Skip to main content
NCBI home page
Pathogens and Disease logoLink to Pathogens and Disease
. 2022 Apr 11;80(1):ftac008. doi: 10.1093/femspd/ftac008

Tannerella forsythia strains differentially induce interferon gamma-induced protein 10 (IP-10) expression in macrophages due to lipopolysaccharide heterogeneity

Sreedevi Chinthamani 1, Rajendra P Settem 2, Kiyonobu Honma 3, Graham P Stafford 4, Ashu Sharma 5,✉
PMCID: PMC9053306  PMID: 35404415

Abstract

Tannerella forsythia is strongly implicated in the development of periodontitis, an inflammatory disease that destroys the bone and soft tissues supporting the tooth.  To date, the knowledge of the virulence attributes of T. forsythia species has mainly come from studies with a laboratory adapted strain (ATCC 43037). In this study, we focused on two T. forsythia clinical isolates, UB4 and UB20, in relation to their ability to activate macrophages. We found that these clinical isolates differentially induced proinflammatory cytokine expression in macrophages. Prominently, the expression of the chemokine protein IP-10 (CXCL10) was highly induced by UB20 as compared to UB4 and the laboratory strain ATCC 43037. Our study focused on the lipopolysaccharide component (LPS) of these strains and found that UB20 expressed a smooth-type LPS, unlike UB4 and ATCC 43037 each of which expressed a rough-type LPS. The LPS from UB20, via activation of TLR4, was found to be a highly potent inducer of IP-10 expression via signaling through STAT1 (signal transducer and activator of transcription-1). These data suggest that pathogenicity of T. forsythia species could be strain dependent and the LPS heterogeneity associated with the clinical strains might be responsible for their pathogenic potential and severity of periodontitis.

Keywords: periodontitis, Tannerella forsythia, lipopolysaccharide, CXCL10, IP-10

Periodontal pathogen T. forsythia strains differentially activate chemokine IP-10 expression in macrophages due to endotoxin heterogeneity.

Introduction

Tannerella forsythia is one of the pathogenic organisms implicated in the development of periodontitis, a chronic inflammatory disease characterized by progressive destruction of the tooth supporting apparatus that affects over 700 million people worldwide with a financial burden of over $442 billion per year (Kassebaum et al. 2014, Tonetti et al. 2017). The disease results from the subgingival colonization by a select pathogenic bacteria, T. forsythia among them being strongly represented (Socransky et al. 1998, Tanner and Izard 2006). Tannerella forsythia is also associated with peri-implantitis and endodontic infections (Perez-Chaparro et al. 2016, Al-Ahmad et al. 2018).

In spite of T. forsythia’s strong association with periodontitis, there is a lack of information on the organism's clinical and virulence repertoire. To date, information on its microbiology and pathogenicity has mainly come from studies with the laboratory adapted type strain ATCC 43037, which has been extensively used for the identification of the virulence factors by in vitro models and assessment of the pathogenic potential of the organism in vivo murine models (Sharma 2010, Chukkapalli et al. 2015). The genome sequences of at least 12 T. forsythia strains isolated from patients with different degrees of periodontitis are publicly available in the NCBI database. Our group has successfully cultivated and sequenced the genomes of three clinical isolates, namely UB4, UB20, and UB22, from periodontitis patients (Stafford et al. 2016). To the best of our knowledge, none of the clinical strains of T. forsythia, with the exception of clinical strain UB4, have been characterized for their virulence properties to date. Regarding UB4, Bloch et al. (2017) showed that the type strain ATCC 43037 and clinical strain UB4 differentially activated the cytokine responses of epithelial cells and monocytes in vitro owing to the presence of a different nonusolonic acid residue (pseudaminic acid in ATCC 43037 and legionaminic acid in UB4) attached to the bacterial surface glycoproteins. Bioinformatic and molecular phylogenetic analyses of genes encoding nonulosonic acid transferase in T. forsythia genomes has indicated that the UB20 strain groups together with the ATCC 43037 strain by virtue of the presence of a pseudaminic acid transferase gene, and thus contains pseudaminic acid residues in its S-layer glycoproteins similar to ATCC 43037 (Tomek et al. 2017).

The current study sought to determine the virulence potential of a laboratory adapted strain (ATCC 43037) and two clinical isolates (UB4 and UB20) of T. forsythia recently sequenced by our group (Stafford et al. 2016). Given that macrophages are the key players in periodontal inflammation and resorption (Hasturk et al. 2012) through release of inflammatory mediators and phagocytic activity, we investigated the interactions of two clinical isolates of T. forsythia with human macrophages derived from THP-1 monocytic cell line and peripheral blood monocytes (PBMCs).

Materials and methods

Culturing T. forsythia clinical isolates

Tannerella forsythia ATCC 43037 and clinical isolates UB20 and UB4 were grown in TF-broth (brain heart infusion media containing 5 μg/ml hemin, 0.5 μg/ml menadione, 0.001% N -acetylmuramic acid, 0.1% L-cysteine, and 5% fetal bovine serum) as we have described previously (Chinthamani et al. 2021).

Generation of THP-1-derived macrophages

The THP-1 cell line was obtained from ATCC (American Type Culture Collection), and maintained at 1 × 106 cells/ml in RPMI-1640 medium supplemented with 10% FBS and 2 mmol/l L-glutamine. THP-1 cells were differentiated using 100 nM phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich, St. Louis, MO) for 48 h. After 48 h of PMA activation, cells were placed in fresh RPMI-1640 (10% FCS and 1% L-glutamine) medium for an additional 24 h.

Generation of PBMC-derived macrophages

Macrophages were generated from monocytes according to a standard protocol described previously (Davies and Gordon 2005). Briefly, peripheral blood (5 ml) was obtained from self-reported healthy donors (males, 28–35 years, n = 3) after obtaining informed consent under a protocol approved by the Institutional Review Board of University at Buffalo. Blood was then layered on top of an equal volume of 1-step Polymorphs dextran gradient (Accurate Chemical). The sample was spun at 730 × g for 30 min at room temperature, and the uppermost band containing mononuclear cells (monocytes) was collected. Monocytes from each sample were then pooled and macrophages were generated in 6-well culture plates in culture medium (RPMI 1640 containing 10% FBS, 100 IU/ml penicillin, 100 mg/ml streptomycin, and 0.25 mg/ml amphotericin; Gibco, Grand Island, NY) for 6 days supplemented with 50 ng/ml M-CSF1 (macrophage colony-stimulating factor; PeproTech, Cranbury, NJ).

Macrophage stimulation and cytokine profiling

THP-1 macrophages (1 × 106/ml) in 6-well tissue culture dishes were stimulated with ATCC 43037, UB20, or UB4, each at an m.o.i. of 20 in triplicates, for either 6 h for transcriptomic profiling by PCR Arrays or 12 h for protein analysis by ELISA based assays. The m.o.i, dose of 20 was empirically selected. Preliminary studies showed that at higher m.o.i doses (> 50) there is detachment of macrophages from the plate surfaces and possible cell death. Time points of 6 and 12 h were selected to allow bacteria to effectively interact with macrophages and optimally regulate transcription and translation, respectively, of cytokines. Unstimulated cells were used as controls for basal gene expression level. RNA was isolated from stimulated THP-1 cells using RNeasy mini kits (Qiagen, Germantown, MD). Briefly, cells were harvested in cell lysis buffer (RLT) and passed over QiaShredder columns, and the resulting lysates were purified on RNeasy columns with on-column DNAse 1 treatment as per the manufacturer's recommendations (Qiagen). Real-time PCR was then performed using the RT2 Profiler™ PCR array (Qiagen) in a 96-well plate preloaded with the primers. A pathway focused RT2 profiler PCR arrays were performed to screen a panel of genes related to Human Dendritic and Antigen Presenting Cell (PAHS-406Z; Qiagen). In order to ensure the high quality of cDNA, reverse transcription reactions were performed prior to the array, using RT2 First Strand Kit. Data analysis was carried with the relative gene expression calculated by the 2–ΔΔCt method in the web-based software package for RT2 Profiler PCR array systems (GeneGlobe, Qiagen).

For cytokine/chemokine protein quantification, cell culture supernatants were collected after treatments as above, centrifuged for 10 min at 250 × g and kept at −80°̊C until required. IL-6, TNF-α, IL-1β, and IL-10 were assayed by multiplex bead array from Bio-Rad (Bio-Plex Pro human cytokine, Bio-Rad Laboratories, Hercules, CA) according to manufacturer's instructions. In some experiments, THP-1-derived macrophages were stimulated with LPS preparations in the presence of 1% serum. Assays were read on the Bio-Plex 200 system (Bio-Rad). For CXCL10, we used the human CXCL10 ELISA kit (e-Biosciences). All measurements were made following manufacturers’ instructions with a standard curve generated with the CXCL10 recombinant protein provided in the kit.

Quantitative reverse transcription PCR (RT-qPCR)

RNA from cells were extracted as above and used to generate cDNA by using iScript cDNA Synthesis kit (Bio-Rad). Reactions were set up with cDNA samples for RT-qPCR containing iQ SYBR Green SuperMix (Bio-Rad). For assessing CXCL10 transcript levels, RT-qPCR assays with 5′-GCAGCTGATTTGGTGACCATCATTGG-3 and 5'-TGCAAGCCAATTTTGTCCACGTGTTG-3' primers for CXCL10 and 5’- ATGGGGAAGGTGAAGGTCG -3’ and 5’- GGGGTCATTGATGGCAACAATA -3’ for GAPDH were performed. The fold change in CXCL10 gene expression was calculated by 2–ΔΔCt method using GAPDH housekeeping gene for normalization.

Extraction and purification of LPS

LPS was purified from bacterial cells as we have described previously (Vinogradov et al. 2017). Briefly, the bacterial cell pellets were suspended in distilled water (1 g wet weight per 1.5 ml water) and an equal volume of 90% phenol was added. The suspension was stirred at 65–70°C for 20 min, cooled, centrifuged, and aqueous phase was dialyzed in a dialysis tube (3.5 K MWCO, Pierce, Rockford, IL) at 4°C against distilled water with at least three changes. The solution was brought to 0.15 M NaCl/50 mM Tris-HCl, 1 mM MgCl2, 1 mM CaCl2, and then treated with deoxyribonuclease and ribonuclease A (Sigma-Aldrich; each at 0.01 mg/ml) for 2 h. Endonuclease digested samples were then treated with proteinase- K (Sigma-Aldrich) at 0.04 mg/ml at 60°C for 1 h. Finally, the digested samples were dialyzed as above and lyophilized. Purified LPS was analyzed by SDS-PAGE electrophoresis in the presence of urea and visualized after silver staining, and stored at −20°C until use.

Western blot analysis

THP-1-derived macrophages were stimulated with purified LPS (1 μg/ml) of each strain separately or whole cells of each strain (ATCC 43037, UB20, or UB4) at 20 m.o.i. for specified time periods and cells were washed with PBS and then lysed in ice cold RIPA (50 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 2 mM EDTA, and pH 7.5) buffer containing protease and phosphatase inhibitors, lysates were prepared, separated by 10% SDS-PAGE, and transferred to nitrocellulose membrane. The membrane was then blocked with AdvanBlock-Chemi (Advansta Inc., CA) at room temperature for 1 h and incubated with primary antibodies specific to phospho-STAT1 (p-STAT1) and STAT1 (1:1000; cell signaling) at 4°C overnight. The membrane was washed with TBS (10 mM Tris-HCl, 150 mM NaCl, and pH7.5) containing 0.1% Tween-20 (TBST) and incubated with horseradish peroxidase-conjugated antibody at room temperature for 1 h. Membranes were washed after each antibody incubation three times with TBST for 5 min per wash. After the final wash, membranes were incubated for 5 min with a working solution of Western Bright ECL substrate (Advansta) and then imaged with a ChemiDoc™ Touch Imaging System (Bio-Rad). Band intensities from stored images were analyzed by ImageJ software using Gel analysis plugin (US National Institutes of Health, Bethesda, MD).

Statistical analysis

Prism 9 software (GraphPad Software) was used for all statistical analyses. Statistical significance was determined by two-tailed paired or unpaired Student's t-test for two groups or one-way ANOVA with appropriate post hoc tests for multiple group comparisons. A P-value of less than .05 was considered statistically significant.

Results

Tannerella forsythia strains differentially induce cytokine/chemokine expression in macrophages

We compared the chemokine/cytokine expression in THP-1-derived macrophages in response to T. forsythia type strains ATCC 43037 and clinical strains UB4 and UB20 by employing RT2-PCR arrays (PAH-406Z; Human Dendritic and Antigen Presenting Cell). Data (gene-specific Ct values) were analyzed using the Qiagen GeneGlobe Data Analysis web platform (https://geneglobe.qiagen.com/us/analyze) to obtain relative transcriptional regulation values of genes. The results showed that several genes were differentially regulated (Fig. 1A and B), with CXCL10 (location C12 on the PCR array plate; Fig. 1A) the highest with approximatey 20-fold increase, while IRF-7, a key regulator of interferons and downstream interferon-stimulated genes (ISGs) including CXCL10 (Weighardt et al. 2004, Schneider et al. 2014) was also significantly regulated (5-fold increase; Fig. 1A). The complete gene list, along with the well location of each gene is shown in Figure S1 (Supporting Information). As shown, CXCL10 and IRF7 transcripts were highly induced in UB20-stimulated macrophages as compared to the ATCC 43037- or UB4-stimulated macrophages. The transcriptional induction of CXCL10 was validated by gene-specific real-time reverse transcription PCR (RT-qPCR) with UB20 inducing up to 15-fold higher transcription of CXCL10 than ATCC 43037 or UB4 strains (Fig. 2A). Moreover, the transcriptional induction of CXCL10 correlated with the protein levels. The ELISA assay results showed that the concentrations of CXCL10 protein in the supernatants of THP-1 as well as human PBMC-derived macrophages were significantly higher following UB20 stimulation as compared to ATCC 43037 or UB4 stimulation (Fig. 2B). Moreover, the protein levels of a select set of cytokines, TNF-α, IL-6, IL-1 β, and IL-10, were also validated by ELISA. The data showed that the cytokine protein levels paralleled transcriptional levels. As shown, IL-6 levels were significantly higher and TNF-α and IL-10 levels were similar in the UB20-stimulated macrophages as compared to the ATCC 43037- and UB-stimulated macrophages; moreover, the levels of IL-1β protein (gene not represented in PCR arrays) was higher in UB20-stimulated versus UB4- and 43037-stimulated macrophages (Fig. 2C).

Figure 1.

Figure 1.

Open in a new tab

RT2 Profiler PCR Array analysis of cytokine/chemokine gene expression in macrophages. THP-1-derived macrophages stimulated with T. forsythia ATCC 43037, UB4, or UB20 at 20 m.o.i each for 6 h. Total RNA was isolated and subjected to cDNA synthesis followed by transcription analysis using human Dendritic and Antigen Presenting Cell PCR Array (PAH-406Z). An overview of the 84 genes regulated in macrophages in response to bacterial challenge is provided in heatmaps (upregulated genes marked in red) and scatterplots (red dots show upregulated cytokine/chemokine genes). Panel A and B show gene expression changes induced by UB20 normalized against ATCC 43037- and UB4-induced gene expression changes, respectively. In scatterplots, the central line indicate genes that were unchanged with boundaries representing the 2-fold regulation cut-off. Genes Highly Induced: (A09), CCL2; (A07), CCL5; (B09), CD4; (C12), CXCL10; (D01), CXCL12; (D06), FAS; (D12), HLA-A; (E11), IL6; (F01), IRF7; and (G02), TAP-2. The data represent the mean of two independent experiments.

Figure 2.

Figure 2.

Open in a new tab

Validation of T. forsythia-induced changes in cytokine expression in macrophages. (A) Validation of IP-10 transcript expression by RT-qPCR. Total RNA was extracted from THP-1 macrophages stimulated with T. forsythia strains at 20 m.o.i. for 6 h and expression of IP-10 (CXCL10) transcript was performed by RT-qPCR. (B) Protein levels of IP-10 secreted in the culture supernatants of THP-1- and PBMC-derived macrophages. (C) Protein levels of a set of cytokines secreted in the culture supernatants of THP1-derived macrophages. Protein levels were assayed by ELISA. The experiments were repeated at least twice and data represent the mean ± s.d. of three technical replicates; ***, P ≤ .001, n.s., not significant.

UB20 lipopolysaccharide activated TLR4 to induce STAT1 phosphorylation and IP-10 secretion

LPS molecules from many species have been implicated in IP-10 induction in macrophages and dendritic cells via activation of TLR4 (Bjorkbacka et al. 2004, Bandow et al. 2012). To determine if T. forsythia LPS was responsible for IP-10 secretion in macrophages, proteinase K-treated purified LPS from T. forsythia strains was used as an agonist for IP-10 induction in macrophage. The SDS-PAGE analysis of LPS molecules showed that UB20 LPS migrated as a ladder-like pattern, indicative of a smooth type LPS (sLPS) having O-oligosaccharide repeats of varying lengths (Fig. 3A). On the other hand, LPS from ATCC 43037 as well as UB4 migrated without a banding pattern typical of LPS with O-antigen repeats, similar to what has been shown previously for the rough-type LPS from ATCC 43037 by Posch et al. (2013). These data indicate that UB20 expresses a sLPS, whereas ATCC 43037 and UB4 each appear to express a rough-type LPS (rLPS). The ATCC 43037 rLPS has been partially characterized previously (Posch et al. 2013) and shown to require serum factor(s) for its ability to induce inflammatory cytokine secretion in macrophages. To test the ability of LPS of different strains to induce IP-10 expression, macrophages were stimulated with LPS (1 μg/ml) in the presence of 1% fetal bovine serum for 8 h and IP-10 levels in the medium determined by ELISA. We found that similar to the trend observed with the whole bacteria (Fig. 2C), LPS from ATCC 43037 and UB4 were significantly less potent compared to LPS from UB20 in inducing IP-10 secretion; LPS from ATCC 43037 as well as UB4 induced a weaker IP-10 response, whereas a robust IP-10 response was seen with UB20 LPS (Fig. 3B). We also confirmed that UB20 LPS signals in a TLR4-dependent manner since IP-10 secretion was blocked dose dependently by a TLR4-specific inhibitor TAK-242 (Ono et al. 2020; Fig. 3C). In relation to IP-10 secretion, type 1 interferon (IFN-α and IFN-β) signaling following TLR4 activation independent of MyD88 pathway leads to the phosphorylation of STAT1 (signal transducer and activator of transcription 1), which after dimerization and translocation to the nucleus activates IP-10 expression (Ohmori and Hamilton 2001). We tested the activity of LPS molecules from T. forsythia strains to phosphorylate STAT1 and induce IP-10 expression in macrophages. Our results showed that whole cells (20 m.o.i.) and LPS (1 μg/ml) derived from the UB20 strain induced STAT1 phosphorylation at 3 h postchallenge (Fig. 4). No STAT1 phosphorylation was observed with whole bacteria or LPS from the ATCC 43037 or UB4 strain (Fig. 4). These data suggest that STAT1 signaling is involved in IP-10 secretion by UB20 LPS via a MyD88-independent pathway. Taken together, these results suggest that unlike the ATCC 43037 or UB4 strain, UB20 strain expresses a sLPS, which is a potent inducer of CXCL10 expression in macrophages due to STAT1 activation downstream of MyD988-independnet TLR4 signaling.

Figure 3.

Figure 3.

Open in a new tab

Electrophoretic analysis and IP-10-inducing activity of LPS of T. forsythia strains. (A) Electrophoresis of purified LPS from different strains on SDS-PAGE. Lanes: 1, 43073; 2, UB4; 3, UB20; and I μg of LPS from each strain (B) Levels of IP-10 secreted by LPS-stimulated macrophages derived from THP-1 and PBMCs. (C) Inhibition of E. coli O55:B5 and UB 20 LPS activity by TLR4-specific metabolic inhibitor TAK-242. The experiments were repeated at least twice and data represent the mean ± s.d. of three technical replicates; ***, P ≤ .001.

Figure 4.

Figure 4.

Open in a new tab

Induction of STAT1 phosphorylation in response to bacteria and LPS. THP1 macrophages were stimulated with T. forsythia strains (MOI of 20 for 1 and 3 h; panel A) or LPS (1μg/ml; panel B) for 3 h. After stimulation, cell lysates were prepared and the total and phosphorylated STAT1 levels were analyzed by western immunoblotting using STAT1- and p-STAI1-specific antibodies. Panel (B) shows the densitometric analysis of a representative immunoblot by ImageJ software. Profile plots (peak areas) of the respective bands and the graph showing relative intensities (pSTAT1/STAT1) of the samples are shown below. Data are representative of two independent experiments.

Discussion

To date, the knowledge of the pathogenic potential of the T. forsythia species has come mainly from the type-strain ATCC 43037, even though several clinical isolates of the species have been isolated and sequenced at the genomic level. A major factor hindering biological characterization of clinical isolates is likely due to difficulties in cultivating them in the laboratory environment due to the fastidious growth requirements of the species in general. Here, we sought the inflammatory potential of two clinical isolates, UB20 and UB4 (Stafford et al. 2016), recently sequenced by our group in terms of their cytokine-inducing activity in macrophages. Our data showed that the T. forsythia clinical isolates UB20 and UB4, and the type-strain ATCC 43037 differentially induced proinflammatory cytokines/chemokines in macrophages. The data showed that the interferon gamma-induced protein 10 (IP-10/CXCL10) was most prominently induced by the clinical isolate UB20 as compared to the clinical isolate UB4 and the type strain ATCC 43037. Since LPS molecule from many bacterial species has been implicated in IP-10 induction (Bjorkbacka et al. 2004, Bandow et al. 2012), we focused our studies on the LPS component of different T. forsythia strains. LPS can induce MyD88-dependent and -independent signaling cascades in macrophage after binding to TLR4 receptor, and particularly MyD88-independent TRIF (TIR-domain-containing adapter-inducing interferon-β) pathway causes activation of a delayed response IFN-dependent genes (Fitzgerald et al. 2003, Takeuchi and Akira 2010, Sin et al. 2020). Moreover, TRIF-dependent IFN-β signaling results in the phosphorylation of STAT1, which causes translocation of p-STAT1 to the nucleus and induction of IP-10 gene expression (Ohmori and Hamilton 2001, Toshchakov et al. 2002, Zughaier et al. 2005, Thomas et al. 2006, Park et al. 2015). In line with these signaling scenarios, our data showed that UB20 and its LPS-induced STAT1 phosphorylation and IP-10 expression in macrophages. On the other hand, LPS molecules from ATCC 43037 and UB4 strains were less potent in stimulating IP-10 secretion in human macrophages. A previous study has shown that LPS from ATCC 43037 is effective in inducing cytokine secretion in human macrophages only in the presence of serum factors. In the current study, we noted that even in the presence of serum factors the ATCC 43037 LPS was not a potent inducer of IP-10 and STAT1 phosphorylation. The reason for this differential activity of LPS molecules toward macrophages is yet to be determined. To this end, the contribution of LPS substructures, including the lipid A and O-antigen components, in biological activities of LPS has been well-recognized. Particularly, polysaccharide O-antigen moieties can alter the interaction of LPS molecules with the TLR4 receptor complex and phagocytosis, impacting activation of downstream inflammatory pathways (Eder et al. 2009, Herath et al. 2013, Stephens et al. 2021). For example, substructure modifications impacting the biological activity of LPS are well-documented in the periodontal pathogen Porphyromonas gingivalis (Paramonov et al. 2001, 2009, Al-Qutub et al. 2006). These include modification of lipid A component with either tetra- or penta-acylated chains, which can be phosphorylated or unphosphorylated (Al-Qutub et al. 2006), and O-antigen chains with varying length and composition (Paramonov et al. 2001, 2009). In addition, some P. gingivalis strains can express a unique form of LPS, known as A-LPS, in which the anionic polysaccharide repeating unit consists of a phosphorylated branched D-mannose containing oligomers (Rangarajan et al. 2017). Together, these modifications allow the pathogen to modulate and evade the host immune response. Therefore, determination of structural composition of LPS from T. forsythia strains is important in delineating the structure–activity relationship of LPS heterogeneity in the species. Structural analysis of LPS from UB20 and UB4 is challenging due to the low recovery of LPS from these fastidious bacteria. Despite these challenges, studies are in progress in our laboratory to determine the chemical structure of LPS of UB4 and UB20 strains. Finally, analysis of the draft genome sequence of UB20, in direct comparison with the UB4 and ATCC 43037 sequences has not revealed a clear candidate for an O-antigen biosynthesis gene cluster at this stage.

Previous studies showed that T. forsythia can induce differential expression of cytokines in epithelial cells and monocytes due to differences in the nonusolonic acid derivatives linked to the bacterium's S-layer glycoproteins (Bloch et al. 2017, Tomek et al. 2017). Our current study showed that nonusolonic acid sugars play no role in the differential induction of IP-10 in macrophages since both the UB20 and ATCC 43037 strains express pseudaminic acid. An important finding of our study is that the differential activation of IP-10 chemokine by T. forsythia strains is dependent on their LPS composition. However, the impact of IP-10 regulation by T. forsythia strains on their pathogenesis remains to be explored. IP-10 (CXCL10) in addition to having a chemotactic activity toward leukocytes, and thus playing a direct role in the inflammatory process, has been shown to possess antimicrobial activity against various species of Gram-positive and Gram-negative bacteria (Holdren et al. 2014, Margulieux et al. 2016, Marshall et al. 2016). Based on these properties of IP-10, we predict that UB20 colonization might cause tissue and bone destruction via independent actions of CXCL10; induction of osteoclastogenesis as result of leukocyte infiltration and antimicrobial action of IP-10 against commensal oral microbiota to promote dysbiosis.

In summary, T. forsythia strains differentially induce interferon gamma-induced protein 10 (IP-10/CXCL10) due to lipopolysaccharide heterogeneity. A clinical isolate, UB20 expresses a smooth LPS which can induce IP-10 expression in macrophages via STAT1 phosphorylation downstream of TLR4 signaling. In contrast, ATCC 43037 and another clinical isolate, UB4, express rough-type molecules which are not potent inducers of TLR4. We predict that colonization by UB20 or related phylotypes might induce a heightened leukocyte recruitment response as result of increased CXCL10 secretion and promote a subgingival dysbiotic community due to antimicrobial activity of CXCL10. While there is no current evidence of the distribution of the different T. forsythia strains in patient plaque samples, the data are suggestive that different strains have heterogenous effects and that UB20 colonization might enhance periodontitis severity.

Authors' contributions

A.S. conceived the work. S.C., R.P.S., and K.H. performed the experiments. S.C. wrote the initial draft. S.C., G.P.S., and A.S. critically analyzed the data and all authors were critical reviewers of the manuscript.

Supplementary Material

ftac008_Supplemental_File
Click here for additional data file. (48.7KB, docx)

ACKNOWLEDGEMENTS

This work was funded by the NIH/NIDCR award number DE029497 to A.S. The authors would like to thank Andrew McCall at the UB School of Dental Medicine Optical Imaging and Analysis Facility for help with gel imaging and RT-qPCR instrumentation.

Contributor Information

Sreedevi Chinthamani, Department of Oral Biology, 311 Foster Hall, University at Buffalo, Buffalo, NY 14214, USA.

Rajendra P Settem, Department of Oral Biology, 311 Foster Hall, University at Buffalo, Buffalo, NY 14214, USA.

Kiyonobu Honma, Department of Oral Biology, 311 Foster Hall, University at Buffalo, Buffalo, NY 14214, USA.

Graham P Stafford, School of Clinical Dentistry, University of Sheffield, 19 Claremont Crescent, Sheffield, S10 2TA, UK.

Ashu Sharma, Department of Oral Biology, 311 Foster Hall, University at Buffalo, Buffalo, NY 14214, USA.

Conflicts of interest statement

The authors have no conflicts of interest to declare.

References

  1. Al-Ahmad A, Muzafferiy F, Anderson ACet al. Shift of microbial composition of peri-implantitis-associated oral biofilm as revealed by 16S rRNA gene cloning. J Med Microbiol. 2018;67:332–40. [DOI] [PubMed] [Google Scholar]
  2. Al-Qutub MN, Braham PH, Karimi-Naser LMet al. Hemin-dependent modulation of the lipid a structure of Porphyromonas gingivalislipopolysaccharide. Infect Immun. 2006;74:4474–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bandow K, Kusuyama J, Shamoto Met al. LPS-induced chemokine expression in both myd88-dependent and -independent manners is regulated by Cot/Tpl2-ERK axis in macrophages. FEBS Lett. 2012;586:1540–6. [DOI] [PubMed] [Google Scholar]
  4. Bjorkbacka H, Fitzgerald KA, Huet Fet al. The induction of macrophage gene expression by LPS predominantly utilizes Myd88-independent signaling cascades. Physiol Genomics. 2004;19:319–30. [DOI] [PubMed] [Google Scholar]
  5. Bloch S, Zwicker S, Bostanci Net al. Immune response profiling of primary monocytes and oral keratinocytes to different tannerella Tannerella forsythia strains and their cell surface mutants. Mol Oral Microbiol. 2017;32:155–67. [DOI] [PubMed] [Google Scholar]
  6. Chinthamani S, Settem PR, Honma Ket al. Purification of Tannerella forsythia surface-layer (S-Layer) proteins. Methods Mol Biol. 2021;2210:135–42. [DOI] [PubMed] [Google Scholar]
  7. Chukkapalli SS, Rivera MF, Velsko IMet al. Chronic oral infection with major periodontal bacteria Tannerellaforsythia modulates systemic atherosclerosis risk factors and inflammatory markers. Pathog Dis. 2015;73:ftv009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Davies JQ, Gordon S.. Isolation and culture of human macrophages. Methods Mol Biol. 2005;290:105–16. [DOI] [PubMed] [Google Scholar]
  9. Eder K, Vizler C, Kusz Eet al. The role of lipopolysaccharide moieties in macrophage response to Escherichia coli. Biochem Biophys Res Commun. 2009;389:46–51. [DOI] [PubMed] [Google Scholar]
  10. Fitzgerald KA, Rowe DC, Barnes BJet al. LPS-TLR4 signaling to IRF-3/7 and NF-kappaB involves the toll adapters TRAM and TRIF. J Exp Med. 2003;198:1043–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hasturk H, Kantarci A, Van Dyke T.. Oral inflammatory diseases and systemic inflammation: role of the macrophage. Front Immunol. 2012;3:118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Herath TD, Darveau RP, Seneviratne CJet al. Tetra- and penta-acylated lipid a structures of Porphyromonas gingivalis LPS differentially activate TLR4-mediated NF-kappaB signal transduction cascade and immuno-inflammatory response in human gingival fibroblasts. PloS ONE. 2013;8:e58496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Holdren GO, Rosenthal DJ, Yang Jet al. Antimicrobial activity of chemokine CXCL10 for dermal and oral microorganisms. Antibiotics. 2014;3:527–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kassebaum NJ, Bernabe E, Dahiya Met al. Global burden of severe periodontitis in 1990-2010: a systematic review and meta-regression. J Dent Res. 2014;93:1045–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Margulieux KR, Fox JW, Nakamoto RKet al. CXCL10 acts as a bifunctional antimicrobial molecule against Bacillus anthracis. Mbio. 2016;7. DOI: 10.1128/mBio.00334-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Marshall A, Celentano A, Cirillo Net al. Antimicrobial activity and regulation of CXCL9 and CXCL10 in oral keratinocytes. Eur J Oral Sci. 2016;124:433–9. [DOI] [PubMed] [Google Scholar]
  17. Ohmori Y, Hamilton TA.. Requirement for STAT1 in LPS-induced gene expression in macrophages. J Leukoc Biol. 2001;69:598–604. [PubMed] [Google Scholar]
  18. Ono Y, Maejima Y, Saito Met al. TAK-242, a specific inhibitor of Toll-like receptor 4 signalling, prevents endotoxemia-induced skeletal muscle wasting in mice. Sci Rep. 2020;10:694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Paramonov N, Bailey D, Rangarajan Met al. Structural analysis of the polysaccharide from the lipopolysaccharide of Porphyromonas gingivalis strain W50. Eur J Biochem. 2001;268:4698–707. [DOI] [PubMed] [Google Scholar]
  20. Paramonov NA, Aduse-Opoku J, Hashim A. Structural analysis of the core region of O-lipopolysaccharide of Porphyromonas gingivalis from mutants defective in O-antigen ligase and O-antigen polymerase. J Bacteriol. 2009;191:5272–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Park OJ, Cho MK, Yun CHet al. Lipopolysaccharide of Aggregatibacteractinomycetemcomitans induces the expression of chemokines MCP-1, MIP-1alpha, and IP-10 via similar but distinct signaling pathways in murine macrophages. Immunobiology. 2015;220:1067–74. [DOI] [PubMed] [Google Scholar]
  22. Perez-Chaparro PJ, Duarte PM, Shibli JAet al. The current weight of evidence of the microbiologic profile associated with peri-implantitis: a systematic review. J Periodontol. 2016;87:1295–304. [DOI] [PubMed] [Google Scholar]
  23. Posch G, Andrukhov O, Vinogradov Eet al. Structure and immunogenicity of the rough-type lipopolysaccharide from the periodontal pathogen Tannerella forsythia. Clin Vaccine Immunol. 2013;20:945–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Rangarajan M, Aduse-Opoku J, Hashim Aet al. LptO (PG0027) is required for lipid a 1-phosphatase activity in Porphyromonas gingivalis W50. J Bacteriol. 2017;199:e00751–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Schneider WM, Chevillotte MD, Rice CM.. Interferon-stimulated genes: a complex web of host defenses. Annu Rev Immunol. 2014;32:513–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Sharma A. Virulence mechanisms of Tannerellaforsythia. Periodontol 2000. 2010;54:106–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Sin WX, Yeong JP, Lim TJFet al. IRF-7 mediates type i IFN responses in endotoxin-challenged mice. Front Immunol. 2020;11:640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Socransky SS, Haffajee AD, Cugini MAet al. Microbial complexes in subgingival plaque. J Clin Periodontol. 1998;25:134–44. [DOI] [PubMed] [Google Scholar]
  29. Stafford GP, Chaudhuri RR, Haraszthy Vet al. Draft genome sequences of three clinical isolates of Tannerella forsythia isolated from subgingival plaque from periodontitis patients in the United States. Genome Announc. 2016;4:e01286–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Stephens M, Liao S, von der Weid PY. Ultra-purification of lipopolysaccharides reveals species-specific signalling bias of TLR4: importance in macrophage function. Sci Rep. 2021;11:1335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Takeuchi O, Akira S.. Pattern recognition receptors and inflammation. Cell. 2010;140:805–20. [DOI] [PubMed] [Google Scholar]
  32. Tanner AC, Izard J.. Tannerella forsythia, a periodontal pathogen entering the genomic era. Periodontol 2000. 2006;42:88–113. [DOI] [PubMed] [Google Scholar]
  33. Thomas KE, Galligan CL, Newman RDet al. Contribution of interferon-beta to the murine macrophage response to the toll-like receptor 4 agonist, lipopolysaccharide. J Biol Chem. 2006;281:31119–30. [DOI] [PubMed] [Google Scholar]
  34. Tomek MB, Janesch B, Maresch Det al. A pseudaminic acid or a legionaminic acid derivative transferase is strain-specifically implicated in the general protein O-glycosylation system of the periodontal pathogen Tannerella forsythia. Glycobiology. 2017;27:1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tonetti MS, Jepsen S, Jin Let al. Impact of the global burden of periodontal diseases on health, nutrition and wellbeing of mankind: a call for global action. J Clin Periodontol. 2017;44:456–62. [DOI] [PubMed] [Google Scholar]
  36. Toshchakov V, Jones BW, Perera PYet al. TLR4, but not TLR2, mediates IFN-beta-induced STAT1alpha/beta-dependent gene expression in macrophages. Nat Immunol. 2002;3:392–8. [DOI] [PubMed] [Google Scholar]
  37. Vinogradov E, St Michael F, Homma Ket al. Structure of the LPS O-chain from Fusobacterium nucleatum strain 10953, containing sialic acid. Carbohydr Res. 2017;440-441:38–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Weighardt H, Jusek G, Mages Jet al. Identification of a TLR4- and TRIF-dependent activation program of dendritic cells. Eur J Immunol. 2004;34:558–64. [DOI] [PubMed] [Google Scholar]
  39. Zughaier SM, Zimmer SM, Datta Aet al. Differential induction of the toll-like receptor 4-MyD88-dependent and -independent signaling pathways by endotoxins. Infect Immun. 2005;73:2940–50. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ftac008_Supplemental_File
Click here for additional data file. (48.7KB, docx)

Articles from Pathogens and Disease are provided here courtesy of Oxford University Press

RESOURCES