Skip to main content
The Plant Cell logoLink to The Plant Cell
. 2022 Jan 31;34(5):1768–1783. doi: 10.1093/plcell/koac027

BRASSINOSTEROID-SIGNALING KINASE1 modulates MAP KINASE15 phosphorylation to confer powdery mildew resistance in Arabidopsis

Hua Shi 1,2,✉,†, Qiuyi Li 3,4, Mingyu Luo 5,6, Haojie Yan 7, Bao Xie 8,9, Xiang Li 10,11, Guitao Zhong 12,13, Desheng Chen 14,15, Dingzhong Tang 16,✉,†
PMCID: PMC9048930  PMID: 35099562

Abstract

Perception of pathogen-associated molecular patterns (PAMPs) by plant cell surface-localized pattern-recognition receptors (PRRs) triggers the first line of plant innate immunity. In Arabidopsis thaliana, the receptor-like cytoplasmic kinase BRASSINOSTEROID-SIGNALING KINASE1 (BSK1) physically associates with PRR FLAGELLIN SENSING2 and plays an important role in defense against multiple pathogens. However, how BSK1 transduces signals to activate downstream immune responses remains elusive. Previously, through whole-genome phosphorylation analysis using mass spectrometry, we showed that phosphorylation of the mitogen-activated protein kinase (MAPK) MPK15 was affected in the bsk1 mutant compared with the wild-type plants. Here, we demonstrated that MPK15 is important for powdery mildew fungal resistance. PAMPs and fungal pathogens significantly induced the phosphorylation of MPK15 Ser-511, a key phosphorylation site critical for the functions of MPK15 in powdery mildew resistance. BSK1 physically associates with MPK15 and is required for basal and pathogen-induced MPK15 Ser-511 phosphorylation, which contributes to BSK1-mediated fungal resistance. Taken together, our data identified MPK15 as a player in plant defense against powdery mildew fungi and showed that BSK1 promotes fungal resistance in part by enhancing MPK15 Ser-511 phosphorylation. These results uncovered a mechanism of BSK1-mediated disease resistance and provided new insight into the role of MAPK phosphorylation in plant immunity.


Arabidopsis BSK1 physically associates with MPK15 and is required for pattern- and pathogen-induced MPK15 Ser-511 phosphorylation, which contributes to BSK1-mediated powdery mildew resistance.

Introduction

Plants have evolved sophisticated innate immune systems to defend themselves against surrounding pathogenic microbes. Upon pathogen infection, cell surface-localized pattern-recognition receptors (PRRs) perceive microbe- or host-derived conserved molecules, termed pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) or damage-associated molecular patterns (DAMPs), leading to pattern-triggered immunity (Jones and Dangl, 2006; Boller and Felix, 2009). Well-characterized PAMPs/MAMPs include a conserved N-terminal 22-amino acid epitope (flg22) of bacterial flagellin and an acetylated N-terminal 18-amino acid epitope (elf18) of the bacterial elongation factor Tu, which are recognized by plant cell surface-localized PRRs FLAGELLIN SENSITIVE2 (FLS2) and EF-TU RECEPTOR (EFR), respectively (Kunze et al., 2004; Chinchilla et al., 2006; Zipfel et al., 2006). The LysM-receptor kinases CHITIN ELICITOR RECEPTOR KINASE1 (CERK1) and LYSIN MOTIF RECEPTOR KINASE5 form a chitin receptor complex in Arabidopsis thaliana to regulate antifungal immunity (Miya et al., 2007; Cao et al., 2014). Plant elicitor peptides (peps) are known as DAMPs to activate plant immunity (Huffaker and Ryan, 2007; Krol et al., 2010). Ligand recognition rapidly induces convergent intracellular signaling pathways that ultimately trigger plant basal defense responses, including transient calcium influx from the apoplast, production of reactive oxygen species (ROS), activation of mitogen-activated protein kinase (MAPK) cascades, and transcriptional induction of a large suite of defense-related genes (Tang et al., 2017; Sun and Zhang, 2020).

Plants employ membrane-localized receptor-like kinases (RLKs) or receptor-like proteins (RLPs) to recognize invading pathogens. In addition to direct recognition, many RLKs and RLPs function as coreceptors or as signaling proteins to transmit immune signals by phosphorylating downstream receptor-like cytoplasmic kinases (RLCKs) (Albert et al., 2020; Wang et al., 2020; Manhães et al., 2021). In Arabidopsis, ligands binding immediately induce heterodimerization of PRRs, including FLS2 and EFR, with coreceptor BRASSINOSTEROID INSENSITIVE1-ASSOCIATED KINASE1 and trigger auto- and trans-phosphorylation within the receptor complexes (Chinchilla et al., 2007; Wang et al., 2014). Activated immune receptors induce phosphorylation and release of downstream RLCKs to transmit immune signals (Tang et al., 2017; Liang and Zhou, 2018). The majority of RLCKs are anchored to the plasma membrane through N-myristoylation or palmitoylation (Lin et al., 2013), with only a cytoplasmic kinase domain but not an ectodomain, suggesting that RLCKs are mainly involved in signal transduction instead of ligand binding.

Eukaryotic MAPK cascades are highly conserved signal transduction modules that integrate environmental and developmental signals into a wide range of cellular processes (Pedley and Martin, 2005; Rodriguez et al., 2010; Meng and Zhang, 2013). In plants, MAPK cascades regulate many aspects of plant growth/development processes, as well as responses to environmental stimuli, including abiotic stresses, hormonal signaling, and innate immunity (Tena et al., 2001; Asai et al., 2002; Pitzschke et al., 2009; Zhang et al., 2018). In Arabidopsis, there are ∼20 MAPKs, 10 MAPKKs, and 60 MAPKKKs (Ichimura et al., 2002). However, until recently, only two complete MAPK cascades, MEKK1-MKK1/2-MPK4 and MAPKKK3/5-MKK4/5-MPK3/6, have been shown to be activated downstream of PRRs and played crucial roles in plant innate immunity (Meng and Zhang, 2013; Sun and Zhang, 2020). The upstream MAPKKKs that govern MPK3/6 activation have long been elusive until recently that several reports demonstrated that MAPKKK5 and MAPKKK3 function redundantly to activate MPK3/6 in response to multiple PAMPs and confer resistance to both bacterial and fungal pathogens (Yamada et al., 2016; Bi et al., 2018; Sun et al., 2018). In addition to MPK3/MPK6/MPK4, other MAPKs, including MPK1, MPK11, and MPK13, have been reported to be activated following treatment with flg22, although the loss of individual MAPK does not result in any obvious defects in the defense against Pseudomonas syringae pv tomato (Pto) DC3000 hrcC-, probably due to potential functional redundancy among these MAPKs (Bethke et al., 2012; Nitta et al., 2014).

BR-SIGNALING KINASE1 (BSK1) belongs to the RLCK subfamily XII, which has 12 family members in Arabidopsis (Tang et al., 2008). It physically associates with FLS2, mediating a series of flg22-induced PTI responses and plays a crucial role in plant immunity against multiple pathogens (Shi et al., 2013). Another family member, BSK5, was recently shown to play a role in PTI by interacting with PRRs PEPR1 and EFR but not with FLS2 (Majhi et al., 2019), suggesting specific interactions of RLCK family members with PRRs. BSK1 is directly phosphorylated by RECEPTOR-LIKE KINASE 902 to transduce immune signaling (Zhao et al., 2019).

To further explore how BSK1 mediates signals downstream from the FLS2 complex, we previously conducted a whole-genome differential phosphorylation analysis using mass spectrometry (DP-MS) and showed that BSK1 directly interacted with and phosphorylated MAPKKK5 to regulate plant immunity, suggesting a direct link of signaling from the immune complex to the MAPK cascade (Yan et al., 2018). In this study, we focused on another MAPK cascade member, MPK15, whose phosphorylation at the Ser-511 residue is absent in the bsk1 mutant. Here, we showed that MPK15 functions in Arabidopsis immunity against biotrophic fungal pathogens. BSK1 associates with MPK15 and is required for pattern- and pathogen-induced Ser-511 phosphorylation. We propose that MPK15 Ser-511 phosphorylation contributes to BSK1-mediated resistance to powdery mildew fungi.

Results

MPK15 is required for powdery mildew resistance

In a previous phosphoproteomic analysis, we found a number of candidates that might function as kinase substrates of BSK1 to relay immune signaling (Yan et al., 2018). In this study, we characterized MPK15, a TDY-subtype member of MAPKs (Ichimura et al., 2002), whose phosphorylation at the Ser-511 residue was affected in bsk1 mutant.

To explore the role of MPK15 in plant defense responses, we obtained two independent mpk15 mutant lines created by CRISPR/Cas9, named mpk15-1 (a single base-pair insertion in the fifth exon) and mpk15-2 (a single base-pair insertion in the second exon), both of which caused a frameshift mutation leading to a premature stop codon (Figure 1A). We also obtained all available T-DNA insertion lines for MPK15 from the Arabidopsis Biological Resource Center. When checking MPK15 transcripts with reverse transcription-polymerase chain reaction (RT-PCR), we found that these T-DNA insertion lines had little effect on the full-length transcript level of MPK15 (Supplemental Figure S1A), so we used mpk15-1 and mpk15-2 for further analyses.

Figure 1.

Figure 1

MPK15 plays positive roles in plant resistance to powdery mildew. A, Structure of the MPK15 gene with CRISPR/Cas9 gene editing sites (sgRNA-1 and sgRNA-2). Exons are indicated by black boxes and introns by black lines. The numbers beside the nucleotide sequences indicate the positions in the MPK15 coding sequence. mpk15-1 carries a single base-pair insertion in the fifth exon and mpk15-2 carries a single base-pair insertion in the second exon (both shown in red). B, mpk15 mutants display increased susceptibility to powdery mildew. Four-week-old plants were infected with G. cichoracearum. The infected leaves were stained with trypan blue to observe fungal structures at 5 dpi. Bar = 50 μm. C, MPK15 overexpression lines (MPK15OE) display enhanced resistance to powdery mildew. Four-week-old plants were infected with G. cichoracearum. The infected leaves were stained with trypan blue to observe fungal structures at 5 dpi. Bar = 50 μm. D and E, Quantification of fungal growth in plants at 5 dpi by counting the number of conidiophores per colony. Data represent mean ± se. Lowercase letters indicate statistically significant differences (P < 0.05, n ≥ 20, one-way ANOVA). Three independent experiments were performed with similar results.

We first infected mpk15 mutants with the bacterial pathogen P. syringae DC3000 and found that mpk15 displayed a wild-type (WT)-like phenotype (Supplemental Figure S1B), indicating that MPK15 may not contribute to Pto DC3000 resistance or that there might be functional redundancy among MPK15 homologs in Arabidopsis.

We then inoculated mpk15 mutants with fungal pathogen powdery mildew Golovinomyces cichoracearum. As shown in Figure 1, B and D, the mpk15 mutants displayed an obviously bsk1-like susceptible phenotype, supporting significantly more conidiophore formation than WT plants, indicating that MPK15 is required for powdery mildew resistance. We also inoculated mpk15 mutants with the oomycete pathogen Hyaloperonospora arabidopsidis (H.a.) Noco2 and found a slight but significant increase in susceptibility compared with the WT (Supplemental Figure S1C). These data indicated that MPK15 functions in the plant immunity.

To further investigate the role of MPK15 in disease resistance, we overexpressed MPK15 by transforming the 35S:MPK15-GFP construct into WT plants. Two independent overexpression (OE) lines (Supplemental Figure S2, A and B) were selected for further analysis. The OE lines were morphologically WT-like, with no growth or developmental defects, which was similar for mpk15 mutants (Supplemental Figure S2C), indicating that MPK15 was not involved in plant growth regulation. We challenged OE plants with powdery mildew and found that both OE lines were more resistant to powdery mildew than WT (Figure 1, C and E). Taken together, these data demonstrated that MPK15 plays a positive role in plant resistance to powdery mildew.

Activated MAPKs could promote plant disease resistance by inducing defense genes expression through phosphorylation of target proteins, including transcription factors. To investigate the molecular basis underlying the positive roles of MPK15 in plant immunity, we examined the expression of a subset of powdery mildew-responsive genes in mpk15 mutants. Unexpectedly, all of the genes tested, including PATHOGENESIS-RELATED GENE1 (PR1), PR2, FLG22-INDUCED RECEPTOR-LIKE KINASE1 (FRK1), NDR1/HIN1-LIKE10 (NHL10), PHYTOALEXIN DEFICIENT4 (PAD4), and FLAVIN-DEPENDENT MONOOXYGENASE1 (FMO1), were induced in a pattern very similar to that of the WT in response to powdery mildew (Supplemental Figure S3), suggesting that MPK15 did not affect the expression of these genes.

Phosphorylation of MPK15 at Ser-511 is required for its function in disease resistance

The DP-MS data described above showed that MPK15 Ser-511 was phosphorylated in WT plants but not in the susceptible bsk1 mutant. To determine the role of Ser-511 phosphorylation in MPK15-mediated powdery mildew resistance, we transformed mpk15-1 plants with HA-tagged WT MPK15, phospho-dead MPK15S511A, and phospho-mimetic MPK15S511D constructs under the control of the MPK15 native promoter. We selected transgenic lines with comparable MPK15 protein levels (Figure 2C) to observe their responses to powdery mildew infection. As presented in Figure 2, A and B, the MPK15 and MPK15S511D lines exhibited resistance similar to WT Col-0, indicating complementation of the mpk15-1 phenotype. In contrast, MPK15S511A lines could not fully suppress the enhanced susceptibility of mpk15-1 to powdery mildew, suggesting that the phosphorylation of MPK15 at Ser-511 is essential for its function in resistance to fungal pathogens. Notably, members of TDY-subtype of MAPKs all have a long C-terminus (Ichimura et al., 2002). Alignment of the C-terminal tail of this clade of MAPKs indicated that Ser-511 is conserved among the closed homologs of MPK15, including MPK8, MPK9, and MPK17 (Supplemental Figure S4, A and B), suggesting that the Ser-511 residue might be functionally conserved.

Figure 2.

Figure 2

Phosphorylation of MPK15 at Ser-511 is critical for MPK15-mediated resistance to powdery mildew. A, Four-week-old plants were infected with G. cichoracearum. The infected leaves were stained with trypan blue to observe fungal structures at 5 dpi. Bar = 80 μm. B, Quantification of fungal growth in plants at 5 dpi by counting the number of conidiophores per colony. Data represent mean ± se. Lowercase letters indicate statistically significant differences (P < 0.05, n ≥ 30, one-way ANOVA). Three independent experiments were performed with similar results. C, MPK15 protein levels in MPK15 and MPK15S511A/S511D transgenic lines shown in (A) were detected by immunoblot analysis with anti-HA antibody. Total protein was extracted from 10-day-old seedlings and separated by SDS-PAGE. Ponceau S staining of plant Rubisco was shown as a loading control. Molecular masses of protein markers are shown on the left.

Powdery mildew and patterns induce MPK15 Ser-511 phosphorylation

To investigate whether pathogens or patterns could induce MPK15 phosphorylation at Ser-511, we developed a phosphopeptide-specific antibody that recognizes phospho-Ser511 (anti-pS511) in MPK15. First, we checked the specificity of the antibody by transiently expressing HA-tagged MPK15 in Col-0 protoplasts. Immunoprecipitated MPK15 was subjected to lambda protein phosphatase (λ-PPase) treatment and then immunoblot analysis with the anti-pS511 antibody. As shown in Figure 3A, a sharp band was detected in the mock-treated sample but disappeared in the λ-PPase-treated sample, indicating that the antibody is specific for phosphorylated MPK15 protein.

Figure 3.

Figure 3

Powdery mildew and patterns induce the phosphorylation of MPK15 Ser-511. A, HA-tagged MPK15 was transiently expressed in Col-0 protoplasts. Immunoprecipitated MPK15 protein was treated with (+) or without (−) lambda protein phosphatase (λ-PPase) for 30 min before immunoblot analysis with anti-pS511 antibody to detect MPK15 phosphorylation. B, Powdery mildew fungi induce the phosphorylation of MPK15 Ser-511. Four-week-old stable transgenic plants expressing MPK15-HA or MPK15 S511A-HA were inoculated with G. cichoracearum. Leaves were harvested at 0 and 3 dpi. MPK15/S511A proteins were immunoprecipitated with anti-HA Agarose beads and subjected to immunoblot analysis with anti-pS511 antibody. Values indicate relative band density of pSer-511 protein normalized to immunoprecipitated MPK15-HA protein by using the ImageJ software. Three independent experiments were performed with similar results. C and D, Patterns induce the phosphorylation of MPK15 Ser-511. Stable transgenic seedlings expressing MPK15-HA or MPK15 S511A-HA were treated with flg22 (C) or chitin (D) for 15 min before harvesting. MPK15/S511A proteins were immunoprecipitated with anti-HA Agarose beads and subjected to immunoblot analysis with anti-pS511 antibody. Values indicate relative band density of pSer-511 protein normalized to immunoprecipitated MPK15-HA protein by using the ImageJ software. The experiments were repeated twice with independently grown seedlings, with similar results.

With this antibody, we could test for pathogen-induced phosphorylation of Ser-511. We inoculated MPK15-HA and MPK15S511A-HA transgenic plants with powdery mildew. In the absence of pathogen infection, we detected background phosphorylation of Ser-511 with MPK15-HA transgenic plants. Three days after inoculation, a stronger signal indicative of enhanced phosphorylation of Ser-511 was detected in the MPK15 protein, whereas no signal was present in the MPK15S511A protein (Figure 3B). This result demonstrated that powdery mildew induced MPK15 phosphorylation at Ser-511, which is consistent with the critical role of Ser-511 phosphorylation in powdery mildew resistance.

We then treated seedlings of MPK15-HA and MPK15S511A-HA with flg22 and chitin to check for PAMP-induced phosphorylation of Ser-511. We observed enhanced phosphorylation signals after PAMP treatment (Figure 3, C and D), indicating that flg22 and chitin could induce MPK15 Ser-511 phosphorylation. Notably, ligand-induced phosphorylation was abolished in the respective receptor-deficient mutants (Supplemental Figure S5, A and B), confirming that the enhanced phosphorylation of MPK15 is a specific response to the PAMP elicitation. With all of the patterns tested, including chitin, flg22, elf18, and pep1, we consistently found increased Ser-511 phosphorylation signals (Supplemental Figure S5C), suggesting that MPK15 might be activated in response to PAMPs.

MPK15 is an active protein kinase and autophosphorylates Ser-511

In MPK15, the dual phosphorylation motif, which is generally phosphorylated by MAPKKs, is TDY instead of the typical TEY; therefore, it belongs to a more distant subgroup of MAPKs, group D (Ichimura et al., 2002). To test the kinase activity of MPK15, we performed an in vitro kinase assay with purified recombinant protein MBP-MPK15. As shown in Figure 4A, MPK15 displayed strong autophosphorylation activity, although the amount of purified protein was relatively low. The autophosphorylation signal was completely lost when the conserved Lys residue at position 119 in the ATP binding site of MPK15 was mutated to Glu (MPK15K119E).

Figure 4.

Figure 4

MPK15 is an active protein kinase and auto-phosphorylates Ser-511 in vitro. A, MPK15 displayed autophosphorylation activity. Recombinant MBP-MPK15 or MBP-MPK15 K119E fusion protein was incubated in an in vitro kinase assay buffer and then subjected to λ-PPase treatment. Immunoblot analysis was performed with anti-pSpT antibody that could detect phosphorylated Ser and Thr (top panel). Input proteins were shown by Coomassie brilliant blue (CBB) staining (bottom panel). B, Ser-511 is an autophosphorylation site of MPK15. Recombinant MBP–MPK15, MBP–MPK15 K119E, or MBP–MPK15 S511A fusion protein was incubated in an in vitro kinase assay buffer and then subjected to λ-PPase treatment. Immunoblot analysis was performed with anti-pS511 antibody (top panel). Input proteins were shown by CBB staining (bottom panel). C, Ser-511 phosphorylation contributes to MPK15 kinase activity. Recombinant MBP-MPK15 or MBP-MPK15 S511A fusion protein was incubated with 10 μg MyBP substrate in an in vitro kinase assay buffer. Anti-pMBP antibody was used to probe for MyBP phosphorylation (top panel). Anti-pSpT antibody was used to detect phosphorylated Ser and Thr (middle panel). Input proteins were shown by CBB staining (bottom panel).

To determine whether MPK15 is an active protein kinase, we performed an in vitro kinase assay by using myelin basic protein (MyBP) as an artificial substrate. We could consistently detect a weak MyBP phosphorylation band (Figure 4C, top panel). MPK15S511A affected MyBP transphosphorylation activity of MPK15 (Figure 4C, top panel), indicating that Ser-511 phosphorylation contributes to MPK15 kinase activity. The weak MyBP transphosphorylation activity of MPK15 suggested that MPK15 may need to be fully activated by upstream MAPKK(s) through phosphorylation of the TDY motif. This notion was supported by the observation that mutation in TDY motif, in which the conserved Thr (T) and Tyr (Y) were mutated to Ala and Phe, respectively, affected the function of MPK15 in plant immunity (Supplemental Figure S6). Together, these results indicated that MPK15 is an active protein kinase and requires activation by its upstream MAPKK(s) for its function.

To examine whether MPK15 could autophosphorylate Ser-511, we performed an in vitro kinase assay with the aforementioned anti-pS511 antibody. A λ-PPase-sensitive band indicating phosphorylated Ser-511 was observed with purified MBP-MPK15, but not with the kinase-dead mutant MPK15K119E (Figure 4B), demonstrating that Ser-511 is an autophosphorylation site of MPK15. Consistently, with a commercial pSpT antibody that recognizes phosphorylated Ser/Thr, a decreased signal was observed with recombinant MPK15S511A protein compared with MPK15 (Figure 4C, middle panel). It is notable that the signal decreased, but did not disappear, suggesting that there are other autophosphorylation sites present in MPK15. Taken together, these data support the notion that pathogen-induced MPK15 phosphorylation at Ser-511 may further active MPK15 to induce disease resistance.

MPK15 associates with BSK1 in planta

To investigate the relationship between BSK1 and MPK15, we performed co-immunoprecipitation (Co-IP) assays by transiently coexpressing BSK1-FLAG and MPK15-GFP in Nicotiana benthamiana leaves. As shown in Figure 5A, BSK1-FLAG coimmunoprecipitated with GFP-tagged MPK15 but not with the negative control. We then confirmed the physical association with stable transgenic plants that expressed both BSK1pro:BSK1-Myc (Shi et al., 2013) and MPK15pro:MPK15-HA. Transgenic plants that expressed only MPK15pro:MPK15-HA were used as a negative control. BSK1-Myc protein was immunoprecipitated using anti-Myc antibody, and MPK15-HA protein was detected only in the transgenic plants that expressed both BSK1-Myc and MPK15-HA (Figure 5B). The association between MPK15 and BSK1 was significantly reduced by pretreatment with the general kinase inhibitor K-252a, indicating that the interaction was largely dependent on kinase activity (Figure 5C).

Figure 5.

Figure 5

MPK15 interacts with BSK1. A, Co-IP assay of MPK15 and BSK1 by transiently coexpressing MPK15-GFP and BSK1-FLAG in N. benthamiana leaves. Total protein was extracted and subjected to immunoprecipitation of MPK15 protein by anti-GFP nanoagarose beads, followed by immunoblot analysis with anti-FLAG antibody. B, Co-IP assay of MPK15 and BSK1 from transgenic Arabidopsis plants. Total protein was extracted from 2-week-old seedlings expressing both BSK1-Myc and MPK15-HA. Plants expressing MPK15-HA alone were used as a negative control. The BSK1 protein was immunoprecipitated by anti-Myc antibody, and the presence of MPK15-HA protein was detected by immunoblot analysis with anti-HA antibody. C, MPK15 and BSK1 interaction was largely dependent on kinase activity. MPK15-HA and BSK1-GFP were coexpressed in Col-0 protoplasts. The kinase inhibitor K-252a was applied 2 h before protoplasts collection. Total protein was extracted and subjected to immunoprecipitation with anti-GFP nanoagarose beads, followed by immunoblot analysis with anti-HA antibody. K-252a treatment significantly reduced the amount of coimmunoprecipitated MPK15 protein compared with the DMSO control treatment. EV, empty vector. D, MPK15 associated with BSK1 in BiFC assay. MPK15 and BSK1 were fused to the N-terminus (YN) or C-terminus (YC) of the YFP protein, respectively. Different combinations were coexpressed in N. benthamiana leaves. YFP fluorescence was detected by confocal microscopy. Bar = 20 μm.

To check whether the MPK15S511A variant could disrupt MPK15 function by affecting its interaction with BSK1, we performed a Co-IP assay in Arabidopsis protoplasts and found that MPK15 and MPK15S511A were similar in their interactions with BSK1 (Supplemental Figure S7), indicating that the phosphorylation of MPK15 Ser-511 did not affect its association with BSK1. Bimolecular fluorescence complementation (BiFC) assays in N. benthamiana leaves confirmed that the formation of MPK15/BSK1 complex occurred mainly in the plasma membrane of tobacco epidermal cells (Figure 5D).

BSK1 is required for basal and pathogen-induced MPK15 Ser-511 phosphorylation in plant cells

To confirm the phosphoproteomic result that bsk1 mutation affected MPK15 Ser-511 phosphorylation, we crossed bsk1 mutant with MPK15pro:MPK15-HA transgenic plants. Sibling lines carrying homozygous MPK15pro:MPK15-HA transgene with either bsk1 or WT genotype were identified for further analyses. We consistently observed that MPK15 protein abundance was lower in bsk1 genotype than in the WT (Supplemental Figure S8A). We then examined the MPK15 transcripts in both transgenic plants and found that MPK15 expression level was also decreased in bsk1 background (Supplemental Figure S8B), suggesting that the lower abundance of MPK15 protein in the bsk1 genotype may be a result of both transcriptional and translational regulation. However, the mechanism by which bsk1 mutation affects MPK15-HA transgene expression is currently unknown.

We inoculated both transgenic lines with powdery mildew and observed that both basal and pathogen-induced levels of Ser-511 phosphorylation were greatly reduced in the bsk1 mutant compared with the WT background (Figure 6A). Similarly, flg22- and chitin-induced phosphorylation of MPK15 Ser-511 were also severely reduced in bsk1 (Figure 6B). The genomic BSK1 clone could completely restore basal and pathogen-induced MPK15 Ser-511 phosphorylation (Figure 6C), indicating that loss of BSK1 is responsible for the decreased MPK15 Ser-511 phosphorylation. These results indicated that BSK1 is required for MPK15 Ser-511 phosphorylation in plant cells. Furthermore, when we coexpressed MPK15-HA and BSK1-GFP in Arabidopsis protoplasts, a stronger Ser-511 phosphorylation signal compared with that of the control samples coexpressing MPK15-HA and GFP was observed (Figure 6D), indicating that BSK1 enhanced MPK15 Ser-511 phosphorylation in planta. The signal bands disappeared after pretreatment with the kinase inhibitor K-252a (Figure 6D). In addition, we found that enhanced Ser-511 phosphorylation required BSK1 kinase activity, since the kinase-dead mutant BSK1K104E did not have the same effect as BSK1 (Supplemental Figure S9).

Figure 6.

Figure 6

BSK1 is required for MPK15 Ser-511 phosphorylation in plant cells. A, bsk1 mutation affected pathogen-induced MPK15 Ser-511 phosphorylation. Four-week-old MPK15-HA/WT and MPK15-HA/bsk1 transgenic plants were inoculated with G. cichoracearum. Leaves were harvested at 0 and 3 dpi. Immunoblot analyses were performed with anti-HA and anti-pS511 antibody. Values indicate relative band density of pSer-511 normalized to MPK15-HA protein by using the ImageJ software. Three independent experiments were performed with similar results. B, bsk1 mutation affected patterns-induced MPK15 Ser-511 phosphorylation. Ten-day-old MPK15-HA/WT and MPK15-HA/bsk1 transgenic seedlings in liquid MS were treated with flg22 or chitin for 15 min. Immunoblot analyses were performed with anti-HA and anti-pS511 antibody. Values indicate relative band density of pSer-511 normalized to MPK15-HA protein by using the ImageJ software. Three independent experiments were performed with similar results. C, Complementation of the bsk1 mutant with BSK1 restored basal and pathogen-induced MPK15 Ser-511 phosphorylation. Four-week-old MPK15-HA/WT, MPK15-HA/bsk1, and MPK15-HA/BSK1 complemental plants were inoculated with G. cichoracearum. Leaves were harvested at 0 and 3 dpi. Immunoblot analyses were performed with anti-HA and anti-pS511 antibody. Values indicate relative band density of pSer-511 normalized to MPK15-HA protein by using the ImageJ software. Three independent experiments were performed with similar results. D, Enhanced MPK15 Ser-511 phosphorylation by BSK1 expression. MPK15-HA was coexpressed with BSK1-GFP or EV in Col-0 protoplasts. K-252a or DMSO was applied 2 h before protoplasts collection. MPK15-HA proteins were affinity purified with anti-HA Agarose beads. Immunoblot analyses were performed with anti-pS511 and anti-HA antibody. The expression levels of EV and BSK1-GFP were monitored from crude extract (Input) with anti-GFP antibody. Values indicate relative band density of pSer-511 protein normalized to immunoprecipitated MPK15-HA protein by using the ImageJ software. Three independent experiments were performed with similar results. E, BSK1 enhanced MPK15 Ser-511 phosphorylation mainly by promoting MPK15 autophosphorylation. MPK15-HA or kinase-dead MPK15 K119E-HA was coexpressed with BSK1-GFP or EV in Col-0 protoplasts. MPK15/K119E-HA proteins were affinity purified with anti-HA Agarose beads. Immunoblot analyses were performed with anti-pS511 and anti-HA antibody. The expression levels of EV and BSK1-GFP were monitored from crude extract (Input) with anti-GFP antibody. Values indicate relative band density of pSer-511 protein normalized to immunoprecipitated MPK15-HA protein by using the ImageJ software. Three independent experiments were performed with similar results. F, BSK1 did not directly phosphorylate MPK15 Ser-511. Recombinant GST-BSK1 was incubated with kinase-dead MBP-MPK15 K119E protein in an in vitro kinase assay buffer, separated by SDS-PAGE and probed with anti-pS511 antibody (top panel). Input protein was shown by CBB staining (bottom panel). G, MAPKKK3/5 were dispensable for powdery mildew-induced MPK15 Ser-511 phosphorylation. Four-week-old MPK15-HA/mapkkk3/5 transgenic plants were inoculated with G. cichoracearum. Leaves were harvested at 0 and 3 dpi. Immunoblot analyses were performed with anti-HA and anti-pS511 antibody. Values indicate relative band density of pSer-511 normalized to MPK15-HA protein by using the ImageJ software. The experiments were repeated twice with similar results.

To examine whether BSK1 could directly phosphorylate MPK15, we performed an in vitro kinase assay with purified recombinant proteins. As shown in Figure 6F, MPK15, but not MPK15K119E, showed autophosphorylation at Ser-511. However, when incubating MBP-MPK15K119E and GST-BSK1 together, we could not detect the phosphorylated Ser-511 signal, suggesting that BSK1 may not directly phosphorylate MPK15 Ser-511 in vitro. Interestingly, when transiently expressing MPK15K119E in Col-0 protoplasts, we detected the Ser-511 phosphorylation signal, whereas the intensity was much reduced compared with that of WT MPK15 (Figure 6E), suggesting that Ser-511 is subjected to both autophosphorylation and transphosphorylation in plant cells. Coexpressing BSK1 greatly enhanced Ser-511 phosphorylation in MPK15 but not in MPK15K119E (Figure 6E), suggesting that BSK1 enhanced MPK15 Ser-511 phosphorylation mainly through promoting MPK15 autophosphorylation. Taken together, these results suggested that BSK1 is required for basal and pathogen-induced MPK15 Ser-511 phosphorylation and that BSK1 positively regulates MPK15 phosphorylation primarily by enhancing its autophosphorylation at Ser-511.

Previously, our lab reported that BSK1 directly phosphorylates MAPKKK5 to relay immune signaling (Yan et al., 2018). Given that we did not detect direct phosphorylation of MPK15 by BSK1, we wondered whether BSK1 enhanced MPK15 Ser-511 phosphorylation through MAPKKK5-mediated MPK15 activation. It’s reported that MAPKKK3 and MAPKKK5 act redundantly to activate MPK3/6 in response to multiple PAMPs (Bi et al., 2018). Therefore, we made use of mapkkk3-2 mapkkk5-2 double mutant plants to test our hypothesis. Col-0 and mapkkk3-2 mapkkk5-2 mutant protoplasts were transformed with MPK15-HA and then treated with flg22 or chitin. After enriching MPK15-HA by affinity purification, we observed PAMPs-induced MPK15 phosphorylation at Ser-511. In contrast to our hypothesis, we detected similarly increased phosphorylation signals in response to PAMPs in Col-0 and mapkkk3-2 mapkkk5-2 mutant protoplasts (Supplemental Figure S10), indicating that flg22- and chitin-induced MPK15 Ser-511 phosphorylation was not dependent on MAPKKK3/5. To further characterize powdery mildew-induced MPK15 Ser-511 phosphorylation, we transformed MPK15pro:MPK15-HA construct to mapkkk3-2 mapkkk5-2 plants. Two independent transgenic lines were identified and inoculated with powdery mildew. As shown in Figure 6G, both lines displayed enhanced pathogen-induced MPK15 Ser-511 phosphorylation. Together, these data indicated that MAPKKK3/5 were dispensable for patterns- and pathogen-induced MPK15 Ser-511 phosphorylation.

Phosphorylation of MPK15 at Ser-511 contributes to BSK1-mediated powdery mildew resistance

The above observations that phosphorylation of Ser-511 was required for the functions of MPK15 in fungal resistance and that bsk1 mutation affected Ser-511 phosphorylation prompted us to examine whether the phospho-mimetic mutation of MPK15 Ser-511 could rescue the susceptibility of the bsk1 mutant to powdery mildew. Therefore, we introduced the MPK15S511D and MPK15S511A variants into the bsk1 mutant and selected two individual transgenic lines with comparable MPK15 protein levels for powdery mildew inoculation (Figure 7C). We found that MPK15S511D, but not MPK15S511A, partially rescued the enhanced susceptible phenotype of bsk1 mutant against powdery mildew (Figure 7, A and B). Interestingly, the narrow-leaf phenotype that might be associated with BR signaling activation in bsk1 was not affected by MPK15S511D transgene (Supplemental Figure S11), indicating that the immune response and growth phenotype of bsk1 were likely uncoupled. Together, these observations indicated that BSK1 regulated plant immunity to powdery mildew partially by modulating MPK15 Ser-511 phosphorylation.

Figure 7.

Figure 7

MPK15 Ser-511 phosphorylation contributes to BSK1-mediated powdery mildew resistance. A, Four-week-old plants were infected with G. cichoracearum. The infected leaves were stained with trypan blue to observe fungal structures at 5 dpi. Bar = 50 μm. B, Quantification of fungal growth in plants at 5 dpi by counting the number of conidiophores per colony. Data represent mean ± se. Lowercase letters indicate statistically significant differences (P < 0.05, n ≥ 15, one-way ANOVA). Three independent experiments were performed with similar results. C, MPK15 protein levels in MPK15S511A/bsk1 and MPK15S511D/bsk1 transgenic lines shown in (A) were detected by immunoblot analysis with anti-HA antibody. Total protein was extracted from 10-day-old seedlings and separated by SDS-PAGE. Ponceau S staining of plant Rubisco was shown as a loading control.

To analyze the genetic relationship between BSK1 and MPK15, we infected WT and bsk1 mpk15 double mutants with powdery mildew and found that the bsk1 mpk15 double mutants displayed susceptibility that was very similar to that of the bsk1 single mutant (Supplemental Figure S12), suggesting that MPK15 and BSK1 likely act in the same genetic pathway in resistance to powdery mildew.

Discussion

MPK15 positively regulates powdery mildew resistance in Arabidopsis

BSK1 is a receptor-like cytoplasmic kinase that plays positive roles in plant defense against bacterial and fungal pathogens. To explore the molecular mechanism underlying BSK1-mediated disease resistance, we previously performed a differential phosphoproteomic analysis with Arabidopsis WT plants and bsk1 mutant and identified several attractive candidates that potentially function as substrates of BSK1 (Yan et al., 2018). In this study, we focused on MPK15, a member of TDY-subtype MAPKs. We demonstrated that MPK15 was involved in plant defense against fungal and oomycete pathogens. Two CRISPR/Cas9 alleles of mpk15 displayed increased susceptibility, and MPK15 overexpression lines showed enhanced resistance to powdery mildew fungi (Figure 1, B–E), indicating that MPK15 plays important roles in powdery mildew resistance, probably by positively regulating host factor(s) that limit powdery mildew growth during a compatible interaction. The resistance mediated by MPK15 is likely SA-independent since we observed that the susceptibility of mpk15 mutants is not associated with reduced expression of known SA marker genes, such as PR1, PR2, and FRK1 (Supplemental Figure S3). In contrast, mpk15 mutants display WT-like resistance to bacterial pathogen Pto DC3000, possibly because the mechanisms of pathogenicity and defense machinery against bacteria and fungi are different. Similarly, our lab previously identified that MKK4- or MKK5-overexpressing lines displayed enhanced resistance against powdery mildew (Zhao et al., 2014); however, no change in Pto DC3000 growth was observed in these MKK4- or MKK5-overexpressing lines (Su et al., 2017).

There are ∼20 MAPKs present in the Arabidopsis genome, and they can be divided into four groups (A–D) (Ichimura et al., 2002). MPK15 belongs to group D, characterized by a conserved TDY motif, instead of the typical TEY motif, which is generally phosphorylated by upstream MAPKKs. MAPKs in group D are also notable for an extended C-terminal region, which is reported to be essential for kinase activity (Cheong et al., 2003). It would be interesting to examine the role of the extended C-terminus in MPK15-mediated disease resistance. Many members in group A (such as MPK3 and MPK6) and group B (such as MPK4 and MPK11) are involved in plant responses to biotic and abiotic stresses, whereas the functions of MAPKs in groups C and D are largely unknown. OsBWMK1, a MAPK member with a TDY motif in rice, is activated by rice blast fungus and induces plant defenses by phosphorylating transcription factors OsEREBP1 and OsWRKY33 (He et al., 1999; Cheong et al., 2003; Koo et al., 2009). By analogy, it is possible that MPK15 activates disease resistance by phosphorylating transcription factor(s) that may regulate plant immunity in SA-independent pathways. Identifying the substrates of MPK15 would provide more insights into the mechanism by which MPK15 functions in plant defense.

BSK1 enhances MPK15 Ser-511 phosphorylation to regulate fungal resistance

Through in vitro kinase assays, we showed that MPK15 is an active protein kinase and that the conserved TDY motif is required for the function of MPK15 in plant immunity (Figure 4B; Supplemental Figure S6), indicating that MPK15 is a typical MAPK and requires phosphorylation from upstream MAPKK(s) for its function. Furthermore, we provided evidence that Ser-511 is one of the autophosphorylation sites of MPK15 and that the phosphorylation of Ser-511 contributes to MPK15 kinase activity and functions in powdery mildew resistance (Figure 4, B and C). Moreover, multiple PAMPs, including flg22 and elf18, could significantly induce MPK15 Ser-511 phosphorylation (Figure 6, A and B), however, mpk15 mutants displayed a WT-like phenotype to Pto DC3000 (Supplemental Figure S1). It is possible that other MAPKs may play redundant roles with MPK15 in resistance to Pto DC3000. For instance, MPK8, the most closed homolog of MPK15, was reported to negatively regulate mechanical wound-induced RbohD gene expression and therefore ROS production (Takahashi et al., 2011). It is likely that MPK8 may be involved in plant disease resistance by regulating ROS signaling pathway. Similarly, MPK3 and MPK6 are phosphorylated in responses to multiple PAMPs, while mpk3 or mpk6 single mutant displays a subtle phenotype to Pto DC3000 (Su et al., 2017). Together, these results support the notion that pathogen-induced MPK15 phosphorylation at Ser-511 may further active MPK15 to induce disease resistance.

Previously, a phosphoproteomic study conducted on mature Arabidopsis pollen grains identified phosphorylation of MPK15 Ser-511, as well as Thr and Tyr in the TDY motif of MPK8/MPK15 (Mayank et al., 2012), suggesting that MAPK signaling cascades are active in pollen. However, as no obvious changes in pollination or seed setting in mpk15 mutants were observed, the role of MPK15 Ser-511 phosphorylation in pollen development needs further study. Intriguingly, an independent phosphoproteomic study in our lab identified that MPK15 Ser-511 phosphorylation is also affected in enhanced disease resistance1 (edr1) mutants (Gao et al., 2021). In contrast to BSK1, EDR1 is a negative regulator of plant immunity (Tang et al., 2005; Zhao et al., 2014). Based on the positive role of Ser-511 phosphorylation in fungal resistance, it is unlikely that EDR1 directly phosphorylates MPK15 Ser-511. Indeed, MPK15 Thr-508 is phosphorylated in the edr1 mutant but not the WT (Gao et al., 2021), providing a possibility that edr1-induced Thr-508 phosphorylation may inhibit Ser-511 phosphorylation. It would be interesting to examine the interplay between these two phosphorylation sites and the function of MPK15 Thr-508 in plant immunity.

With stable transgenic plants, we observed that both basal and pathogen-induced phosphorylation of MPK15 Ser-511 were significantly reduced in the bsk1 mutant (Figure 6, A–C). Furthermore, BSK1 enhances Ser-511 phosphorylation by association with MPK15. However, we were unable to detect direct phosphorylation of MPK15 by BSK1 (Figure 6F). One possibility is that the weak kinase activity of BSK1 results in a relatively low intensity phosphorylation signal that is under our detection threshold. It remains possible that BSK1 could phosphorylate MPK15 in vivo and/or in a ligand-induced manner. Alternatively, our results showed that BSK1 is less effective in enhancing the phosphorylation of MPK15K119E than that of MPK15 (Figure 6E), indicating that BSK1 may regulate MPK15 phosphorylation mainly by promoting MPK15 autophosphorylation at Ser-511. It is possible that BSK1 may directly phosphorylate upstream MAPKKKs/MAPKKs to activate MPK15, leading to enhanced Ser-511 phosphorylation. One promising candidate would be MAPKKK5, since BSK1 could directly phosphorylate MAPKKK5 to relay immune signals (Yan et al., 2018). However, this notion is not supported by our observation that PAMP- and pathogen-induced Ser-511 phosphorylation is unaffected in mapkkk3-2 mapkkk5-2 mutant (Figure 6G; Supplemental Figure S10). Deciphering the MAPKKKs/MAPKKs upstream of MPK15 will be of great interest in the future.

The observation that Ser-511 is phosphorylated when transiently expressing kinase-dead MPK15K119E in Arabidopsis protoplasts suggests that Ser-511 is subjected to both auto- and trans-phosphorylation. Thus, PAMP- and pathogen-induced Ser-511 phosphorylation could result from both auto- and trans-phosphorylation. We propose that the candidates that could transphosphorylate MPK15 should be kinases involved in plant immunity that are activated by pathogens. It remains to be determined how these kinases function together with BSK1 to regulate the phosphorylation of MPK15.

BSK1 promotes MPK15 Ser-511 autophosphorylation, which contributes to BSK1-mediated powdery mildew resistance (Figure 7). Moreover, mutation in the TDY motif of MPK15, which is usually phosphorylated by upstream MAPKK(s), affected its function in plant immunity (Supplemental Figure S6). These data indicated that MPK15 needs to be fully activated by BSK1-mediated Ser-511 autophosphorylation and MAPKK(s)-mediated TDY phosphorylation for proper function. However, the interplay between the two signaling pathways remains to be determined. Furthermore, MPK15 Ser-511 is phosphorylated in response to multiple patterns, the signal specificity is currently unknown. It is possible that, similar to MPK3/6/4, multiple PRR signals converge at MPK15 to maintain immune output.

In conclusion, our study demonstrated that MPK15 plays a positive role in powdery mildew resistance in Arabidopsis and identified a key phosphorylation site, Ser-511, that is important for its function. PAMPs and fungal pathogens could significantly induce MPK15 Ser-511 phosphorylation in a BSK1-dependent manner. Furthermore, BSK1 promotes fungal resistance partially by enhancing MPK15 Ser-511 phosphorylation (Figure 8). These results have identified a key player in fungal resistance and uncovered a new mechanism of BSK1-mediated disease resistance.

Figure 8.

Figure 8

A working model: BSK1 regulates MPK15 Ser-511 phosphorylation to promote disease resistance. In WT plants, upon pathogens infection, PRRs and coreceptors are rapidly activated, leading to BSK1 phosphorylation. Activated BSK1 promotes MPK15 Ser-511 phosphorylation, which contributes to disease resistance. In bsk1 mutant, impaired phosphorylation of MPK15 results in weakened immune responses. Moreover, activation by upstream MAPKK(s) is also required for proper function of MPK15. However, upstream components in the MPK15 cascade and whether they subject to BSK1 regulation remain to be determined. Dashed arrows indicate impaired signaling.

Materials and methods

Plant materials and growth conditions

Arabidopsis thaliana plants used in this study included WT Col-0 and the mutants bsk1-1 (Shi et al., 2013), fls2 (SALK_141277), cerk1-2 (SALK_007193C), and mapkkk3-2 mapkkk5-2 (Bi et al., 2018), all of which were in the Col-0 background. The T-DNA insertion lines (SALK_046143, SALK_061149, CS309341) were obtained from the Arabidopsis Biological Resource Center. A. thaliana and N. benthamiana plants were grown in a growth room at 22°C under a 9-h light/15-h dark cycle for phenotyping or a 16-h light/8-h dark cycle for seeds setting, with a light intensity of 7,000–8,000 lux.

Pathogens inoculation

Powdery mildew fungus G. cichoracearum strain UCSC1 was maintained on highly susceptible pad4-1 plants. To achieve an even distribution of conidia, inoculation was performed as previously described (Wang et al., 2011). To quantify the conidiation, infected leaves were stained with trypan blue at 5 days post-inoculation (dpi), and the number of conidiophores per colony was counted under a microscope as described (Frye and Innes, 1998). For each genotype, at least 12 leaves from 6 plants were harvested for microscopic visualization. For the oomycete pathogen H.a. Noco2 infection assay, 2-week-old plants were spray-inoculated with H. a. Noco2 conidiospores at a concentration of 50,000 spores per milliliter of water. Plants were kept for 7 days at 18°C in 12-h-light/12-h-dark cycles with 95% humidity. H.a. Noco2 growth was quantified by counting the number of spores per gram of leaf samples with a hemocytometer as previously described (Li et al., 2010). Pto DC3000 infection was performed by leaf infiltration as described (Zhao et al., 2019).

Vector construction and the generation of transgenic plants

For transient expression in protoplasts, the full-length MPK15 or BSK1 CDS without stop codon was amplified by PCR from Col-0 cDNA and cloned into pUC19-35S-HA-RBS1 vector (kindly provided by Jian-Min Zhou) using In-Fusion method (Clontech, Takara Bio USA, Inc.; Cat# 639649). pUC19-MPK15S511A-HA was generated by site-directed mutagenesis (Stratagene). To generate the 35S:MPK15-GFP construct, full-length MPK15 CDS was inserted into the Gateway vector pDONR207 and then cloned into the pEarleyGate 103 destination vector (Earley et al., 2006) using the Gateway cloning system (Invitrogen, Waltham, MA, USA). 35S:BSK1-GFP was described previously (Shi et al., 2013).

To generate the MPK15pro:MPK15-HA construct, MPK15 genomic sequence (without the stop codon), including 1,569-bp fragment upstream of the start codon, was amplified from Col-0 genomic DNA and inserted into the pDONR207 to create pDONR207-NP-MPK15 entry clone. The insert was next subcloned into the pEarleyGate 301 destination vector with C-terminal HA fusion. MPK15pro:MPK15S511A-HA, MPK15pro:MPK15S511D-HA and MPK15pro:MPK15TDYm-HA were generated with site-directed mutagenesis by using pDONR207-NP-MPK15 as a template. The derived constructs were introduced into the mpk15-1 mutant (see below) by Agrobacterium tumefaciens-mediated transformation (Clough and Bent, 1998). Homozygous transgenic lines with single copy were characterized in T3 generation by immunoblotting with anti-HA antibody at 1:1,000 dilution (Roche, Basel, Switzerland; Cat# 11867423001).

To construct the MPK15 CRISPR/Cas9 vector, two 20-bp single-guide RNAs (sgRNAs) were designed to target MPK15. sgRNA target 1 (GTAGGGAAGCCGCTATTTCC) was located in the fifth exon of MPK15, and sgRNA target 2 (GTCATATCTCTGATGCAACC) was located in the second exon. We obtained a single fragment flanked by the two sgRNA targets by PCR using pCBC-DT1T2 as a template and then cloned the fragment into CRISPR/Cas9 binary vector pHEC401 as described (Wang et al., 2015). To screen for homozygous CRISPR/Cas9 mutants, we extracted genomic DNA from individual transgenic T1 plants and then directly sequenced purified PCR fragments spanning target sites. To prevent further editing of the MPK15 transgenes, we first screened for lines that the guide RNA transgene was segregated away and found one such line named mpk15-1.

BiFC assay

The coding sequences of MPK15 and BSK1 were cloned into two intermediate vectors, pSY736 and pSY735 (Bracha-Drori et al., 2004), respectively, in frame with the N- or C-terminus of yellow fluorescent protein (YFP). The fusion sequences were then cloned into pDONR207 and finally into binary vector pMDC32 using the Gateway system. Agrobacterium strain GV3101 containing the desired pairs were transiently coexpressed in 4-week-old N. benthamiana leaves. YFP signals were detected by confocal microscopy (Zeiss LSM880) 3 days after injection as described previously (Wu et al., 2015).

RNA isolation and RT-qPCR

Total RNA was isolated using TRIzol reagent (Invitrogen; Cat# 15596026). First-strand cDNA from 2 μg of total RNA was synthesized using M-MLV reverse transcriptase (Promega, Madison, WI, USA; Cat# M1705). Real-time quantitative PCR was performed with PerfectStart Green qPCR SuperMix (TransGen Biotech, Beijing, China; Cat# AQ601-02) with a CFX connect Real-Time PCR system (Bio-Rad, Hercules, CA, USA). The ACTIN2 gene was used as a control for normalizing the amount of cDNA.

Phosphosite-specific antibody (anti-pS511) generation

Anti-pS511 antibody was custom-made by Abmart. Rabbits were immunized with the phosphopeptide: Ac-CVASTLD(pS)PKAS-NH2. The polyclonal antiserum was incubated with nonphosphorylated peptide (Ac-CVASTLDSPKAS-NH2) to minimize the recognition of nonphosphorylated peptide as previously described (Li et al., 2014). Phosphorylated MPK15 Ser-511 was detected by immunoblotting analysis with anti-pS511 antibody at 1:3,000 dilution.

Co-IP assays and immunoblotting analyses

Arabidopsis protoplasts transformation and Co-IP assays were performed as described previously (Shi et al., 2013). Briefly, 1 mL of protoplasts were transfected with 200 μg plasmid DNA and incubated for 16 h before being treated with 1 μM flg22 or 100 μg/mL chitin for 15 min. Total protein was extracted with 1 mL IP buffer (50 mM Tris–HCl at pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 10% glycerol, 1% [v/v] IGEPAL CA-630 [Sigma–Aldrich, St. Louis, MO, USA; Cat# I3021], 50 μM MG132, 2 μM NaF, 2 μM Na3VO4 and protease inhibitor cocktail [Sigma–Aldrich; Cat# P9599]). For anti-GFP IP, total protein was incubated with 15 μL GFP nanobeads (Chromotech, Canton, MI, USA; Cat# gta-20); For anti-HA IP, total protein was incubated with 20 μL anti-HA Agarose beads (Abmart, Shanghai, China; Cat# M20013) for 2 h at 4°C with gentle rotation. Following incubation, the beads were washed four times with wash buffer (50 mM Tris–HCl at pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 10% glycerol, 0.3% [v/v] IGEPAL CA-630 [Sigma–Aldrich]) and boiled at 95°C for 5 min. The samples were separated in SDS-PAGE gel and immunoblotted with anti-HA or anti-GFP antibody (Roche; Cat# 11814460001, 1:2,000 dilution).

In vitro kinase assay

MPK15 or BSK1 was cloned into pMAL-c2G (with MBP tag) or pGEX-4T-1 (with GST tag) vectors, respectively. MBP-MPK15K119E and MBP-MPK15S511A were generated by site-directed mutagenesis as described above. Expression of the fusion proteins was induced by 0.5 mM IPTG for 5 h at 28°C. The recombinant proteins were affinity purified with resins according to the manufacturer’s instructions. For in vitro kinase assay, the kinase and substrate were incubated in 30 μL reaction buffer containing 25 mM Tris–HCl (pH 7.5), 10 mM MgCl2, 1 mM MnCl2, 1 mM DTT and 100 μM ATP for 30min at 30°C. The autophosphorylation activity of MPK15 was detected with a  commercial antibody that could recognize phosphorylated Ser and Thr (ECM Biosciences, Versailles, KY, USA; Cat# PP2551, 1:1,000 dilution). Phosphorylation of MyBP substrate (Millipore, Burlington, MA, USA; Cat# 13-104) was detected with anti-phospho-MBP (anti-pMBP) antibody (Millipore; Cat# 05-429, 1:1,000 dilution).

Phylogenetic analysis

Sequences of MPK15 homologs were identified by BLAST searches at http://www.Arabidopsis.org/Blast/index.jsp. Multiple sequence alignments were generated using the Clustal Omega program at https://www.ebi.ac.uk/Tools/msa/clustalo/. The multiple-alignment file was further analyzed with BoxShade online software (https://embnet.vital-it.ch/software/BOX_form.html). A phylogenetic analysis was performed using the MEGA version 5.05 program with the neighbor-joining algorithm. Bootstrapping was performed with 1,000 replications. The alignment is provided as Supplemental File S1.

Elicitors and chemicals treatment

The flg22, elf18, and pep1 peptides were synthesized by Sangon Biotech (Shanghai, China). They were used at a final concentration of 1 μM. Chitin (Sigma–Aldrich; Cat# C9752) was used at a final concentration of 100 μg/mL. K-252a (Sigma–Aldrich; Cat# K2015) was prepared as a DMSO stock solution and used at a final concentration of 1 μM. λ-PPase was purchased from New England BioLabs (Ipswich, MA, USA; Cat# P0753S) and used following the manufacturer’s instructions.

Oligonucleotide sequences

The primers used in this study are listed in Supplemental Table S1.

Statistical analyses

The statistical analyses were performed with one-way ANOVA. The ANOVA tables are provided in Supplemental Table S2.

Accession numbers

Sequence data for the genes described in this article can be found in the TAIR database (https://www.arabidopsis.org) under the following accession numbers: MPK15 (At1g73670), BSK1 (At4g35230), PR1 (At2g14610), PR2 (At3g57260), PAD4 (At3g52430), FMO1 (At1g19250), FRK1 (At2g19190), NHL10 (At2g35980), ACTIN2 (At3g18780), FLS2 (At5g46330), CERK1 (At3g21630), MAPKKK3 (At1g53570), and MAPKKK5 (At5g66850).

Supplemental data

The following materials are available in the online version of this article.

Supplemental Figure S1. mpk15 mutants display WT-like responses to Pto DC3000 and Enhanced Susceptibility to H.a. Noco2.

Supplemental Figure S2. Characterization of MPK15 overexpression lines.

Supplemental Figure S3. mpk15 mutants show WT-like induction of powdery mildew-responsive genes.

Supplemental Figure S4. MPK15 Ser-511 site is conserved among the closed homologues of MPK15.

Supplemental Figure S5. PAMP receptor mutants are deficient in induction of MPK15 Ser-511 phosphorylation.

Supplemental Figure S6. Mutation in TDY motif affected the function of MPK15 in powdery mildew resistance.

Supplemental Figure S7. Ser-511 phosphorylation is not required for the interaction between MPK15 and BSK1.

Supplemental Figure S8. Characterization of MPK15 transcripts and MPK15 protein accumulation in transgenic plants.

Supplemental Figure S9. BSK1 kinase activity is critical for enhancing MPK15 Ser-511 phosphorylation.

Supplemental Figure S10. Patterns-induced MPK15 Ser-511 phosphorylation was not dependent on MAPKKK3/5.

Supplemental Figure S11. Growth phenotype of the transgenic plants.

Supplemental Figure S12. bsk1 mpk15 double mutants display bsk1-like susceptibility to powdery mildew.

Supplemental Table S1. Primers used in this study.

Supplemental Table S2. ANOVA tables for statistical analyses.

Supplemental File S1. Text file of the alignment used to generate the phylogenetic tree in Supplemental Figure S4.

Supplementary Material

koac027_Supplementary_Data

Acknowledgments

We thank the ABRC for providing T-DNA insertion lines and Dr. Jian-Min Zhou for mapkkk3-2 mapkkk5-2 seeds.

Funding

This work was supported by grants from the National Natural Science Foundation of China (31801020 and 32161133012).

Conflict of interest statement. The authors declare no conflict of interest.

Contributor Information

Hua Shi, State Key Laboratory of Ecological Control of Fujian-Taiwan Crop Pests, Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, Plant Immunity Center, Fujian Agriculture and Forestry University, Fuzhou 350002, China; Fujian Provincial Key Laboratory of Crop Breeding by Design, College of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, China.

Qiuyi Li, State Key Laboratory of Ecological Control of Fujian-Taiwan Crop Pests, Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, Plant Immunity Center, Fujian Agriculture and Forestry University, Fuzhou 350002, China; College of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, China.

Mingyu Luo, State Key Laboratory of Ecological Control of Fujian-Taiwan Crop Pests, Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, Plant Immunity Center, Fujian Agriculture and Forestry University, Fuzhou 350002, China; College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, China.

Haojie Yan, State Key Laboratory of Plant Cell and Chromosome Engineering, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China.

Bao Xie, State Key Laboratory of Ecological Control of Fujian-Taiwan Crop Pests, Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, Plant Immunity Center, Fujian Agriculture and Forestry University, Fuzhou 350002, China; College of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, China.

Xiang Li, State Key Laboratory of Ecological Control of Fujian-Taiwan Crop Pests, Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, Plant Immunity Center, Fujian Agriculture and Forestry University, Fuzhou 350002, China; College of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, China.

Guitao Zhong, State Key Laboratory of Ecological Control of Fujian-Taiwan Crop Pests, Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, Plant Immunity Center, Fujian Agriculture and Forestry University, Fuzhou 350002, China; College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, China.

Desheng Chen, State Key Laboratory of Ecological Control of Fujian-Taiwan Crop Pests, Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, Plant Immunity Center, Fujian Agriculture and Forestry University, Fuzhou 350002, China; College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, China.

Dingzhong Tang, State Key Laboratory of Ecological Control of Fujian-Taiwan Crop Pests, Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Crops, Plant Immunity Center, Fujian Agriculture and Forestry University, Fuzhou 350002, China.

 

D.T. and H.S. initiated the project and designed the experiments. H.S., Q.L., M.L., H.Y., X.L., B.X., and D.C. performed the experiments. H.S., G.Z., and D.T. analyzed the data. H.S. wrote the article. D.T. contributed to significant discussion and revision.

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (https://academic.oup.com/plcell) is: Dingzhong Tang: (dztang@fafu.edu.cn).

References

  1. Albert I, Hua C, Nürnberger T, Pruitt RN, Zhang L (2020) Surface sensor systems in plant immunity. Plant Physiol  182:  1582–1596 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomezgomez L, Boller T, Ausubel FM, Sheen J (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature  415:  977–983 [DOI] [PubMed] [Google Scholar]
  3. Bethke G, Pecher P, Eschen-Lippold L, Tsuda K, Katagiri F, Glazebrook J, Scheel D, Lee J (2012) Activation of the Arabidopsis thaliana mitogen-activated protein kinase MPK11 by the flagellin-derived elicitor peptide, flg22. Mol Plant Microbe Interact  25:  471–480 [DOI] [PubMed] [Google Scholar]
  4. Bi G, Zhou Z, Wang W, Li L, Rao S, Wu Y, Zhang X, Menke FLH, Chen S, Zhou JM (2018) Receptor-like cytoplasmic kinases directly link diverse pattern recognition receptors to the activation of mitogen-activated protein kinase cascades in Arabidopsis. Plant Cell  30:  1543–1561 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Boller T, Felix G (2009) A renaissance of elicitors: perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu Rev Plant Biol  60:  379–406 [DOI] [PubMed] [Google Scholar]
  6. Bracha-Drori K, Shichrur K, Katz A, Oliva M, Angelovici R, Yalovsky S, Ohad N (2004) Detection of protein–protein interactions in plants using bimolecular fluorescence complementation. Plant J  40:  419–427 [DOI] [PubMed] [Google Scholar]
  7. Cao Y, Liang Y, Tanaka K, Nguyen CT, Jedrzejczak RP, Joachimiak A, Stacey G (2014) The kinase LYK5 is a major chitin receptor in Arabidopsis and forms a chitin-induced complex with related kinase CERK1. Elife  3:  e03766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim JC, Park BO, Koo SC, et al. (2003) BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activatio of a transcription factor. Plant Physiol  132:  1961–1972 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chinchilla D, Bauer Z, Regenass M, Boller T, Felix G (2006) The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. Plant Cell  18:  465–476 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chinchilla D, Zipfel C, Robatzek S, Kemmerling B, Nürnberger T, Jones JD, Felix G, Boller T (2007) A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature  448:  497–500 [DOI] [PubMed] [Google Scholar]
  11. Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J  16:  735–743 [DOI] [PubMed] [Google Scholar]
  12. Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS (2006) Gateway-compatible vectors for plant functional genomics and proteomics. Plant J  45:  616–629 [DOI] [PubMed] [Google Scholar]
  13. Frye CA, Innes RW (1998) An Arabidopsis mutant with enhanced resistance to powdery mildew. Plant Cell  10:  947–956 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gao C, Sun P, Wang W, Tang D (2021) Arabidopsis E3 ligase KEG associates with and ubiquitinates MKK4 and MKK5 to regulate plant immunity. J Integr Plant Biol  63:  327–339 [DOI] [PubMed] [Google Scholar]
  15. He C, Fong S, Yang D, Wang GL (1999) BWMK1, a novel MAP kinase induced by fungal infection and mechanical wounding in rice. Mol Plant Microbe Interact  12:  1064–1073 [DOI] [PubMed] [Google Scholar]
  16. Huffaker A, Ryan CA (2007) Endogenous peptide defense signals in Arabidopsis differentially amplify signaling for the innate immune response. Proc Natl Acad Sci USA  104:  10732–10736 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ichimura K, Shinozaki K, Tena G, Sheen J, Henry Y, Champion A, Kreis M, Zhang S, Hirt H, Wilson C, et al. (2002) Mitogen-activated protein kinase cascades in plants: A new nomenclature. Trends Plant Sci  7:  301–308 [DOI] [PubMed] [Google Scholar]
  18. Jones JD, Dangl JL (2006) The plant immune system. Nature  444:  323–329 [DOI] [PubMed] [Google Scholar]
  19. Koo SC, Moon BC, Kim JK, Kim CY, Sung SJ, Min CK, Cho MJ, Yong HC (2009) OsBWMK1 mediates SA-dependent defense responses by activating the transcription factor OsWRKY33. Biochem Biophys Res Commun  387:  365–370 [DOI] [PubMed] [Google Scholar]
  20. Krol E, Mentzel T, Chinchilla D, Boller T, Felix G, Kemmerling B, Postel S, Arents M, Jeworutzki E, Al-Rasheid KAS, et al. (2010) Perception of the Arabidopsis danger signal peptide 1 involves the pattern recognition receptor AtPEPR1 and its close homologue AtPEPR2. J Biol Chem  285:  13471–13479 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kunze G, Zipfel C, Robatzek S, Niehaus K, Boller T, Felix G (2004) The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell  16:  3496–3507 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Li L, Li M, Yu L, Zhou Z, Liang X, Liu Z, Cai G, Gao L, Zhang X, Wang Y, et al. (2014) The FLS2-associated kinase BIK1 directly phosphorylates the NADPH oxidase RbohD to control plant immunity. Cell Host Microbe  15:  329–338 [DOI] [PubMed] [Google Scholar]
  23. Li Y, Li S, Bi D, Cheng YT, Li X, Zhang Y (2010) SRFR1 negatively regulates plant NB-LRR resistance protein accumulation to prevent autoimmunity. PLoS Pathog  6:  e1001111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Liang X, Zhou JM (2018) Receptor-like cytoplasmic kinases: Central players in plant receptor kinase–mediated signaling. Annu Rev Plant Biol  69:  267–299 [DOI] [PubMed] [Google Scholar]
  25. Lin W, Ma X, Shan L, He P (2013) Big roles of small kinases: The complex functions of receptor-like cytoplasmic kinases in plant immunity and development. J Integr Plant Biol  55:  1188–1197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Majhi BB, Sreeramulu S, Sessa G (2019) BRASSINOSTEROID-SIGNALING KINASE5 associates with immune receptors and is required for immune responses. Plant Physiol  180:  1166–1184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Manhães AMEDA, Ortiz-Morea FA, He P, Shan L (2021) Plant plasma membrane-resident receptors: Surveillance for infections and coordination for growth and development. J Integr Plant Biol  63:  79–101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mayank P, Grossman J, Wuest S, Boisson-Dernier A, Roschitzki B, Nanni P, Nühse T, Grossniklaus U (2012) Characterization of the phosphoproteome of mature Arabidopsis pollen. Plant J  72:  89–101 [DOI] [PubMed] [Google Scholar]
  29. Meng X, Zhang S (2013) MAPK cascades in plant disease resistance signaling. Annu Rev Phytopathol  51:  245–266 [DOI] [PubMed] [Google Scholar]
  30. Miya A, Albert P, Shinya T, Desaki Y, Ichimura K, Shirasu K, Narusaka Y, Kawakami N, Kaku H, Shibuya N (2007) CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proc Natl Acad Sci USA  104:  19613–19618 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nitta Y, Ding P, Zhang Y (2014) Identification of additional MAP kinases activated upon PAMP treatment. Plant Signal Behav  9:  e976155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pedley KF, Martin GB (2005) Role of mitogen-activated protein kinases in plant immunity. Curr Opin Plant Biol  8:  541–547 [DOI] [PubMed] [Google Scholar]
  33. Pitzschke A, Schikora A, Hirt H (2009) MAPK cascade signalling networks in plant defence. Curr Opin Plant Biol  12:  421–426 [DOI] [PubMed] [Google Scholar]
  34. Rodriguez MC, Petersen M, Mundy J (2010) Mitogen-activated protein kinase signaling in plants. Annu Rev Plant Biol  61:  621–649 [DOI] [PubMed] [Google Scholar]
  35. Shi H, Shen Q, Qi Y, Yan H, Nie H, Chen Y, Zhao T, Katagiri F, Tang D (2013) BR-SIGNALING KINASE1 physically associates with FLAGELLIN SENSING2 and regulates plant innate immunity in Arabidopsis. Plant Cell  25:  1143–1157 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Su J, Zhang M, Zhang L, Sun T, Liu Y, Lukowitz W, Xu J, Zhang S (2017) Regulation of stomatal immunity by interdependent functions of a pathogen-responsive MPK3/MPK6 cascade and abscisic acid. Plant Cell  29:  526–542 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sun L, Zhang J (2020) Regulatory role of receptor-like cytoplasmic kinases in early immune signaling events in plants. FEMS Microbiol Rev  44:  845–856 [DOI] [PubMed] [Google Scholar]
  38. Sun T, Nitta Y, Zhang Q, Wu D, Tian H, Lee JS, Zhang Y (2018) Antagonistic interactions between two MAP kinase cascades in plant development and immune signaling. EMBO Rep  19:  e45324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Takahashi F, Mizoguchi T, Yoshida R, Ichimura K, Shinozaki K (2011) Calmodulin-dependent activation of MAP kinase for ROS homeostasis in Arabidopsis. Mol Cell  41:  649–660 [DOI] [PubMed] [Google Scholar]
  40. Tang D, Christiansen KM, Innes RW (2005) Regulation of plant disease resistance, stress responses, cell death, and ethylene signaling in Arabidopsis by the EDR1 protein kinase. Plant Physiol  138:  1018–1026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tang D, Wang G, Zhou JM (2017) Receptor kinases in plant–pathogen interactions: More than pattern recognition. Plant Cell  29:  618–637 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tang W, Kim TW, Oses-Prieto JA, Sun Y, Deng Z, Zhu S, Wang R, Burlingame AL, Wang ZY (2008) BSKs mediate signal transduction from the receptor kinase BRI1 in Arabidopsis. Science  321:  557–560 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tena G, Asai T, Chiu WL, Sheen J (2001) Plant mitogen-activated protein kinase signaling cascades. Curr Opin Plant Biol  4:  392–400 [DOI] [PubMed] [Google Scholar]
  44. Wang W, Feng B, Zhou JM, Tang D (2020) Plant immune signaling: Advancing on two frontiers. J Integr Plant Biol  62:  2–24 [DOI] [PubMed] [Google Scholar]
  45. Wang Y, Nishimura MT, Zhao T, Tang D (2011) ATG2, an autophagy-related protein, negatively affects powdery mildew resistance and mildew-induced cell death in Arabidopsis. Plant J  68:  74–87 [DOI] [PubMed] [Google Scholar]
  46. Wang Y, Li Z, Liu D, Xu J, Wei X, Yan L, Yang C, Lou Z, Shui W (2014) Assessment of BAK1 activity in different plant receptor-like kinase complexes by quantitative profiling of phosphorylation patterns. J Proteomics  108:  484–493 [DOI] [PubMed] [Google Scholar]
  47. Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, Chen QJ (2015) Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol  16:  144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wu G, Liu S, Zhao Y, Wang W, Kong Z, Tang D (2015) ENHANCED DISEASE RESISTANCE4 associates with CLATHRIN HEAVY CHAIN2 and modulates plant immunity by regulating relocation of EDR1 in Arabidopsis. Plant Cell  27:  857–873 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yamada K, Yamaguchi K, Shirakawa T, Nakagami H, Mine A, Ishikawa K, Fujiwara M, Narusaka M, Narusaka Y, Ichimura K, et al. (2016) The Arabidopsis CERK1‐associated kinase PBL27 connects chitin perception to MAPK activation. EMBO J  35:  2468–2483 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yan H, Zhao Y, Shi H, Li J, Wang Y, Tang D (2018) BRASSINOSTEROID-SIGNALING KINASE1 phosphorylates MAPKKK5 to regulate immunity in Arabidopsis. Plant Physiol  176:  2991–3002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang M, Su J, Zhang Y, Xu J, Zhang S (2018) Conveying endogenous and exogenous signals: MAPK cascades in plant growth and defense. Curr Opin Plant Biol  45:  1–10 [DOI] [PubMed] [Google Scholar]
  52. Zhao C, Nie H, Shen Q, Zhang S, Lukowitz W, Tang D (2014) EDR1 physically interacts with MKK4/MKK5 and negatively regulates a MAP kinase cascade to modulate plant innate immunity. PLoS Genet  10:  e1004389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhao Y, Wu G, Shi H, Tang D (2019) RECEPTOR-LIKE KINASE 902 associates with and phosphorylates BRASSINOSTEROID-SIGNALING KINASE1 to regulate plant immunity. Mol Plant  12:  59–70 [DOI] [PubMed] [Google Scholar]
  54. Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JD, Boller T, Felix G (2006) Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell  125:  749–760 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

koac027_Supplementary_Data

Articles from The Plant Cell are provided here courtesy of Oxford University Press

RESOURCES