serotype [4,5,12:i:−] isolates used in curing experiments and their segregants
| Strain/PP segregant typea | AMPb tem1-likec | CHL cmlA1 | GEN aac(3)-IV | STR aadA2d | SUL sul1e | TMP dfrA12d | TET tetA | qacEΔ1e | spvABC | Integron
|
|
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1,900 bp | 150 bp | ||||||||||
| LSP389/97 PPI | + | + | + | + | + | + | + | ||||
| + | + | + | + | + | + | + | + | + | + | + | |
| s1 (1f) | + | + | + | + | + | + | − | ||||
| + | + | + | + | + | + | − | + | + | + | + | |
| s2 (10) | + | + | − | + | + | − | + | ||||
| + | + | − | + | + | − | + | + | + | − | + | |
| s3 (13) | − | + | − | + | + | − | + | ||||
| − | + | − | + | + | − | + | + | + | − | + | |
| s4 (2) | − | − | − | − | + | − | + | ||||
| − | − | − | − | + | − | + | + | + | − | + | |
| LSP272/98 PPII | + | + | + | + | + | + | − | ||||
| + | + | + | + | + | + | − | + | − | + | + | |
| s5 (1) | − | − | − | + | + | + | − | ||||
| − | − | − | + | + | + | − | + | − | + | + | |
| s6 (13) | − | + | − | + | + | − | − | ||||
| − | + | − | + | + | − | − | + | − | − | + | |
| s7 (1) | − | + | − | − | + | − | − | ||||
| − | + | − | − | + | − | − | + | − | − | + | |
| LSP132/98 PPIII | + | + | + | + | + | + | + | ||||
| + | + | + | + | + | + | + | + | + | + | + | |
| s8 (17) | − | − | − | − | + | − | + | ||||
| − | − | − | − | + | − | + | + | + | − | + | |
| LSP457/98 PPIV | + | + | + | + | + | + | + | ||||
| + | + | + | + | + | + | + | + | + | + | + | |
| s9 (1) | + | − | − | + | + | + | + | ||||
| + | − | − | + | + | + | + | + | + | + | + | |
| s10 (1) | − | − | − | + | + | + | + | ||||
| − | − | − | + | + | + | + | + | + | + | + | |
PP, plasmid profiles described in reference 10. PPI is represented by 20 clinical and 2 pork isolates (including CNM4IC); PPII, PPIII, and PPIV are represented by 4 (including CNM9IC), 1, and 2, clinical isolates, respectively. PPI, PPIII, and PPIV include pUO-SVR3, while PPII includes pUO-SR4.
Resistance.
PCR product generated with the primers compiled in Table 2.
Located in variable region of class 1 integron defined by 1,900-bp amplicon.
Located in 3′CS of class 1 integrons.
Number of segregants, out of 100 colonies tested, presenting the same resistance phenotype as indicated PCR product.
Determination of resistance genes.
To determine the genes for AMP, GEN, and STR resistance, the [4,5,12:i:−] isolates were tested, by disk diffusion assay (13) and taking into account results described elsewhere (2, 16, 17), with (i) amoxicillin-clavulanic acid (AMC; 30 μg), carbenicillin (CAR; 100 μg), cephalothin (30 μg), ceftazidime (30 μg), cefotaxime (30 μg), imipenem (10 μg), oxacillin (OXA; 1 μg), and piperacillin (PIP; 100 μg) and (ii) amikacin (30 μg), apramycin (APR; 100 μg), 5-episisomycin (5EPI; 10 μg), fortimycin (100 μg), kanamycin (30 μg), netilmicin (NET) and its derivatives 2′-NET- and 6′-NET (100 μg), tobramycin (TOB; 10 μg), and spectinomycin (SPT; 10 μg). PCR amplication was performed using specific primers (Table 2). All [4,5,12:i:−] isolates showed resistance to AMP-CAR-OXA, GEN-APR-5EPI-NET-2′NET-6′NET-TOB, and STR-SPT and generated amplification products with the blaTEM, aac(3)-IV, and aadA primers. Typhimurium LSP14/92 showed resistance to AMP-CAR-PIP-OXA-AMC and STR-SPT and generated the expected amplification products with the blaCARB and aadA primers. PCR for other resistance genes using [4,5,12:i:−] isolates generated amplification products with the cmlA, dfrA12, tetA, and sul1 primers, while Typhimurium LSP14/92 generated products with the floR, tetG, and sul1 primers. Sequencing of the 460-bp blaTEM and 435-bp cmlA amplicons generated by LSP389/97, conducted described elsewhere (9), confirmed the presence of blaTEM-1-like and cmlA1 genes (accession numbers AF126482.1 and U12338, respectively). These data support the finding that the genes implicated in AMP, CHL, and TET resistance in the [4,5,12:i:−] clone differ from those reported for the pentadrug-resistant Typhimurium DT104 clone.
TABLE 2.
PCR primers and conditions used in this work
| Region or gene (resistance) | Primer
|
Expected amplicon | PCR conditionsa
|
||||
|---|---|---|---|---|---|---|---|
| Nameb | Sequence (5′ to 3′) | EMBL GenBank accession no. | Reference | Ta (°C) | ta (min:s) | ||
| Integron | 5′CS/3′CS | GGCATCCAAGCAGCAAGC/AAGCAGACTTGACCTGAT | U12338 | 12 | Variable | 55 | 2:30 |
| Integrase | Int1-F/B | GCCTTGCTGTTCTTCTAC/GATGCCTGCTTGTTCTAC | X12870 | 11 | 558 bp | 55 | 0:30 |
| qacEΔ1 | qacEΔ1-F/B | ATCGCAATAGTTGGCGAAGT/CAAGCTTTTGCCCATGAAGC | X15370 | 15 | 250 bp | 60–65 | 0:20 |
| sul1 (SUL) | sul1-F/B | CTTCGATGAGAGCCGGCGGC/GCAAGGCGGAAACCCGCGCC | X12869 | 15 | 436 bp | 65 | 0:30 |
| blaCARB (AMP) | OC-1/2c | AATGGCAATCAGCGCTTC/GGGGCTTGATGCTCACTC | 1 | 566 bp | 55–60 | 0:30 | |
| blaTEM (AMP) | OT-1/2c | TTGGGTGCACGAGTGGGT/TAATTGTTGCCGGGAAGC | 1 | 503 bp | 55 | 0:30 | |
| blaOXA (AMP) | OO-1/2c | ACCAGATTCAACTTTCAA/TCTTGGCTTTTATGCTTG | 7 | 598 bp | 50–55 | 0:30 | |
| aac(3)-IV (GEN) | aac(3)-IV F/B | GTTACACCGGACCTTGGA/AACGGCATTGAGCGTCAG | X01385 | This work | 674 bp | 55–60 | 0:40 |
| aadA (STR-SPT) | aadA1a-F/B | GTGGATGGCGGCCTGAAGCC/ATTGCCCAGTCGGCAGCG | M10241 | 15 | 526 bp | 70 | 0:30 |
| dfrA1-like (TMP) | dfrA15-F/B | GTGAAACTATCACTAATGG/CCCTTTTGCCAGATTTGG | Z83311 | 9 | 473 bp | 55 | 0:30 |
| dfrA12 (TMP) | dfrA12-F/B | ACTCGGAATCAGTACGCA/GTGTACGGAATTACAGCT | AF175203 | This work | 462 bp | 55 | 0:30 |
| cat (CHL) | cat-F/B | CCTGCCACTCATCGCAGT/CCACCGTTGATATATCCC | U46780 | This work | 623 bp | 60 | 0:30 |
| cmlA (CHL) | cmlA-F/B | TGTCATTTACGGCATACTCG/ATCAGGCATCCCATTCCCAT | M64556 | J. Ruíz and J. Vila, personal communication | 435 bp | 55 | 0:30 |
| floR (CHL) | paspp-flo-F/B | CACGTTGAGCCTCTATAT/ATGCAGAAGTAGAACGCG | AF071555 | 11 | 868 bp | 55 | 0:40 |
| tetA (TET) | tetA-F/B | GCTACATCCTGCTTGCCT/CATAGATCGCCGTGAAGA | X61367 | 11 | 210 bp | 55–60 | 0:20 |
| tetG (TET) | tetG-F/B | GCTCGGTGGTATCTCTGC/AGCAACAGAATCGGGAAC | S52437 | 11 | 500 bp | 55 | 0:30 |
| spvAd | spvA-F/B | GTCAGACCCGTAAACAGT/GCACGCAGAGTACCCGCA | 517162 | This work | 604 bp | 60 | 0:30 |
| spvBd | spvB-F/B | ACGCCTCAGCGATCCGCA/GTACAACATCTCCGAGTA | 517162 | This work | 1,063 bp | 60 | 1:00 |
| spvCd | spvC-F/B | ACTCCTTGCACAACCAAATGCGGA/TGTCTTCTGCATTTCGCCACCATCA | 517162 | 10 | 424 bp | 60 | 0:30 |
PCR assays were performed as described elsewhere (9). Ta, annealing temperature; te, elongation time.
F: forward; B: backward.
Shorter than original one primer.
Salmonella plasmid virulence gene.
Detection of integrons.
Detection of class 1 integrons and the resistance genes located therein was performed by PCR amplification with specific primers (Table 2). All [4,5,12:i:−] isolates carried two integrons defined by PCR products of 1,900 and 150 bp, sizes indicating that only in the first could gene cassettes carrying resistance genes be inserted. Class 1 integrons in their conserved regions, in addition to the integrase (intI1) gene, usually contain genes encoding resistance to quaternary ammonium compounds and ethidium bromide (qacEΔ) and sulfonamides (sul1) (6, 12, 14). The presence of these genes was confirmed in all [4,5,12:i:−] isolates by PCR. Sequencing of the 1,900-bp amplicon from LSP389/97 confirmed the presence of the dfrA12 (dhfrXII) gene cassette near the 5′ conserved region (5′CS), an open reading frame with an unknown function and a 59-bp element, and the aadA2 gene cassette near the 3′CS (accession number AF284063). Intragenic primers for dfrA12 were used to confirm that this gene, together with aadA2, was carried in the 1,900-bp amplicons from all [4,5,12:i:−] isolates studied. Typhimurium LSP14/92 carried two other integrons, with variable regions previously defined as 1,200-bp pse1 and 1,000-bp aadA2 (9).
Determination of relationships between drug resistance and plasmids.
In a previous work, we found that when two representative [4,5,12:i:−] isolates were grown in the presence of sodium dodecyl sulfate (1%), some cells (segregants) lost AMP, CHL, GEN, and TMP resistance and their large plasmids appeared to be smaller (10). To confirm the apparent relationship between drug resistance and plasmids, as well as the possible relationship between integrons and plasmids, we used the following approaches.
(i) New curing experiments using representative isolates of the four plasmid profiles.
For each experiment we analyzed about 100 colonies, finding that some colonies had lost some resistances and could be grouped in segregant types. A strong correlation between phenotype and genotype was found in all segregants, and one colony of each type was selected for the following experiments (Table 1).
(ii) Integron analysis.
Using qacEΔ1, sul1, and 5′CS/3′CS primers, all segregant types generated amplification products of about 250, 430, and 150 bp, respectively, but only some of them generated products of 1,900 bp with dfrA12 primers and expressed TMP resistance. Only some of the TMP-susceptible segregants were also STR susceptible indicating that more than one gene was implicated in STR resistance.
(iii) Plasmid analysis.
None of the small cryptic plasmids was eliminated by curing, and all pUO-SVR3 segregants yielded an amplification product with spv primers. In segregants lacking the 1,900-bp dfrA12-aadA2 integron and the other resistance genes, pUO-SVR3 or pUO-SR4 derivatives were smaller than the original plasmids.
(iv) Plasmid DNA hybridization.
Hybridization using DNA from parents and representative segregants was performed with probes for the presumably lost genes and spvC. The results (Fig. 1) confirmed that 150- and 1,900-bp dfrA12-aadA2 integrons, as well as blaTEM-1-like, aac(3)-IV, cmlA1, tetA, and spvC genes, were plasmid located.
FIG. 1.
Analysis of plasmids from representative Salmonella serotype [4,5,12:i:−] isolates used in curing experiments and from some of the segregates obtained. (A) Plasmid profiles; (B) hybridization of the plasmids shown in panel A with gene-specific probes. Lanes T, Typhimurium LSP14/92; lanes P1 and P2, [4,5,12:i:−] LSP389/97 and LSP272/98, respectively; lanes s4 to s8, segregant types. The features of the [4,5,12:i:−] organisms shown are compiled in Table 1. Arrowheads, chromosomal (Chr) DNA.
Plasmids, complete integrons, and gene cassettes are elements with potential for individual and joint horizontal transfer (4, 6, 14). The transfer of multidrug-resistant Salmonella plasmids, or the resistance gene cluster(s) therein, to other salmonellae or other pathogenic bacteria in animal reservoirs or human hosts could result in serious problems. The relative arrangement of the integrons with the other resistance genes and the spv loci in plasmids carried by [4,5,12:i:−] organisms remain to be determined.
Acknowledgments
We thank M. A. González-Hevia (Laboratotio de Salud Pública, LSP, Principado de Asturias, Spain) and M. A. Usera and A. Echeitia (Centro Nacional de Microbiología, CNM, Madrid, Spain) for Salmonella [4,5,12:i:−] isolates; we thank J. Ruiz and J. Vila for the design of cmlA primers and advice regarding chloramphenicol resistance analysis.
This work was supported by a grant from the Fondo de Investigación Sanitaria (FIS 00/1084), Ministerio de Sanidad y Consumo, Spain. S. Soto is the recipient of a grant of Formación de Personal Investigador (Ref AP98), Ministerio de Educación y Cultura, Spain.
REFERENCES
- 1.Arlet G, Phillippon A. Construction by polymerase chain reaction and intragenic DNA probes for three main types of transferable β-lactamases (TEM, SHV, CARB) FEMS Microbiol Lett. 1991;82:19–26. doi: 10.1016/0378-1097(91)90414-6. [DOI] [PubMed] [Google Scholar]
- 2.Bush K, Jacoby G A, Medeiros A A. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother. 1995;39:1211–1233. doi: 10.1128/aac.39.6.1211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Briggs C E, Fratamico P. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob Agents Chemother. 1999;43:846–849. doi: 10.1128/aac.43.4.846. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Davies J. Inactivation of antibiotics and the dissemination of resistance genes. Science. 1994;264:375–382. doi: 10.1126/science.8153624. [DOI] [PubMed] [Google Scholar]
- 5.Echeitia M A, Aladueña A, Cruchaga S, Usera M A. Emergence and spread of an atypical Salmonella enterica subsp: enterica serotype 4,5,12:i:− strain in Spain. J Clin Microbiol. 1999;37:3425. doi: 10.1128/jcm.37.10.3425-3425.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Fluit A C, Schmitz F J. Class 1 integrons, gene cassettes, mobility, and epidemiology. Eur J Clin Microbiol Infect Dis. 1999;18:761–770. doi: 10.1007/s100960050398. [DOI] [PubMed] [Google Scholar]
- 7.Gallardo F, Ruiz J, Marco F, Towner K J, Vila J. Increase of incidence of resistance to ampicillin, chloramphenicol and trimethoprim in clinical isolates of Salmonella serotype Typhimurium with investigation of molecular epidemiology and mechanisms of resistance. J Med Microbiol. 1999;48:367–374. doi: 10.1099/00222615-48-4-367. [DOI] [PubMed] [Google Scholar]
- 8.Glynn M K, Boop C, Dewitt W, Dabney P, Moktar M, Angulo F. Emergence of multidrug-resistant Salmonella enterica serotype Typhimurium DT104 infections in the United States. N Engl J Med. 1998;338:1333–1338. doi: 10.1056/NEJM199805073381901. [DOI] [PubMed] [Google Scholar]
- 9.Guerra B, Soto S M, Cal S, Mendoza M C. Antimicrobial resistance and spread of class 1 integrons among Salmonella serotypes. Antimicrob Agents Chemother. 2000;44:2166–2169. doi: 10.1128/aac.44.8.2166-2169.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Guerra B, Laconcha I, Soto S M, González-Hevia M A, Mendoza M C. Molecular characterization of emergent multiresistant Salmonella enterica serotype [4,5,12:i:−] organisms causing human salmonellosis. FEMS Microbiol Lett. 2000;190:341–347. doi: 10.1111/j.1574-6968.2000.tb09309.x. [DOI] [PubMed] [Google Scholar]
- 11.Lai-King N G, Mulvey M R, Martin I, Petters G A, Johnson W. Genetic characterization of antimicrobial resistance in Canadian isolates of Salmonella serovar Typhimurium DT104. Antimicrob Agents Chemother. 1999;43:3018–3021. doi: 10.1128/aac.43.12.3018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Levèsque C, Pyche L, Larose C, Roy P H. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother. 1995;39:85–191. doi: 10.1128/aac.39.1.185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standards and M2–A5. Wayne, Pa: National Committee for Clinical Laboratory Standards; 2000. [Google Scholar]
- 14.Recchia G D, Hall R M. Gene cassettes: a new class of mobile element. Microbiology. 1995;141:3015–3027. doi: 10.1099/13500872-141-12-3015. [DOI] [PubMed] [Google Scholar]
- 15.Sandvang D, Aarestrup F M, Jensen L B. Characterization of integrons and antibiotic resistance genes in Danish multiresistant Salmonella typhimurium DT104. FEMS Microbiol Lett. 1997;160:37–41. doi: 10.1111/j.1574-6968.1998.tb12887.x. [DOI] [PubMed] [Google Scholar]
- 16.Shaw K J, Sabatelli F J, Naples L, Mann P, Hare R S, Miller G. The application of molecular techniques for the study of aminoglycoside resistance. Methods Mol Med. 1998;15:555–577. doi: 10.1385/0-89603-498-4:555. [DOI] [PubMed] [Google Scholar]
- 17.Terán F J, Suárez J E, Mendoza M C. Cloning, sequencing, and use as a molecular probe of a gene encoding an aminoglycoside 6′-N-acetyltransferase of broad substrate profile. Antimicrob Agents Chemother. 1991;35:714–719. doi: 10.1128/aac.35.4.714. [DOI] [PMC free article] [PubMed] [Google Scholar]