Skip to main content
PMC home page
Poultry Science logoLink to Poultry Science
. 2022 Mar 15;101(6):101857. doi: 10.1016/j.psj.2022.101857

Influence of dietary vitamin E and selenium supplementation on broilers subjected to heat stress, Part I: Growth performance, body composition and intestinal nutrient transporters

Ali Calik *,#, Nima K Emami *,†, Mallory B White *, Maria C Walsh ‡, Luis F Romero ‡,1, Rami A Dalloul *,†,2
PMCID: PMC9048119  PMID: 35461066

Abstract

High ambient temperature is one of the most common stressors in modern poultry production, resulting in reduced feed intake, weight gain, and increased mortality. This study evaluated the effects of vitamin E (Vit E) and organic selenium (Se) supplementation on performance, body composition, core body temperatures, and mRNA abundance of nutrient transporters in the jejunum of broilers exposed to daily 4-h elevated temperature during d 28 to 35. A total of 640 Cobb male birds were randomly allocated to 32 floor pens in a 2 × 2 factorial arrangement that included ambient temperature (thermoneutral, [TN]; or heat stress, [HS]) and dietary treatments (basal diet or Vit E + Se). Four rooms were used (2 TN and 2 HS) each housing half of the 8 replicate pens per group. Vit E and organic Se were added to the basal diet at the rate of 250 mg/kg and 1 mg/kg diet, respectively. Data were subjected to a 2-way ANOVA using the GLM procedure of JMP (SAS). During the HS period, birds fed the Vit E/Se diet had significantly lower mortality compared to nonsupplemented group (1.92% vs. 7.01%). Moreover, dietary Vit E/Se supplementation had a significant effect on performance by increasing BWG, FI, and European production efficiency factor (EPEF) during the entire experimental period (d 0–35). Dietary Vit E and Se supplementation significantly increased carcass, tissue, lean, and fat weights as well as bone mineral content (BMC) and bone mineral density (BMD) on d 35. Birds fed Vit E/Se supplemented diet had significantly lower (P = 0.010) core body temperature compared to birds fed the basal diet on d 30. Dietary treatment did not influence mRNA abundance of PepT1, SGLT1, or NaPi-IIb on d 28 or d 35. However, HS significantly upregulated levels of PepT1 and NaPi-IIb (P < 0.001) and downregulated that of SGLT1 (P = 0.017) on d 28. In conclusion, dietary Vit E and Se supplementation significantly improved broiler growth performance and carcass composition, and reduced heat-related mortality and core body temperature (on d 30) without influencing the mRNA abundance of intestinal nutrient transporters.

Key words: broiler, heat stress, nutrient transporter, selenium, vitamin E

INTRODUCTION

Modern poultry production is associated with a range of stressors including environmental, nutritional, and biological, and such stress factors inevitably influence the animal's physiology and performance with varying degrees (Surai et al., 2019). High ambient temperature is one of the most common stressors in commercial poultry production, resulting in reduced feed intake and body weight gain, and increased mortality (Lara and Rostagno, 2013; Emami et al., 2021). Because of their physiological state and greater metabolic activity, broilers are more susceptible to temperature-associated environmental challenges (Sahin et al., 2009; Lara and Rostagno, 2013; Emami et al., 2020). In addition to its effect on bird performance, it also causes alterations in intestinal nutrient transporters (Habashy et al., 2017), gut permeability and function (Slawinska et al., 2016), immune response (Habibian et al., 2014; Emami et al., 2021) and the endocrine system including cortisol and thyroid hormones (Sohail et al., 2010). Moreover, elevated ambient temperatures have been reported to cause undesirable changes in carcass characteristics (De Antonio et al., 2017; Emami et al., 2021), bone mineralization (Yan et al., 2019), and meat quality (Cheng et al., 2018).

Exposure to high ambient temperature elevates the level of reactive oxygen species (ROS) and causes biological and physiological disturbances in cellular functions (Emami et al., 2020). An uncontrolled increase in ROS level leads to free radical mediated chain reactions, which further causes lipid peroxidation and oxidative damage to proteins, DNA, and RNA (Hai et al., 2006; Harsini et al., 2012; He et al., 2018). Birds respond to such conditions by reprogramming several defense mechanisms including antioxidant enzymes, heat-shock proteins, and cytokines to alleviate or reduce the negative effects of HS (Tan et al., 2010; Slimen et al., 2016). Moreover, environmental and nutritional strategies are available to improve the efficiency of these defense mechanisms (Flees et al., 2021; Greene et al., 2021). Among the strategies for coping with the impact of HS in animals, dietary interventions through supplementation of several feed additives including vitamins (e.g., A, E, and C) and minerals (e.g., zinc, selenium) can be utilized to improve the host's antioxidant defense mechanism (Sahin and Kucuk, 2003; Habibian et al., 2016; He et al., 2018).

Vitamin E (Vit E) is a biological antioxidant and a free radical scavenger that protects the cells and lipid rich-membranes from oxidative damage (Traber and Atkinson, 2007; Gao et al., 2010) and is considered as the core of the antioxidant system (Surai et al., 2019). Among the four tocopherols and four tocotrienols (designated as α-, β-, γ-, and δ-), only the α-tocopherol form has the biological activity to meet the animal's Vit E requirements. Dietary supplementation of various levels of Vit E can improve broiler performance (Sahin et al., 2002; Attia et al., 2017) and reduce the oxidative stress experienced under high environmental temperatures (Sahin et al., 2001).

Selenium is an essential trace mineral that plays a pivotal role within several metabolic pathways. It is a component of selenium-dependent antioxidant enzymes such as glutathione peroxidases (GSH-Px) (Habibian et al., 2015). Along with superoxide dismutase (SOD) and catalase (CAT), this enzyme protects the cells against free radicals and lipid peroxides especially under stress conditions (Sahin and Kucuk, 2001). Since the plant-based feed ingredients used in the diet are deficient in Se, inorganic (sodium selenite) and organic (selenomethionine and selenoyeast) forms are used to supply broiler needs (Habibian et al., 2015). Thus, these Se sources are usually added at 0.2 to 0.3 mg/kg diet to meet the requirements without relying on Se content of the feed ingredients for optimum broiler growth. The maximum allowable level of organic Se sources in complete feed is 0.3 mg/kg in US (FDA, 2017) and 0.2 mg/kg in Europe (EFSA, 2011). However, dietary addition of Se above the recommended level might have beneficial effects on broiler performance, oxidative status, and immune response during a stress challenge (Surai, 2018).

Elevated ambient temperature can impair the absorption of vitamins A, C, and E and reduce tissue mineral concentrations including iron, zinc, and selenium (Sahin and Kucuk, 2003; Harsini et al., 2012; Habibian et al., 2016). In line with published data suggesting the beneficial and protective effects of dietary Vit E and Se during HS conditions, the present study aimed to investigate the effects of dietary supplementation of Vit E and Se on broiler growth performance, mortality rate, body composition and mRNA abundance of several nutrient transporters in the jejunum.

MATERIALS AND METHODS

Experimental Diets, Birds, and Management

This project was approved and conducted under the guidelines of the Virginia Tech Institutional Animal Care and Use Committee. A total of 640 one-day-old Cobb male chicks were randomly allocated to 32 floor pens in a 2 × 2 factorial arrangement that included ambient temperature (thermoneutral, [TN]; or heat stress, [HS]) and dietary treatments (basal diet or Vit E + Se) as main factors. Four rooms were used (2 TN and 2 HS) each housing half of the 8 replicate pens per group. For the Vit E and Se diet, the basal diet was supplemented with 250 mg/kg Vit E (Rovimix E50, DSM Nutritional Products, Basel, Switzerland) and 1 mg/kg organic Se (Sel-Plex, Alltech Inc., Nicholasville, KY).

The birds were raised in a controlled environment for 35 d. The starter and grower diets were based on corn-soybean meal formulations and provided to the birds from d 0 to 21 and d 21 to 35 of age, respectively (Table 1). All diets were formulated to meet or exceed the NRC (1994) nutrient recommendations. Each pen was equipped with a plastic bucket feeder and an automatic nipple drinker. Water and experimental diets (in mash form) were provided ad libitum throughout the study period. All chicks were weighed on a per pen basis and feed intake (FI) was recorded at weekly intervals. Any mortality was removed and recorded (including bird weight) twice daily. Body weight gain (BWG), FI, and feed conversion ratio (FCR) were subsequently calculated based on performance values. European production efficiency factor (EPEF) was calculated using the following formula: [(liveability (%) × live weight (kg) / age (d) × FCR) × 100].

Table 1.

Basal diet formulation for starter (d 0–21) and grower (d 22–35) phases.

Ingredient, g/kg 0-21 d 22-35 d
Corn 59.73 64.44
Soybean meal, CP 48% 33.20 28.00
Vegetable oil 3.00 4.20
Limestone 0.68 0.60
Dicalcium phosphate 2.20 1.80
DL-Methionine (98%) 0.20 0.13
L-Lysine HCI (78%) 0.24 0.12
L-Threonine 0.09 0.05
Salt 0.30 0.30
Vit-Min (NB3000)1,2 0.36 0.36
Total 100.00 100.00
Chemical composition (Calculated)
 Dry Matter, % 87.75 87.75
 Crude Protein, % 21.00 18.75
 AMEn, kcal/kg 3060 3185
 Lysine, % 1.32 1.08
 Dig. Lysine, % 1.18 0.95
 Methionine + cysteine, % 0.88 0.76
 Dig. Methionine + cysteine, % 0.78 0.66
 Threonine, % 0.90 0.77
 Dig. Threonine, % 0.77 0.66
 Calcium, % 0.90 0.76
 Available phosphorus, % 0.45 0.38
Open in a new tab
1

Vitamins supplied per kg diet: Retinol, 3.33 mg; Cholecalciferol, 0.1 mg; α-tocopherol acetate, 23.4 mg, Vitamin K3, 1.2 mg; Thiamine, 1.6 mg; Riboflavin, 9.5 mg; Niacin, 40 mg; Pantothenic acid, 9.5 mg; Pyridoxine, 2 mg; Folic acid, 1 mg; Vitamin B12, 0.016 mg; Biotin, 0.05 mg; Choline, 556 mg.

2

Minerals supplied per kg diet: Mn, 144 mg; Fe, 72 mg; Zn, 144 mg; Cu, 16.2 mg; I, 2.15 mg; Se 0.22 mg.

Heat Stress Protocol

The HS protocol was performed during the last week of the experiment (d 28–d 35). For the HS groups, temperature was raised and maintained at 35 ± 1°C from 10 AM to 2 PM (4 h), then reduced to 25 ± 1°C for the remainder of the day. Relative humidity was monitored and maintained at <50%. Birds in the TN groups were kept under recommended temperature (25 ± 1°C). The birds’ core body temperature (2 birds/pen) was monitored daily with a rectal probe during the HS period (d 28–35).

Carcass Composition Analysis (DEXA)

Dual Energy X-Ray Absorptiometry (DEXA) analysis was performed on 3 birds per pen on d 35 to assess various measurements of carcass/body composition. Birds were individually wing-banded, sacrificed by cervical dislocation and subsequently defeathered. Carcasses were stored at –20°C until DEXA analysis. Birds were thawed and 10 birds were scanned at a time using a GE Healthcare Lunar Prodigy Advance System (General Electric, Madison, WI). Individual bird scans were used to calculate measurements.

Total RNA Extraction and Reverse Transcription

On d 28 and d 35, 2 birds/pen were selected, euthanized, and jejunal sections (1 cm) were excised and snap-frozen in liquid nitrogen to later assess the mRNA abundance of several nutrient transporters. A 20 to 30 mg aliquot of jejunal tissues was weighed into a 2 mL microcentrifuge tube and homogenized in 600 μL TRI Reagent (Zymo Research, Irvine, CA) by a TissueLyser II (Qiagen, Valencia, CA). Total RNA was extracted from the homogenate using the Direct-zol RNA Miniprep Plus Kit (Zymo Research, Irvine, CA) according to the manufacturer's recommendations. Total RNA concentration was determined at optical density (OD) of 260 using a NanoDrop-1000 (Thermo Fisher Scientific, Waltham, MA), and RNA purity was verified by evaluating the 260/280 OD ratios. RNA integrity was evaluated by gel electrophoresis on 1.5% agarose gel in 0.5 × TAE buffer. After extraction, 2 µg of total RNA were used to synthesize first-strand cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) according to the manufacturer's recommendation and the cDNA was stored at −20°C until further analysis.

Quantitative Real-Time PCR

The mRNA abundance of peptide transporter 1 (PePT1), sodium-glucose cotransporter 1 (SGLT1), and type IIb sodium-phosphate cotransporter (NaPi-IIb) were determined by quantitative real-time PCR (ABI 7500 Fast Real-Time PCR System, Applied Biosystems, Foster City, CA) using Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA). Details of primer sets are provided in Table 2. Product specificity was confirmed by analysis of the melting curves produced by the ABI 7500 software (version 2.0.3). mRNA abundance was analyzed using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an endogenous control. Average mRNA abundance relative to GAPDH for each sample was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001). The calibrator for each gene was the average ΔCt value from the negative control group for each sampling day.

Table 2.

Sequences of primer pairs used for amplification of target and reference genes.

Gene1 Primer Sequence Size Acc (Reference)
PepT1 CCCCTGAGGAGGATCACTGTT
CAAAAGAGCAGCAGCAACGA		 66 NM_204365
(Kaminski and Wong, 2018)
SGLT1 GCCATGGCCAGGGCTTA
CAATAACCTGATCTGTGCACCAGTA		 71 NM_001293240
(Kaminski and Wong, 2018)
NaPi-IIb GGCTGGCATGACTTTCGTTG
GGGTGAGGGGATAAGAACGC		 107 NM_204474
Open in a new tab
1

PepT1: peptide transporter-1 (SLC15A1), SGLT1: sodium-glucose cotransporter-1 (SLC5A1), NaPi-IIb: type IIb sodium-phosphate cotransporter (SLC34A2).

For each gene, the primer sequence for forward (F) and reverse (R) (5ʹ-3ʹ) primers, the amplicon size (bp) and the NCBI Accession number (Acc) used for the primer design are listed.

Statistical Analysis

Data were subjected to a 2-way ANOVA using the GLM procedure of JMP (Pro 13). The model included ambient temperature (TN or HS) and dietary treatments (basal diet or Vit E/Se) as the main factors, and the 2-way interactions. Tukey's multiple range test was only carried out for significant interactions and was performed using simple effect analysis. Mortality rates were compared using a chi-square test. The probability P < 0.05 was considered significant unless otherwise noted.

RESULTS

Growth Performance

The effects of dietary Vit E and Se administration on the growth performance of broilers under TN and HS conditions are shown in Tables 3 and 4, respectively. There was no significant interaction effect on the growth performance of the birds in terms of BWG, FCR, and FI between dietary and ambient temperature treatments during different experimental periods, or the entire course of the experiment. Under TN condition, dietary supplementation of Vit E and Se significantly improved BWG between 0 to 7, 0 to 14, 0 to 21, and 0 to 27 days of the study (P < 0.05). Moreover, dietary intervention significantly influenced FCR (P = 0.040) during the first week of the study. Except for week one (d 0–7), birds in the Vit E/Se group consumed more feed compared to the control group (P < 0.05).

Table 3.

Dietary Vit E/Se supplementation on broiler performance between d 0 to d 27.1

Item3 Treatment Groups2
 Statistics
Control Vit E/Se SEM P value
0 to 7 d
 BWG (g) 105.3 110.8 1.40 0.049
 FI (g) 146.2 147.7 1.85 0.695
 FCR 1.389 1.334 0.01 0.040
0 to 14 d
 BWG (g) 390.1 409.7 3.87 0.009
 FI (g) 542.9 572.3 5.60 0.006
 FCR 1.392 1.399 0.01 0.738
0 to 21 d
 BWG (g) 888.2 913.3 6.41 0.049
 FI (g) 1230.7 1279.5 9.20 0.006
 FCR 1.386 1.401 0.01 0.281
0 to 27 d
 BWG (g) 1357.4 1392.9 8.36 0.031
 FI (g) 1993.4 2050.4 11.57 0.011
 FCR 1.469 1.472 0.01 0.763
Open in a new tab
1

Data represent mean values of 16 replicates per treatment.

2

Control: birds fed a basal diet; Vit E/Se: birds fed a basal diet supplemented with 250 mg/kg vitamin E and 1 mg/kg selenium.

3

BWG: body weight gain; FI: feed intake; FCR: feed conversion ratio.

Table 4.

Effects of dietary Vit E/Se supplementation on body weight gain, feed intake, and feed conversion ratio of broilers under heat stress.1

Treatments2
 Diet
 Ambient Temperature
 Statistics3
Control
 Vit E/Se
 P value
Item4 TN HS TN HS Control Vit E/Se TN HS RMSE Diet AT D × AT
28 to 35 d
 BWG (g) 651.2 606.4 693.5 614.7 628.8 654.1 672.3 610.5 44.43 0.118 0.001 0.288
 FI (g) 1118 1073 1145 1087 1096 1116 1127 1080 47.83 0.155 0.010 0.519
 FCR 1.709 1.771 1.651 1.773 1.740 1.712 1.680 1.772 0.06 0.235 <0.001 0.215
 Mortality (%) 0.00 7.01 0.00 1.92 3.57 0.97 0.00 4.47 - 0.030 <0.001 -
0 to 35 d
 BW (g) 2061 2004 2145 2040 2032 2093 2103 2022 66.21 0.015 0.002 0.320
 BWG (g) 2018 1961 2103 1998 1989 2050 2060 1979 66.45 0.015 0.002 0.319
 FI (g) 3104 3075 3218 3115 3089 3166 3156 3095 81.18 0.008 0.042 0.160
 FCR 1.535 1.570 1.530 1.560 1.553 1.545 1.533 1.565 0.003 0.467 0.003 0.808
 EPEF 362.1 333.3 385.8 357.9 347.7 371.9 373.9 345.6 29.14 0.026 0.010 0.967
 Mortality (%) 5.63 8.75 3.75 4.38 7.19 4.06 4.69 6.56 - 0.086 0.303 -
Open in a new tab
1

Data represent mean values of 8 replicates per treatment.

2

Control: birds fed a basal diet; Vit E/Se: birds fed a basal diet supplemented with 250 mg/kg vitamin E and 1 mg/kg selenium; TN: thermoneutral; HS: heat stress.

3

AT: Ambient Temperature; D: Diet

4

BW: body weight; BWG: body weight gain; FI: feed intake; FCR: feed conversion ratio; EPEF: European production efficiency factor.

The environmental heat challenge caused a significant reduction in BWG and FI, and increased FCR from d 28 to 35 as well as during the entire experimental period (d 0–35). During the HS period (d 28–35), mortality rate was significantly higher (P < 0.001) in the heat-challenged groups in comparison to control birds (4.47% vs. 0%, respectively). However, the mortality rate was found to be lower (P = 0.030) in birds fed the Vit E/Se supplemented diet during d 28 to 35. Dietary Vit E/Se supplementation had a pronounced effect on broiler performance by increasing BWG, FI, and EPEF during the overall experimental period (d 0 to 35). Moreover, the cumulative mortality rate tended to be lower (P = 0.086) in the Vit E/Se birds compared to control birds during the overall study period (d 0 to 35).

Carcass and Body Composition

The effects of dietary supplementation of Vit E/Se on broiler body/carcass composition (carcass weight, tissue weight, lean weight, fat weight, tissue percentage, bone mineral content [BMC], bone mineral density [BMD] and surface area of defeathered whole carcass) under HS condition are shown in Table 5. There was no significant interaction effect on broiler body/carcass composition between the dietary and ambient temperature treatments at the end of the study. As expected, HS significantly reduced broiler carcass, tissue, and lean weights on d 35. In accordance with the performance data, dietary Vit E/Se supplementation significantly increased carcass, tissue, lean, and fat weights, as well as BMC and BMD on d 35.

Table 5.

Effects of dietary Vit E/Se supplementation on body composition of broilers under heat stress.1

Treatments2
 Diet
 Ambient Temperature
 Statistics3
Control
 Vit E/Se
 P-value
Item4 TN HS TN HS Control Vit E/Se TN HS RMSE Diet AT D × AT
Carcass, (g) 2149 2110 2318 2206 2130 2262 2234 2158 167.1 <0.001 0.029 0.289
Tissue, (g) 1973 1929 2141 2050 1951 2096 2057 1990 160.9 <0.001 0.042 0.471
Lean, (g) 1572 1546 1729 1633 1559 1681 1651 1590 137.8 <0.001 0.033 0.218
Fat, (g) 400.9 382.9 412.2 416.9 391.9 414.5 406.5 399.8 50.88 0.032 0.524 0.277
Tissue (%Fat) 20.33 19.85 19.31 20.30 20.10 19.80 19.82 20.08 2.04 0.505 0.537 0.080
BMC, (g) 25.38 25.42 26.87 26.45 25.40 26.60 26.13 25.94 2.61 0.020 0.723 0.665
BMD, (g/cm2) 0.193 0.199 0.202 0.205 0.196 0.203 0.197 0.202 0.01 0.003 0.062 0.601
Area, (cm2) 161.1 156.5 163.5 157.8 158.8 160.6 162.3 157.1 14.86 0.538 0.089 0.848
Open in a new tab
1

Data represent mean values of 24 replicates per treatment.

2

Control: birds fed a basal diet; Vit E/Se: birds fed a basal diet supplemented with 250 mg/kg vitamin E and 1 mg/kg selenium; TN: thermoneutral; HS: heat stress.

3

AT: Ambient Temperature; D: Diet.

4

BMC: bone mineral content; BMD: bone mineral density.

Body Temperature

As expected, elevated environmental temperature significantly increased broiler core body temperature between d 28 and d 35 (Table 6). There was a significant interaction (P = 0.033) between dietary and ambient temperature treatments in terms of core body temperature on d 30. Broiler core body temperature was not affected by dietary treatment between d 28 and 35 except for d 30. Birds fed a diet containing Vit E/Se had significantly lower (P = 0.010) core body temperature compared to birds fed a control diet on d 30.

Table 6.

Effects of dietary Vit E/Se supplementation on rectal temperature of broilers under heat stress.1

Treatments2
 Diet
 Ambient Temperature
 Statistics3
Control
 Vit E/Se
 P value
Item TN HS TN HS Control Vit E/Se TN HS RMSE Diet AT D × AT
D28 41.74 44.18 41.82 44.04 42.96 42.93 41.78 44.11 0.36 0.729 <0.001 0.215
D29 41.78 43.92 41.76 43.88 42.85 42.82 41.77 43.90 0.23 0.622 <0.001 0.869
D30 41.76c 44.23a 41.69c 43.60b 42.99 42.65 41.72 43.92 0.52 0.010 <0.001 0.033
D31 41.49 43.77 41.59 43.70 42.63 42.65 41.54 43.73 0.40 0.877 <0.001 0.406
D32 41.63 43.78 41.53 43.73 42.70 42.63 41.58 43.75 0.30 0.344 <0.001 0.710
D33 41.63 43.69 41.49 43.67 42.66 42.58 41.56 43.68 0.46 0.503 <0.001 0.610
D34 41.69 44.13 41.83 43.96 42.91 42.89 41.76 44.04 0.40 0.900 <0.001 0.137
D35 41.68 43.69 41.74 43.48 42.68 42.61 41.71 43.58 0.41 0.506 <0.001 0.186
Open in a new tab
a-c

Means with different superscripts in the same row are significantly different (P < 0.05).

1

Data represent mean values of 16 replicates per treatment.

2

Control: birds fed a basal diet; Vit E/Se: birds fed a basal diet supplemented with 250 mg/kg vitamin E and 1 mg/kg selenium; TN: thermoneutral; HS: heat stress.

3

AT: Ambient Temperature; D: Diet.

mRNA Abundance of Nutrient Transporters

The effects of dietary Vit E/Se administration on the mRNA abundance of PepT1, SGLT1, and NaPi-IIb in the jejunum of broilers under HS conditions are shown in Table 7. There was no significant interaction on jejunal mRNA abundance of these nutrient transporters between the dietary treatment and ambient temperature groups on d 28 or d 35. HS significantly upregulated PepT1 and NaPi-IIb mRNA levels (P < 0.001) and downregulated that of SGLT1 (P = 0.017) on d 28. The dietary treatment did not influence mRNA abundance of PepT1, SGLT1, and NaPi-IIb on d 28 and d 35.

Table 7.

Relative mRNA abundance of PepT1, SGLT1, and NaPi-IIb in the jejunum of broiler chickens on d 28 and d 35.1

Treatments2
 Diet
 Ambient Temperature
 Statistics3
Control
 Vit E/Se
 P-value
Item4 TN HS TN HS Control Vit E/Se TN HS RMSE Diet AT D × AT
d 28
 PepT1 1.18 2.02 1.08 2.24 1.60 1.66 1.13 2.13 0.91 0.814 0.001 0.483
 SGLT1 1.04 0.75 0.91 0.70 0.89 0.80 0.97 0.72 0.40 0.383 0.017 0.665
 NaPi-IIb 1.24 2.09 1.26 1.93 1.67 1.60 1.25 2.01 0.85 0.751 0.001 0.675
d 35
 PepT1 1.12 1.42 1.37 1.60 1.27 1.48 1.24 1.51 0.64 0.184 0.096 0.833
 SGLT1 1.07 0.92 1.22 0.95 1.00 1.08 1.15 0.93 0.45 0.433 0.062 0.624
 NaPi-IIb 1.03 1.17 1.16 0.97 1.10 1.06 1.10 1.07 0.42 0.735 0.779 0.129
Open in a new tab
1

Data represent mean values of 16 replicates per treatment.

2

Control: birds fed a basal diet; Vit E/Se: birds fed a basal diet supplemented with 250 mg/kg vitamin E and 1 mg/kg selenium; TN: thermoneutral; HS: heat stress.

3

AT: Ambient Temperature; D: Diet.

4

PepT1: peptide transporter-1 (SLC15A1), SGLT1: sodium-glucose cotransporter-1 (SLC5A1), NaPi-IIb: type IIb sodium-phosphate cotransporter (SLC34A2).

DISCUSSION

Heat stress causes an inevitable reduction in feed consumption and an increase in mortality that leads to reduced growth performance and significant economic losses in intensive poultry production systems (Lara and Rostagno, 2013). Several higher eukaryotic organisms, including poultry, have developed an integrated antioxidant defense system to reduce or eliminate the effects of such environmental challenges and maintain homeostasis and survival (Surai and Kochish, 2019). However, quite a long history of research revealed that the antioxidant defense system of the host is not efficient enough under severe stress conditions to maintain both growth performance and health without additional nutrients (Surai, 2018). Thus, modulation of the antioxidant response via several nutritional practices becomes a topic of great interest. In this context, we hypothesized that excess dietary Vit E (250 mg/kg) plus organic Se (1 mg/kg) could make a valuable contribution to this integrated antioxidant system by reducing the negative impact of HS and improving broiler performance and mRNA abundance of nutrient transporters.

In the present study, dietary supplementation of Vit E/Se significantly improved broiler BWG and FI under TN conditions on d 0 to 27. The current recommended levels for Vit E and Se are accepted as sufficient, and excess levels are generally not needed under standard production practices. However, there are contradicting results reporting either an enhancement (Swain et al., 2000; Dalia et al., 2018) or no change (Kim et al., 2010; Habibian et al., 2016) in broiler growth performance due to supplemental Vit E and/or Se under standard conditions. The increase in BWG and FI starting from the first week of this study might be attributable to the antioxidant effect of Vit E and Se against transport and handling stress or other possible stressors during standard husbandry practices. Nevertheless, this finding was not the main goal of the study.

The elevated environmental temperature between d 28 and d 35 markedly increased the birds’ body temperature, and altered their behavior (panting, elevated wings, diminished feed intake) indicating that the birds were experiencing HS. As expected, the heat challenge retarded growth performance and increased mortality rates between d 28 and d 35 as well as during the overall experimental period. The negative effects of elevated environmental temperature on broiler performance and health were also documented in previous studies (Dai et al., 2009; Niu et al., 2009; Quinteiro-Filho et al., 2010; Habibian et al., 2016). More recently, Emami et al. (2021) suggested that impaired performance during cyclic HS (35°C for 8 h) not only correlated with lower FI but also altered gut integrity and dysregulated immune response in HS-birds. Results from the current study indicated that dietary Vit E/Se supplementation had no effect on broiler BWG, FI, and FCR during the HS period (d 28–35). However, as an important finding, the mortality rate was significantly reduced in birds receiving a Vit E/Se (1.92%) supplement compared to birds in the control group (7.01%) during the HS period. Even though neither BWG nor FCR were statistically influenced during the HS period (d 28–35), the reduced mortality rate due to the dietary Vit E/Se intervention would raise the profitability rate in industrial practices by directly influencing flock performance. Moreover, dietary supplementation of Vit E/Se alleviated the growth suppression effect of the heat challenge by increasing BWG, FI, and EPEF during the overall experimental period (d 0–35). In agreement with these findings, Sahin and Kucuk (2001) reported that a combined use of 250 mg/kg Vit E and 0.2 mg/kg Se improved performance of Japanese quails under constant HS due to a possible synergistic mode of action between these nutrients in alleviating the negative impact of oxidative damage. In addition, dietary addition of organic Se (0.4 mg/kg) with or without ginger resulted in improved broiler performance as evidenced by a significant increase in BWG and FI (Safiullah et al., 2019). However, contradictory results were also reported concerning the efficiency of Vit E and/or Se in improving growth performance of broilers under HS conditions Habibian et al. (2016) did not observe any significant differences in performance between control and dietary Vit E (0, 125, or 250 mg/kg) and Se (0, 0.5, or 1 mg/kg) supplemented birds under 37°C cyclic HS for 8 h. Yet, they reported an increase of Se content in breast muscle accompanied with reduced malondialdehyde (MDA) content due to Vit E/Se supplementation. Similarly, Harsini et al. (2012) reported that single or combined (125 mg/kg Vit E and 0.5 mg/kg Se) use of Vit E and/or Se had no effect on broiler performance when birds were exposed to 37°C cyclic HS for 8 h.

In addition to the performance impairment, elevated environmental temperatures also induce changes in broiler body composition (De Antonio et al., 2017) such as increased fat deposition (Emami et al., 2021), reduced carcass protein content (Zhang et al., 2012), and reduced bone mineralization (Hosseini-Vashan et al., 2016). Our DEXA findings revealed that carcass, tissue, and lean weights were significantly reduced due to the HS; however, dietary supplementation of Vit E and Se markedly increased these values and alleviated the negative effects of HS in accordance with growth performance parameters. Since this technique is relatively new in poultry-focused studies, there are not enough published data to discuss the DEXA outputs of the current study. However, these results agree with published work whereby dietary addition of 250 mg/kg Vit E and 0.2 mg/kg Se increased the carcass characteristics of quails subjected to constant HS as determined by conventional methods (Sahin and Kucuk, 2001). In contrast, Habibian et al. (2016) showed that cyclic heat challenge (37°C for 8 h) and/or dietary supplemental Vit E and Se did not influence broiler carcass, breast, and thigh yields and these findings coincided with their performance results. It should be noted that the degree of environmental temperature and the stress duration experienced by the birds influence the efficiency of these antioxidants (Lara and Rostagno, 2013). Improvements in broiler growth performance and carcass parameters (carcass, tissue, and lean weights) in the present study are presumably related to the modulatory effects of Vit E and/or Se on antioxidant defense mechanisms (Khan et al., 2018; Kumbhar et al., 2018) and immune responses (Swain et al., 2000; Dalia et al., 2018).

Bone health issues present a serious problem in the broiler industry that leads to significant economic losses and reduced welfare (Shim et al., 2012). Elevated temperatures cause bone loss due to the increased corticosterone levels (Xu et al., 2018), which stimulates osteoclast activity (Hirayama et al., 2002) and reduces mineral consumption and absorption (Yan et al., 2019). Moreover, HS-related excessive rapid breathing causes respiratory alkalosis accompanied by increased blood pH and reduced ionized Ca concentration in the blood, which also contribute to reduced bone mineralization and strength (Yan et al., 2020). BMC and BMD, are important variables that provide valuable information regarding bone health and are strongly correlated with bone strength (Schreiweis et al., 2005). According to our findings, the HS challenge did not influence BMC or BMD, most likely due to the degree and duration of the implemented HS, but dietary addition of Vit E/Se improved BMC and BMD of those birds Talaty et al. (2009) suggested that BMD was not correlated with broiler body weight after 4 wk of age. Therefore, we can assume that increased BMC and BMD in Vit E/Se birds were directly related to dietary treatment, but not to improved weight gain. Similar to our findings, Vakili et al. (2010) reported that dietary Zn and Vit E supplementation improved the bone strength of heat-stressed broilers. An oxidative stress-related increase in ROS levels inhibits bone mineralization by elevating the osteoclast activity and inducing apoptosis of osteoblasts and osteocytes (Domazetovic et al., 2017). Conversely, antioxidants have an important role in maintaining osteoblast/osteoclast activity and bone health (Domazetovic et al., 2017). Therefore, the observed improvement in BMC and BMD values might be associated with the increased feed consumption and antioxidant properties of Vit E/Se. These results may indicate greater structural stiffness of leg bones; thus, dietary Vit E/Se supplementation may be useful under HS conditions to support bone health.

Absorption of nutrients through the intestinal tract is mediated by several transport proteins expressed on the enterocytes (Gilbert et al., 2008). Various factors and conditions including age, genetic selection, dietary nutrients, intestinal pathogens, and environmental stress regulate the expression levels of these transporters (Gilbert et al., 2008; Su et al., 2014; Habashy et al., 2017). Regardless of the dietary treatments, HS challenge significantly influenced mRNA levels of these nutrient transporters, especially on d 28. PepT1 is a member of the solute carrier 15 (SLC15) family of peptide transporters, capable of transporting di- and tri-peptides (Daniel and Kottra, 2004; Madsen and Wong, 2011). The current study revealed that exposure to high temperature significantly increased mRNA abundance of PepT1 in the jejunum on d 28. Moreover, there was a tendency for upregulation of jejunal PepT1 on d 35. Increased expression of PepT1 was also demonstrated in response to elevated ambient temperature (Habashy et al., 2017) and fasting conditions in broiler chicks (Madsen and Wong, 2011). Thus, the HS-related reduction in feed intake might induce mRNA abundance of PepT1 to maximize protein uptake under stress conditions. SGLT1 transports glucose and galactose across the apical side of the intestinal epithelial cells (Moran et al., 2010). Glucose sensors located on the enterocytes sense the luminal presence of monosaccharides, which further induces a signaling cascade leading to upregulation of SGLT1 (Dyer et al., 2003). Therefore, downregulation of SGLT1 in the present study might be associated with the lower luminal glucose level caused by reduced feed intake in HS birds. Another possible explanation could be that the heat stressed birds try to promote gluconeogenesis and glycogenolysis by reducing the mRNA level of intestinal SGLT1 (Habashy et al., 2017). HS-related downregulation of intestinal SGLT1 in chickens was also evidenced in previous studies (Faseleh Jahromi et al., 2016; Habashy et al., 2017). However, there are also contradictory results indicating no differences in SGLT mRNA level in the jejunum of birds exposed to 32 ± 1°C cyclic HS for 10 h (Sun et al., 2015) and growing pigs subjected to natural high ambient temperature (Cervantes et al., 2016). NaPi-IIb is an important transport protein for the absorption of phosphorus in the small intestine. Previous studies revealed that expression of NaPi-IIb in the small intestine is primarily regulated by vitamin D3 (Xu et al., 2002) and dietary P levels (Hattenhauer et al., 1999). In the present study, increased mRNA abundance of NaPi-IIb in HS birds on d 28 was likely an adaptation strategy to maintain P balance in response to reduced feed intake during HS Li et al. (2012) revealed that reduction in the dietary P level significantly induced NaPi-IIb mRNA abundance. However, NaPi-IIb mRNA abundance was not influenced by either Vit E/Se supplementation or HS challenge on d 35. Reduction in P demand (Waldroup et al., 2000) and downregulation of NaPi-IIb mRNA abundance (Li et al., 2017) with the growth of broilers could be the reason for the variation observed between d 28 and d 35. To the best of our knowledge, published data on the response of intestinal nutrient transporters to dietary Vit E/Se are very limited. Contrary to our expectations, we did not observe any additional modulation in PepT1, SGLT1, and NaPi-IIb mRNA abundance in the jejunum due to dietary Vit E/Se supplementation. However, there are studies suggesting positive effects of several antioxidants, such as chromium (Orhan et al., 2019), on intestinal nutrient transporters of chickens subjected to HS. Therefore, further studies applying different environmental temperatures and duration are needed to extend our knowledge on the effects of Vit E/Se on intestinal nutrients transporters.

The results of this study revealed that growth performance, livability and carcass composition of broilers were adversely affected during a HS challenge. However, we showed that dietary supplementation of Vit E/Se might be a useful nutritional strategy to alleviate the negative impacts of elevated environmental temperatures on broiler production performance. Moreover, the observed improvement in BMC and BMD is an important finding regarding bone health in heat-stressed broilers. However, dietary Vit E/Se did not influence the levels of intestinal nutrient transporters measured in this experiment. Collectively, the present study revealed that dietary supplementation of Vit E and Se significantly improved broiler performance, carcass characteristics, and bone health, and reduced mortality rate under HS conditions likely due to the synergistic antioxidant action of Vit E and Se in alleviating the negative impact of oxidative damage.

ACKNOWLEDGMENTS

This work was supported, in part, by USDA-NIFA Hatch funds to the Virginia Agricultural Experiment Station, Virginia Tech.

DISCLOSURES

The authors declare no conflict of interest.

REFERENCES

  1. Attia Y.A., Al-Harthi M.A., El-Shafey A.S., Rehab Y.A., Kim W.K. Enhancing tolerance of broiler chickens to heat stress by supplementation with vitamin E, vitamin C and/or probiotics. Ann. Anim. Sci. 2017;17:1155–1169. [Google Scholar]
  2. Cervantes M., Cota M., Arce N., Castillo G., Avelar E., Espinoza S., Morales A. Effect of heat stress on performance and expression of selected amino acid and glucose transporters, HSP90, leptin and ghrelin in growing pigs. J. Therm. Biol. 2016;59:69–76. doi: 10.1016/j.jtherbio.2016.04.014. [DOI] [PubMed] [Google Scholar]
  3. Cheng Y.F., Du M.F., Xu Q., Chen Y.P., Wen C., Zhou Y.M. Dietary mannan oligosaccharide improves growth performance, muscle oxidative status, and meat quality in broilers under cyclic heat stress. J. Therm. Biol. 2018;75:106–111. doi: 10.1016/j.jtherbio.2018.06.002. [DOI] [PubMed] [Google Scholar]
  4. Dai S.F., Wang L.K., Wen A.Y., Wang L.X., Jin G.M. Dietary glutamine supplementation improves growth performance, meat quality and colour stability of broilers under heat stress. Br. Poult. Sci. 2009;50:333–340. doi: 10.1080/00071660902806947. [DOI] [PubMed] [Google Scholar]
  5. Dalia A.M., Loh T.C., Sazili A.Q., Jahromi M.F., Samsudin A.A. Effects of vitamin E, inorganic selenium, bacterial organic selenium, and their combinations on immunity response in broiler chickens. BMC Vet. Res. 2018;14:249. doi: 10.1186/s12917-018-1578-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Daniel H., Kottra G. The proton oligopeptide cotransporter family SLC15 in physiology and pharmacology. Pflüg. Arch. Eur. J. Phy. 2004;447:610–618. doi: 10.1007/s00424-003-1101-4. [DOI] [PubMed] [Google Scholar]
  7. De Antonio J., Fernandez-Alarcon M., Lunedo R., Squassoni G., Ferraz A., Macari M., Furlan R., Furlan L. Chronic heat stress and feed restriction affects carcass composition and the expression of genes involved in the control of fat deposition in broilers. J. Agric. Sci. 2017;155:1487–1496. [Google Scholar]
  8. Domazetovic V., Marcucci G., Iantomasi T., Brandi M.L., Vincenzini M.T. Oxidative stress in bone remodeling: role of antioxidants. Clin. Cases Miner. Bone Metab. 2017;14:209–216. doi: 10.11138/ccmbm/2017.14.1.209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dyer J., Vayro S., Shirazi-Beechey S.P. Mechanism of glucose sensing in the small intestine. Biochem. Soc. Trans. 2003;31:1140–1142. doi: 10.1042/bst0311140. [DOI] [PubMed] [Google Scholar]
  10. EFSA Scientific opinion on safety and efficacy of Sel-Plex® (organic form of selenium produced by Saccharomyces cerevisiae CNCM I-3060) for all species. EFSA Journal. 2011;9:2110. [Google Scholar]
  11. Emami N.K., Greene E.S., Kogut M.H., Dridi S. Heat stress and feed restriction distinctly affect performance, carcass and meat yield, intestinal integrity, and inflammatory (chemo)cytokines in broiler chickens. Front. Physiol. 2021;12 doi: 10.3389/fphys.2021.707757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Emami N.K., Jung U., Voy B., Dridi S. Radical response: effects of heat stress-induced oxidative stress on lipid metabolism in the avian liver. Antioxidants. 2020;10:35. doi: 10.3390/antiox10010035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Faseleh Jahromi M., Altaher Y.Wesam, Shokryazdan P., Ebrahimi R., Ebrahimi M., Idrus Z., Tufarelli V., Liang J.B. Dietary supplementation of a mixture of Lactobacillus strains enhances performance of broiler chickens raised under heat stress conditions. Int. J. Biometeorol. 2016;60:1099–1110. doi: 10.1007/s00484-015-1103-x. [DOI] [PubMed] [Google Scholar]
  14. FDA . U.S. Food & Drug Administration; Office of the Federal Register: Washington, DC, USA.: 2017. CFR-Code of Federal Regulations Title 21. Part 573: Food Additives Permitted in Feed and Drinking Water of Animals.https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfcfr/CFRSearch.cfm?fr=573.920 Accessed October 2021. [Google Scholar]
  15. Flees J.J., Emami N.K., Greene E., Ganguly B., Dridi S. Phytogenic water additives improve broiler growth performance via modulation of intermediary metabolism-related signaling pathways. Animals. 2021;11:750. doi: 10.3390/ani11030750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gao J., Lin H., Wang X.J., Song Z.G., Jiao H.C. Vitamin E supplementation alleviates the oxidative stress induced by dexamethasone treatment and improves meat quality in broiler chickens. Poult. Sci. 2010;89:318–327. doi: 10.3382/ps.2009-00216. [DOI] [PubMed] [Google Scholar]
  17. Gilbert E.R., Li H., Emmerson D.A., Webb K.E., Jr., Wong E.A. Dietary protein quality and feed restriction influence abundance of nutrient transporter mRNA in the small intestine of broiler chicks. J. Nutr. 2008;138:262–271. doi: 10.1093/jn/138.2.262. [DOI] [PubMed] [Google Scholar]
  18. Greene E.S., Emami N.K., Dridi S. Research note: phytobiotics modulate the expression profile of circulating inflammasome and cyto(chemo)kine in whole blood of broilers exposed to cyclic heat stress. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2020.10.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Habashy W.S., Milfort M.C., Fuller A.L., Attia Y.A., Rekaya R., Aggrey S.E. Effect of heat stress on protein utilization and nutrient transporters in meat-type chickens. Int. J. Biometeorol. 2017;61:2111–2118. doi: 10.1007/s00484-017-1414-1. [DOI] [PubMed] [Google Scholar]
  20. Habibian M., Ghazi S., Moeini M.M. Effects of dietary selenium and vitamin E on growth performance, meat yield, and selenium content and lipid oxidation of breast meat of broilers reared under heat stress. Biol. Trace Elem. Res. 2016;169:142–152. doi: 10.1007/s12011-015-0404-6. [DOI] [PubMed] [Google Scholar]
  21. Habibian M., Ghazi S., Moeini M.M., Abdolmohammadi A. Effects of dietary selenium and vitamin E on immune response and biological blood parameters of broilers reared under thermoneutral or heat stress conditions. Int. J. Biometeorol. 2014;58:741–752. doi: 10.1007/s00484-013-0654-y. [DOI] [PubMed] [Google Scholar]
  22. Habibian M., Sadeghi G., Ghazi S., Moeini M.M. Selenium as a feed supplement for heat-stressed poultry: a review. Biol. Trace Elem. Res. 2015;165:183–193. doi: 10.1007/s12011-015-0275-x. [DOI] [PubMed] [Google Scholar]
  23. Hai L., Decuypere E., Buyse J. Acute heat stress induces oxidative stress in broiler chickens. Comp. Biochem. Phys. A. 2006;144:11–17. doi: 10.1016/j.cbpa.2006.01.032. [DOI] [PubMed] [Google Scholar]
  24. Harsini S.G., Habibiyan M., Moeini M.M., Abdolmohammadi A.R. Effects of dietary selenium, vitamin E, and their combination on growth, serum metabolites, and antioxidant defense system in skeletal muscle of broilers under heat stress. Biol. Trace Elem. Res. 2012;148:322–330. doi: 10.1007/s12011-012-9374-0. [DOI] [PubMed] [Google Scholar]
  25. Hattenhauer O., Traebert M., Murer H., Biber J. Regulation of small intestinal Na-P(i) type IIb cotransporter by dietary phosphate intake. Am. J. Physiol. 1999;277:G756–G762. doi: 10.1152/ajpgi.1999.277.4.G756. [DOI] [PubMed] [Google Scholar]
  26. He S., Arowolo M., Medrano R., Li S., Yu Q., Chen J., He J. Impact of heat stress and nutritional interventions on poultry production. World Poultry Sci. J. 2018;74:647–664. [Google Scholar]
  27. Hirayama T., Sabokbar A., Athanasou N.A. Effect of corticosteroids on human osteoclast formation and activity. J. Endocrinol. 2002;175:155–163. doi: 10.1677/joe.0.1750155. [DOI] [PubMed] [Google Scholar]
  28. Hosseini-Vashan S.J., Golian A., Yaghobfar A. Growth, immune, antioxidant, and bone responses of heat stress-exposed broilers fed diets supplemented with tomato pomace. Int. J. Biometeorol. 2016;60:1183–1192. doi: 10.1007/s00484-015-1112-9. [DOI] [PubMed] [Google Scholar]
  29. Kaminski N.A., Wong E.A. Differential mRNA expression of nutrient transporters in male and female chickens. Poult. Sci. 2018;97:313–318. doi: 10.3382/ps/pex262. [DOI] [PubMed] [Google Scholar]
  30. Khan A.Z., Kumbhar S., Liu Y.H., Hamid M., Pan C.L., Nido S.A., Parveen F., Huang K.K. Dietary supplementation of selenium-enriched probiotics enhances meat quality of broiler chickens (Gallus gallus domesticus) raised under high ambient temperature. Biol. Trace Elem. Res. 2018;182:328–338. doi: 10.1007/s12011-017-1094-z. [DOI] [PubMed] [Google Scholar]
  31. Kim Y.J., Park W.Y., Choi I.H. Effects of dietary α-tocopherol, selenium, and their different combinations on growth performance and meat quality of broiler chickens. Poult. Sci. 2010;89:603–608. doi: 10.3382/ps.2009-00280. [DOI] [PubMed] [Google Scholar]
  32. Kumbhar S., Khan A.Z., Parveen F., Nizamani Z.A., Siyal F.A., Abd El-Hack M.E., Gan F., Liu Y.H., Hamid M., Nido S.A., Huang K.H. Impacts of selenium and vitamin E supplementation on mRNA of heat shock proteins, selenoproteins and antioxidants in broilers exposed to high temperature. AMB Express. 2018;8:112. doi: 10.1186/s13568-018-0641-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lara L.J., Rostagno M.H. Impact of heat stress on poultry production. Animals. 2013;3:356–369. doi: 10.3390/ani3020356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Li J., Yuan J., Guo Y., Sun Q., Hu X. The influence of dietary calcium and phosphorus imbalance on intestinal NaPi-IIb and Calbindin mRNA expression and tibia parameters of broilers. Asian-Australas J. Anim. Sci. 2012;25:552–558. doi: 10.5713/ajas.2011.11266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Li J., Yuan J., Miao Z., Guo Y. Effects of age on intestinal phosphate transport and biochemical values of broiler chickens. Asian-Australas J. Anim. Sci. 2017;30:221–228. doi: 10.5713/ajas.16.0540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  37. Madsen S.L., Wong E.A. Expression of the chicken peptide transporter 1 and the peroxisome proliferator-activated receptor alpha following feed restriction and subsequent refeeding. Poult. Sci. 2011;90:2295–2300. doi: 10.3382/ps.2010-01173. [DOI] [PubMed] [Google Scholar]
  38. Moran A.W., Al-Rammahi M.A., Arora D.K., Batchelor D.J., Coulter E.A., Ionescu C., Bravo D., Shirazi-Beechey S.P. Expression of Na+/glucose co-transporter 1 (SGLT1) in the intestine of piglets weaned to different concentrations of dietary carbohydrate. Br. J. Nutr. 2010;104:647–655. doi: 10.1017/S0007114510000954. [DOI] [PubMed] [Google Scholar]
  39. Niu Z.Y., Liu F.Z., Yan Q.L., Li W.C. Effects of different levels of vitamin E on growth performance and immune responses of broilers under heat stress. Poult. Sci. 2009;88:2101–2107. doi: 10.3382/ps.2009-00220. [DOI] [PubMed] [Google Scholar]
  40. NRC . 9th ed. National Academies Press; Washington, DC: 1994. Nutrient Requirements of Poultry. [Google Scholar]
  41. Orhan C., Tuzcu M., Deeh P.B.D., Sahin N., Komorowski J.R., Sahin K. Organic chromium form alleviates the detrimental effects of heat stress on nutrient digestibility and nutrient transporters in laying hens. Biol. Trace Elem. Res. 2019;189:529–537. doi: 10.1007/s12011-018-1485-9. [DOI] [PubMed] [Google Scholar]
  42. Quinteiro-Filho W.M., Ribeiro A., Ferraz-de-Paula V., Pinheiro M.L., Sakai M., Sa L.R., Ferreira A.J., Palermo-Neto J. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 2010;89:1905–1914. doi: 10.3382/ps.2010-00812. [DOI] [PubMed] [Google Scholar]
  43. Safiullah N.Chand, Khan R.U., Naz S., Ahmad M., Gul S. Effect of ginger (Zingiber officinale Roscoe) and organic selenium on growth dynamics, blood melanodialdehyde and paraoxonase in broilers exposed to heat stress. J. Appl. Anim. Res. 2019;47:212–216. [Google Scholar]
  44. Sahin K., Kucuk O. Effects of vitamin E and selenium on performance, digestibility of nutrients, and carcass characteristics of Japanese quails reared under heat stress (34 degrees C) J. Anim. Physiol. Anim. Nutr. (Berl) 2001;85:342–348. doi: 10.1046/j.1439-0396.2001.00340.x. [DOI] [PubMed] [Google Scholar]
  45. Sahin K., Kucuk O. Zinc supplementation alleviates heat stress in laying Japanese quail. J. Nutr. 2003;133:2808–2811. doi: 10.1093/jn/133.9.2808. [DOI] [PubMed] [Google Scholar]
  46. Sahin K., Kucuk O., Sahin N., Gursu M. Optimal dietary concentration of vitamin E for alleviating the effect of heat stress on performance, thyroid status, ACTH and some serum metabolite and mineral concentrations in broilers. Vet. Med.-Czech. 2002;47:110–116. [Google Scholar]
  47. Sahin K., Sahin N., Kucuk O., Hayirli A., Prasad A.S. Role of dietary zinc in heat-stressed poultry: a review. Poult. Sci. 2009;88:2176–2183. doi: 10.3382/ps.2008-00560. [DOI] [PubMed] [Google Scholar]
  48. Sahin K., Sahin N., Onderci M., Yaralioglu S., Kucuk O. Protective role of supplemental vitamin E on lipid peroxidation, vitamins E, A and some mineral concentrations of broilers reared under heat stress. Vet. Med.-Czech. 2001;46:140–144. [Google Scholar]
  49. Schreiweis M.A., Orban J.I., Ledur M.C., Moody D.E., Hester P.Y. Validation of dual-energy X-ray absorptiometry in live White Leghorns. Poult. Sci. 2005;84:91–99. doi: 10.1093/ps/84.1.91. [DOI] [PubMed] [Google Scholar]
  50. Shim M.Y., Karnuah A.B., Mitchell A.D., Anthony N.B., Pesti G.M., Aggrey S.E. The effects of growth rate on leg morphology and tibia breaking strength, mineral density, mineral content, and bone ash in broilers. Poult. Sci. 2012;91:1790–1795. doi: 10.3382/ps.2011-01968. [DOI] [PubMed] [Google Scholar]
  51. Slawinska A., Hsieh J.C., Schmidt C.J., Lamont S.J. Heat stress and lipopolysaccharide stimulation of chicken macrophage-like cell line activates expression of distinct sets of genes. PLoS One. 2016;11 doi: 10.1371/journal.pone.0164575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Slimen I.B., Najar T., Ghram A., Abdrrabba M. Heat stress effects on livestock: molecular, cellular and metabolic aspects, a review. J. Anim. Physiol. Anim. Nutr. (Berl) 2016;100:401–412. doi: 10.1111/jpn.12379. [DOI] [PubMed] [Google Scholar]
  53. Sohail M.U., Ijaz A., Yousaf M.S., Ashraf K., Zaneb H., Aleem M., Rehman H. Alleviation of cyclic heat stress in broilers by dietary supplementation of mannan-oligosaccharide and Lactobacillus-based probiotic: Dynamics of cortisol, thyroid hormones, cholesterol, C-reactive protein, and humoral immunity. Poult. Sci. 2010;89:1934–1938. doi: 10.3382/ps.2010-00751. [DOI] [PubMed] [Google Scholar]
  54. Su S., Miska K.B., Fetterer R.H., Jenkins M.C., Wong E.A. Expression of digestive enzymes and nutrient transporters in Eimeria acervulina-challenged layers and broilers. Poult. Sci. 2014;93:1217–1226. doi: 10.3382/ps.2013-03807. [DOI] [PubMed] [Google Scholar]
  55. Sun X., Zhang H., Sheikhahmadi A., Wang Y., Jiao H., Lin H., Song Z. Effects of heat stress on the gene expression of nutrient transporters in the jejunum of broiler chickens (Gallus gallus domesticus) Int. J. Biometeorol. 2015;59:127–135. doi: 10.1007/s00484-014-0829-1. [DOI] [PubMed] [Google Scholar]
  56. Surai P.F. Wageningen Academic Publishers; Wageningen, The Netherlands: 2018. Selenium in Poultry Nutrition and Health. [Google Scholar]
  57. Surai P.F., Kochish I.I. Nutritional modulation of the antioxidant capacities in poultry: the case of selenium. Poult. Sci. 2019;98:4231–4239. doi: 10.3382/ps/pey406. [DOI] [PubMed] [Google Scholar]
  58. Surai P.F., Kochish II., Romanov M.N., Griffin D.K. Nutritional modulation of the antioxidant capacities in poultry: the case of vitamin E. Poult. Sci. 2019;98:4030–4041. doi: 10.3382/ps/pez072. [DOI] [PubMed] [Google Scholar]
  59. Swain B.K., Johri T.S., Majumdar S. Effect of supplementation of vitamin E, selenium and their different combinations on the performance and immune response of broilers. Br. Poult. Sci. 2000;41:287–292. doi: 10.1080/713654938. [DOI] [PubMed] [Google Scholar]
  60. Talaty P.N., Katanbaf M.N., Hester P.Y. Life cycle changes in bone mineralization and bone size traits of commercial broilers. Poult. Sci. 2009;88:1070–1077. doi: 10.3382/ps.2008-00418. [DOI] [PubMed] [Google Scholar]
  61. Tan G.Y., Yang L., Fu Y.Q., Feng J.H., Zhang M.H. Effects of different acute high ambient temperatures on function of hepatic mitochondrial respiration, antioxidative enzymes, and oxidative injury in broiler chickens. Poult. Sci. 2010;89:115–122. doi: 10.3382/ps.2009-00318. [DOI] [PubMed] [Google Scholar]
  62. Traber M.G., Atkinson J. Vitamin E, antioxidant and nothing more. Free Radic. Biol. Med. 2007;43:4–15. doi: 10.1016/j.freeradbiomed.2007.03.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Vakili R., Rashidi A.A., Sobhanirad S. Effects of dietary fat, vitamin E and zinc supplementation on tibia breaking strength in female broilers under heat stress. Afr. J. Agric. Res. 2010;5:3151–3156. [Google Scholar]
  64. Waldroup P.W., Kersey J.H., Saleh E.A., Fritts C.A., Yan F., Stilborn H.L., Crum R.C., Jr., Raboy V. Nonphytate phosphorus requirement and phosphorus excretion of broiler chicks fed diets composed of normal or high available phosphate corn with and without microbial phytase. Poult. Sci. 2000;79:1451–1459. doi: 10.1093/ps/79.10.1451. [DOI] [PubMed] [Google Scholar]
  65. Xu H., Bai L., Collins J.F., Ghishan F.K. Age-dependent regulation of rat intestinal type IIb sodium-phosphate cotransporter by 1, 25-(OH) 2 vitamin D3. Am. J. Physiol. Cell Physiol. 2002;282:C487–C493. doi: 10.1152/ajpcell.00412.2001. [DOI] [PubMed] [Google Scholar]
  66. Xu Y., Lai X., Li Z., Zhang X., Luo Q. Effect of chronic heat stress on some physiological and immunological parameters in different breed of broilers. Poult. Sci. 2018;97:4073–4082. doi: 10.3382/ps/pey256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Yan F.F., Mohammed A.A., Murugesan G.R., Cheng H.W. Effects of a dietary synbiotic inclusion on bone health in broilers subjected to cyclic heat stress episodes. Poult. Sci. 2019;98:1083–1089. doi: 10.3382/ps/pey508. [DOI] [PubMed] [Google Scholar]
  68. Yan F.F., Wang W.C., Cheng H.W. Bacillus subtilis-based probiotic promotes bone growth by inhibition of inflammation in broilers subjected to cyclic heating episodes. Poult. Sci. 2020;99:5252–5260. doi: 10.1016/j.psj.2020.08.051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Zhang Z.Y., Jia G.Q., Zuo J.J., Zhang Y., Lei J., Ren L., Feng D.Y. Effects of constant and cyclic heat stress on muscle metabolism and meat quality of broiler breast fillet and thigh meat. Poult. Sci. 2012;91:2931–2937. doi: 10.3382/ps.2012-02255. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES