Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2022 May 2;18:160. doi: 10.1186/s12917-022-03260-1

Case of necrotic enteritis associated with campylobacteriosis and coccidiosis in an adult Indian peacock (Pavo cristatus)

Aleksandra Ledwoń 1,, Małgorzata Murawska 2, Izabella Dolka 1, Dorota Chrobak Chmiel 2, Piotr Szleszczuk 1
PMCID: PMC9063363  PMID: 35501900

Abstract

Background

To date, Campylobacter jejuni has not been found to be pathogenic to peafowl. The available publications show that out of a total of 44 samples tested from peafowl, this bacterium was isolated only in two cases. Eimeria pavonina infestations in the peafowl have been described, but no fatal cases have been reported yet.

Case presentation

The four-year-old peacock was presented with chronic diarrhea, emaciation and weakness. Post mortem examination revealed enlarged and pale kidneys, small intestinal mucosal necrosis and thickening of intestinal wall, and pericardial effusion. The histopathological examination revealed necrotic enteritis with marked mononuclear cells infiltration associated with the presence of coccidia, additionally there was histological evidence of septicemia in liver and kidneys. Bacteria identification was based on light microscopy of the small intestine sample, culture, and biochemical tests. Further identification was based on PCR. Antimicrobial susceptibility profile was created by determination of minimal inhibitory concentration (MIC) values for 6 antimicrobial agents from 5 different classes. PCR assays were performed to detect virulence factors genes responsible for motility, cytolethal distending toxin production, adhesion and internalization. Bacteriology of the small intestine sample showed abundant growth almost exclusively of Campylobacter jejuni, resistant to ciprofloxacin, gentamycin and ampicillin. Bacteria was sensitive to Amoxicillin + clavulanic acid, tetracycline, and erythromycin. All tested virulence factors genes have been detected. The parasitological examination was performed by microscopic examination of fresh faeces and intestinal content, and revealed the moderate number of Eimeria pavonina, Histomonas meleagridis, single Capillaria spp. eggs as well Heterakis spp. like parasites.

Conclusion

The above case shows that a virulent isolate of Campylobacter jejuni in combination with a parasitic invasion may cause chronic enteritis in peafowl, which most likely led to extreme exhaustion of the host organism and death.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-022-03260-1.

Keywords: Peafowl, Campylobacter jejuni, Eimeria pavonina, Necrotic enteritis

Background

Campylobacteriosis

Campylobacter jejuni (C. jejuni) is relatively often isolated from chickens [1, 2] and is considered as non-pathogenic for these birds, however there are reports of hepatitis in poultry (known as avian vibrionic hepatitis - AVH), caused by this bacterium [3] in the presence of risk factors (e.g. stress, immunosuppressive conditions of the host) [2]. The source of Campylobacter spp. infection for birds is carrier faeces [4].

C. jejuni is of interest to veterinarians mainly due to its zoonotic potential [5].

In humans, this infection is a common cause of bacterial enteritis, but can be associated also with Guillian-Barré syndrome (GBS), reactive arthritis and necrotic enterocolitis in children [6, 7].

In birds the pathogenicity of C. jejuni depends on its origin and the age. According to some authors, isolates from humans are more pathogenic, for newly hatched chickens than chicken-origin isolates [8]. Screening studies on healthy 31 Indian peafowl from three Michigan zoos have not shown the presence of Campylobacter spp., while a moderate number of coccidia has been found in these birds [9]. In a study conducted by a laboratory in Louisiana, C. jejuni was found in one Indian peafowl out of 10 samples tested from these birds [10]. Research by Misawa et al. [11] in zoo animals showed the presence of C. jejuni in one of the 3 studied peacocks.

Coccidiosis

Coccidia invasions in peafowl have been reported by several authors in the past. Among others, the following species of coccidia in peafowl have been described in Asian countries and Egypt: Eimeria pavonina [12], Eimeria mandalin [13], Eimeria roscoviensis [14], Eimeria mayurai [15], Eimeria riyadhae, Eimeria arabica [16] and Eimeria pavoaegyptica [17]. In Pakistan, coccidial oocysts were found in 20–30% of peafowl faecal samples [18]. In peafowl kept in Europe, Isospora mayuri and Eimeria pavonina (E. pavonina) were reported [19, 20].

Campylobacter spp. and Eimeria spp. coinfection

Invasion of Eimeria tenella, which is closely related to E. pavonina [20], has been confirmed to increase C. jejuni colonization in the intestines of chickens [21]. To date, no fatal co-infection of C. jejuni and E. pavonina in the Indian peafowl has been reported.

Case presentation

In June 2020, a 4-year-old Indian peacock (Pavo cristatus) has been brought to the Veterinary Clinic of the Institute of Veterinary Medicine, Warsaw University of Life Sciences due to weakness and chronic diarrhea. The peacock was a private property of a person who had 4 more peahens, that did not show any signs of disease. Peafowl were free range. The bird had atrophy of the pectoral muscles and was unable to move independently. The owner’s reported that weakness and diarrhea were observed in this bird 3 months ago and numerous coccidia and Histomonas meleagridis were detected at the microscopic examination of the fresh faeces sample. Transient improvement was obtained after the use of toltrazuril (Baycox 2.5%, Bayer, Germany) at a dose 7 mg / kg of body weight, followed by ronidazole (Trichonidazole, Biovet Puławy, Poland) at a dose of 60 mg /1 l of drinking water for 7 days. The condition of the peacock, however, gradually began to deteriorate, and bird died.

Necropsy was performed on the same day. Necropsy showed that the peacock was emaciated (Supplementary Fig. 1), the feathers around the cloaca were soiled with diarrheal faeces (Supplementary Fig. 2). Serous fluid in the pericardial sac was found. The testes were inactive and kidneys were moderately enlarged and pale. The mucosa of the small intestine was significantly thickened and covered with pale yellow coating (Fig. 1). The lumen of the caeca was dilated, but mucosa of the caeca was unchanged (Supplementary Figs. 35). Only the proximal caecum and rectum were thickened and pale pink in color (Supplementary Fig. 5). Macroscopically, no changes were found in other organs.

Fig. 1.

Fig. 1

Mucosal thickening of the jejunum with prominent folds, covered with a pale yellow coating

Histopathology

Tissue samples (liver, kidney, and intestines) were fixed in 10% neutral-buffered formalin, dehydrated in increasing gradients of ethyl alcohol and embedded in paraffin. The tissue sample was then cut in the microtome at four micron thickness. Finally, paraffin sections were stained with haematoxylin and eosin (H-E). In the jejunum: massive, diffuse inflammatory infiltrate mainly composed of mononuclear cells (numerous lymphocytes, plasma cells, macrophages), intermixed with coccidian parasites in the increased lamina propria showing marked architectural distortion. Severe destruction of the mucosa: loss of the villi (blunt or flattened), marked epithelial necrosis, and sloughing, the loss or damaged crypts, moderate congestion of the mucosa, and focal small grains structures in blood vessels resemble bacterial clusters were detected (Fig. 2). In addition, perivascular mononuclear cell infiltration in the muscular and serous membranes was present focally. In the liver multifocal necrosis of hepatocytes and microvacuolar fatty degeneration of hepatocytes, disintegrated areas with fibrinoid necrosis of vessels surrounded by inflammatory cells (mainly mononuclear cells), fibrin thrombi, numerous were found (Fig. 3). In the kidneys: perivascular mononuclear inflammatory infiltrate, necrosis of blood vessel walls, and necrosis of tubular epithelial cells, glomerulonephritis, fibrin thrombi in the capillary of the glomerulus were found (Fig. 4).

Fig. 2.

Fig. 2

Intestine. Necrotic enteritis. Marked inflammation mainly consisted of mononuclear cells in the lamina propria of the mucosa; perivascular inflammation in the muscular membrane. Villus atrophy, crypt epithelial cell proliferation and necrosis, congestion. H-E, 40x. Left insert: Destroyed enterocytes of the intestinal crypt due to invasion of coccidia (arrowheads), 200x. Right insert: free coccidian parasites (arrowheads) intermixed with exfoliated epithelial cells on the destroyed luminal surface of the villi. 400x.*

Fig. 3.

Fig. 3

Liver. Massive inflammation of the portal triad. Liver parenchyma displays necrotic and degenerated hepatocytes (microvacuolar fatty change; arrowheads), venous thrombi, and congestion. H-E, 100x

Fig. 4.

Fig. 4

Kidney. Massive perivascular inflammation (arrowhead), proliferative glomerulopathy, necrosis of renal epithelial cells both in the cortex and medulla. H-E, 100x

Parasitology

In order to detect the presence of parasites from the content of the small intestine, caecum and rectum, direct wet mount and stained preparations were made using the Ziehl-Neelsen staining and Hemacolor® rapid staining (Merck, Germany). To determine coccidia species identity, DNA was isolated from the content of the jejunum using the QIAamp DNA Stool Mini Kit (Qiagen GmbH, Germany), following a two-day protocol [22], additionally introducing sample homogenization with glass beads for 10 min on the GeneReady homogenizer (Hangzhou Lifereal Biotechnology Co., Ltd., China). We amplified 767 base pairs of the cox-1 mitochondrial gene using universal Eimeria spp. primer pairs described by Miska et al. [23]. The PCR product was then sequenced. Examination of the rectal and small intestine contents showed an average 4 coccidia oocyst in the high-dry power field (400x magnification), and two eggs of Capillaria spp. in the preparation. Examination of the caecal content revealed large, round, mobile flagellates with the morphology of Histomonas meleagridis and several nematodes similar to Heterakis gallinarum. In the preparation stained with the Ziehl-Neelsen stain, average of 3 coccidia oocysts were found per high-power field (1000x magnification). The presence of Histomonas meleagridis was confirmed in a microscopic slide, stained with the Hemacolor® method. Based on the sequencing of the PCR product, the coccidia were identified as Eimeria pavonina, and its sequence was uploaded to GenBank and assigned accession number: OM891494.

Bacteriology

Isolation and identification

A fragment of the jejunum taken aseptically was used for direct microscopic examination and for culturing. A direct microscope slide was stained using Gram-staining method. After the analysis of direct microscopic slide collected clinical material was streaked on Columbia Agar plates with 5% sheep blood (CBA; GRASO Biotech, Poland) and on modified charcoal-cefoperazone-deoxycholate agar plates (mCCDA; GRASO Biotech, Poland), followed by the streak plate method was performed. Another 2 fragments of the small intestine were placed in the sterile tubes containing 5 mL of Preston Broth with Preston Modified Supplement (BIOCORP, France) and 5% defibrinated sheep blood (GRASO Biotech, Poland). Agar plates were incubated at 42 °C under microaerophilic conditions created by GasPak Campy Container System (BD, USA) for 48 h. Preston’s broth/s were incubated as described above but with shaking (120 RPM) and after pre-propagation 100 μL of the liquid media was streaked on the CBA and mCCDA plates and incubated as described above, without shaking. Obtained colonies were streaked eventually on the CBA plates and incubated as described above. Preliminary identification was based on colony morphology, both on Columbia Agar and mCCDA plates, Gram staining, motility, microscopic morphology, catalase and oxidase tests. Further identification, to the species level, was conducted by PCR [24]. Briefly, genomic DNA was extracted using Genomic Mini isolation kit (A&A Biotechnology, Poland), following the manufacturer’s protocol with minor modifications.

For the identification of Campylobacter jejuni (mapAF, mapAR for mapA target – 604 bp amplicon)) and Campylobacter coli (Mu3, Mu for Random target – 364 bp amplicon) species using the PCR method, two pairs of species-specific primers [24] and also, genomic DNA’s of standard strains (C. jejuni 81–176 and C. coli 605) and sterile, deionized water were used as positive and negative controls respectively.

Antimicrobial susceptibility testing

Antimicrobial susceptibility profile was created by determination of minimal inhibitory concentration (MIC) values, using ETEST® gradient strips (Biomerieux, France). Six antimicrobial agents from five classes were tested (Tables 1 and 2). Choice of antimicrobial agents was based on their usage in veterinary medicine and the necessity of monitoring resistance of C. jejuni to antimicrobials used in human treatment due to zoonotic nature of campylobacteriosis. Interpretation of the obtained results was based on EUCAST [25] or CLSI [26] guidelines Table 1 summarizes information on used antimicrobial agents and criteria of interpretation. Additionally, for ciprofloxacin resistance mechanism determination, a 270 bp fragment of the gyrA gene was amplified, according to Chatur et al. [27] and sent for Sanger sequencing to Genomed (Poland) and analyzed for point mutations in our laboratory using DNA Baser Assembler software v. 5.11.3 (Heracle BioSoft SRL, Romania).

Table 1.

List of antimicrobial agents, their abbreviations and concentrations used for creating antimicrobial susceptibility profile. Interpretation according to: aEUCAST, bCLSI

Antimicrobial agent class Antimicrobial agent Abbr. ETEST Interpretation
Concn. [mg/L] S I R
β-lactams Ampicillina AM 0,016–256 ≤2 x ≥8
Amoxicillin + clavulanic acida AMC 0,016–256 ≤2 x ≥8
Aminoglycosides Gentamicina GE 0,016–256 ≤0,5 x ≥0,5
Tetracyclines Tetracyclineb TE 0,016–256 ≤4 8 ≥16
Macrolides Erythromycinb E 0,016–256 ≤8 16 ≥32
Fluoroquinolones Ciprofloxacina CIP 0,002–32 ≤0,5 x ≥0,5
Table 2.

Antimicrobial agents susceptibility profile of Campylobacter jejuni isolate

Antimicrobial agent class Antimicrobial agent Abbr. MIC value Interpretation
β-lactams Ampicillin AM 256 Ra
Amoxycyllin + clavulanic acid AMC 0,5 Sb
Aminoglycosides Gentamicin GE 0,75 R
Tetracyclines Tetracycline TE 0,75 S
Macrolides Erythromycin E 1 S
Fluoroquinolones Ciprofloxacin CIP 3 R

aR-resistant

bS- sensitive

Virulence factors genes detection

PCRs were performed to detect chosen virulence factors genes responsible for: motility (flaA, flaB), cytolethal distending toxin production (cdtA, cdtB, cdtC), adhesion and invasion to the host’s cells (ciaB, pldA, cadF, flpA). Assays were performed on genomic DNA of the identified C. jejuni isolate (isolation as described in “Isolation and identification” section), using primers and conditions as in reference publications. Used primers along with the amplicons sizes are listed in Table 3.

Table 3.

Primers used for C. jejuni virulence factors genes detection by PCR

Target gene Primer name Amplicon size [bp] Sequence 5′ – 3′ Ref.
flaA flaA-F 1728 GGATTTCGTATTAACACAAATGGTGC [28]
flaA-R CTGTAGTAATCTTAAAACATTTTG
flaB fB1 260 AAGGATTTAAAATGGGTTTTAGAATAAACACC [29]
fA2 GCTCATCCATAGCTTTATCTGC
cdtA cdtA-f 370 CCTTGTGATGCAAGCAATC [30]
cdtA-R ACACTCCATTTGCTTTCTG
cdtB cdtB-F 620 CAGAAAGCAAATGGAGTGTT [31]
cdtB-R AGCTAAAAGCGGTGGAGTAT
cdtC cdtC-F 182 TTGGCATTATAGAAAATACAGTT [31]
cdtC-R CGATGAGTTAAAACAAAAAGATA
ciaB ciaB-F 527 TGCGAGATTTTTCGAGAATG [32]
ciaB-R TGCCCGCCTTAGAACTTACA
pldA pldA-F 385 AAGAGTGAGGCGAAATTCCA [32]
pldA-R GCAAGATGGCAGGATTATCA
cadF cadF-F2B 400 TTGAAGGTAATTTAGATATG [33]
cadF-R1B CTAATACCTAAAGTTGAAAC
flpA Cj1279c-F 832 TCAGAAGATGGCAAGGTTATAGAAG [34]
Cj1279c-R GTTATTGCTATTGATTCAGCTGGAC

Bacteriology results

Isolation and identification

A direct microscope slide from small intestine sample stained with Gram method showed numerous Gram-negative, thin, helical rods with almost no other biota (Supplementary Fig. 6). After incubation on mCCDA plates (direct inoculation), medium-numerous, medium-sized, round, flat, grey colonies with no gloss were obtained in pure culture. After pre-propagation on the supplemented Preston Broth, on Columbia Blood Agar plates we obtained growth of the pure culture of medium-sized, round, flat-convex, greyish and non-haemolytic colonies. Grown bacterial colonies were both catalase and oxidase positive. Microscopic slide from microbial cultures on blood agar plates, stained with Gram method, showed Gram-negative, thin, helical rods. Wet-mount slide from blood agar culture showed thin, motile, helical rods with characteristic corkscrew-like movement.

As a result of the PCR assay with mapAF and mapAR primers, we obtained single amplification product, about 600 bp in size during the electrophoresis in 1% agarose gel in 1X TAE buffer, the same as for positive control, which allowed us to identify isolate as Campylobacter jejuni, which sequence was uploaded to GenBank and assigned accession number OM927984. We obtained no product with Mu3 and Mu4 primers (for C. coli identification).

Antimicrobial agents susceptibility of Campylobacter jejuni isolate

Additionally, as a result of sequencing of the fragment of gyrA gene, point mutation (transition) in position 257 (257C > T) was found, resulting in amino acid substitution in codon 86 (Thr-86-Ile), which is the most common and frequent fluoroquinolones resistance mechanism among Campylobacter genus [35].

Virulence factors genes detection

We have detected all of the selected genes responsible for motility (flaA, flaB), cytolethal distending toxin production (cdtA, cdtB, cdtC) and adhesion and internalization process (ciaB, pldA, cadF, flpA) by obtaining single product of expected size (Table 3) in each PCR assay.

Discussion and conclusions

Necrotic enteritis in poultry is a disease caused mainly by Clostridium perfringens [36]. Other bacterial, parasitic, and viral factors have also been reported to cause similar changes in poultry, but this was not Campylobacter spp. [37]. Previous studies [911] show that, C. jejuni is not often isolated from peafowl. So far, no case of a peafowl disease caused by this bacteria has been described. However, in other bird species, C. jejuni was isolated from the intestinal tract of clinically affected and asymptomatic birds [2, 4]. Clinical signs of avian campylobacteriosis have been observed in pet birds (mainly Passeriformes) and generally were associated with subacute to chronic hepatitis, include lethargy, anorexia, diarrhea and emaciation [4]. At necropsy, the liver is enlarged, pale or greenish, congested, with or without hemorrhage. Coalescing necrotic hepatitis is a common histological finding [4].

In poultry, Campylobacter jejuni has been considered as a commensal microorganism which colonizes its primary host rather than infecting it, in the absence of any obvious clinical signs, however, recent studies show possible pathogenicity of this bacterium for chickens [38]. The clinical signs of campylobacteriosis were experimentally induced in young chickens. Infected birds showed symptoms of diarrhea, weight loss, and even died [39].. Microscopic changes were found, ranging from moderate infiltration of mononuclear cells in ileum and cecum [39], to villus atrophy in the jejunum [40], mucosal damage, notably thickening, shortening and fusion of villi in the ileum [41]. In the presented case, the changes in the small intestine were similar, and their greater advancement may be caused by the concomitant parasitic invasion.

In the examined peacock, no changes in the liver were found macroscopically, but microscopic examination showed advanced necrosis and inflammation in the liver and kidneys. It is known that toxins produced by C. jejuni may be responsible for necrotic changes in the chicken embryo liver [42].

Antibiotics used in Campylobacter infections include macrolides such as erythromycin [43], tetracyclines, streptomycin and furans [8]. The isolate from the studied case additionally showed sensitivity to amoxicillin with clavulanic acid. The resistance of the tested strain to ciprofloxacin determined by single point mutation in the gyrA gene, is in line with the recent trends in fluoroquinolone resistance in strains of members of the genus Campylobacter, isolated from livestock and clinical samples from several countries [33].

So far, the authors have not observed fatal cases of coccidiosis in adult peafowl and no mortality cause by coccidia in peafowl has been documented in available literature. The only description of E. pavonina infestation reported in Europe [20] is a case of marked depression in a young peacock (during winter), while other 33 adult and young peafowl in this place, showed no symptoms of the disease [20]. Interestingly, no parasites were detected in faecal samples from the diseased bird, but in samples of birds from the same and other aviaries [20]. In presented case, although many oocysts were not found in the faeces and intestinal contents, the infestation was confirmed by histopathological examination.

Toltrazuril is a triazinetrione derivative administered orally in the drinking water for the treatment of coccidiosis in chickens and turkeys. The recommended dose and duration of treatment for chickens and turkeys is 7 mg/kg bw per day for two consecutive days (https://www.ema.europa.eu/en/medicines/veterinary/referrals/toltrazuril)- and this is how the described peacock was treated 3 months before his death. In the case described by Hauck et al. [20], treatment with toltrazuril was at the same dose, but twice for 3 days with a break of 5 days. Studies conducted by Gesek et al. [44] with doses of 7 mg / kg bw, 14 mg /kg bw. and 24.5 mg / kg for 2 days in Japanese quails, showed that only a dose of 24.5 mg / kg bw, led to total destruction of the coccidia, but only in two of the six treated birds. However, the use of such high doses causes pathologic toxic changes in the liver and kidneys [44]. Other available drugs that may be used in the treatment of coccidiosis in ornamental Gallinaceous birds are sulfonamides. Studies in turkeys have shown that toltrazuril is more effective than sulfonamides [45]. There is therefore a need to test the effectiveness of other triazine compounds, such as aminomizuril and ethanamizuril [46] in peafowl.

In the presented case, Histomonas meleagridis was found in the cecum, but no changes typical of this invasion were observed. Much more often cryptosporidiosis was diagnosed as the cause of changes in the intestines in peacocks [47, 48], but in the case described, these parasites were not found in microscopic examination.

Presented case shows that despite the fact that Campylobacter jejuni is considered non-pathogenic for most healthy chickens [3], it may induce clinical signs and mortality in peafowl. This case provide guidance to veterinarians who struggle with chronic diarrhea in peafowl, to include campylobacteriosis in diagnostic tests, as well as do not neglect coccidiosis therapy even in adult birds.

Supplementary Information

Additional file 1. (5.4MB, jpg)
Additional file 2. (8.2MB, jpg)
Additional file 3. (5.2MB, jpg)
Additional file 4. (5.6MB, jpg)
Additional file 5. (5.5MB, jpg)
Additional file 6. (886.7KB, jpg)

Acknowledgments

The authors would like to thank dr Ilona Stefańska from the Department of Preclinical Sciences WULS, for help in the processing of the research results.

Abbreviations

mg / kg.

Milligrams per kilogram

mg /l.

Milligrams per liter

spp.

Species

μl

Microliter

bp

Base pair

PCR

Polymerase chain reaction

bw

Body weight

ppm

Parts per million

Authors’ contributions

AL was responsible for performing and interpretation of clinical examination, necropsy, parasitology and was main contributor in preparing this manuscript. MM was responsible for molecular analysis and interpretation of microbiological data and writing of the manuscript. ID was responsible for histopathology interpretation and writing of the manuscript. DCC was involved in microbiological analysis of sample described in this report. PS supervised the work, was responsible for interpretation of data and design of the work. All authors read and approved the final manuscript.

Funding

This study was funded by Warsaw University of Life Sciences.

Availability of data and materials

The data generated or analyzed during this study are included in this published article and its supplementary files. The raw data of DNA- sequencing are available from the NCBI database under accession number PRJNA819941. (SRX14610090 and SRX14609836) https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA819941.

Declarations

Ethics approval and consent to participate

Not applicable; A case of natural disease in an ornamental bird is described, and the owner agreed to necropsy of the peacock.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Rossler E, Signorini ML, Romero-Scharpen A, Soto LP, Berisvil A, Zimmermann JA, Fusari ML, Olivero C, Zbrun MV, Frizzo LS. Meta-analysis of the prevalence of thermotolerant Campylobacter in food-producing animals worldwide. Zoonoses Public Health. 2019;66(4):359–369. doi: 10.1111/zph.12558. [DOI] [PubMed] [Google Scholar]
  • 2.Laconi A, Drigo I, Palmieri N, Carraro L, Tonon E, Franch R, Bano L, Piccirillo A. Genomic analysis of extra-intestinal Campylobacter jejuni and Campylobacter coli isolated from commercial chickens. Vet Microbiol. 2021;259:109161. doi: 10.1016/j.vetmic.2021.109161. [DOI] [PubMed] [Google Scholar]
  • 3.Pielsticker C, Glünder G, Rautenschlein S. Colonization properties of Campylobacter jejuni in chickens. Eur J Microbiol Immunol (Bp) 2012;2(1):61–65. doi: 10.1556/EuJMI.2.2012.1.9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gerlach H. Bacteria. In: Ritchie B, Harrison G, Harrison L, editors. Avian Medicine Principles and Application. Lake Worth: Wingers Publishing, Inc.; 1994. pp. 949–965. [Google Scholar]
  • 5.Jackson R. Gastrointestinal disorders. In: Poland G, Raftery A, editors. BSAVA Manual of Backyard Poultry Medicine and Surger. Gloucester: BSAVA; 2019. p. 178–204.
  • 6.Colver AF, Pedler SJ, Hawkey PM. Severe Campylobacter infection in children. J Inf Secur. 1985;11(3):217–220. doi: 10.1016/s0163-4453(85)93096-8. [DOI] [PubMed] [Google Scholar]
  • 7.Altekruse SF, Stern NJ, Fields PI, Swerdlow DL. Campylobacter jejuni—An emerging foodborne pathogen. Emerg Infect Dis. 1999;5(1):28–35. doi: 10.3201/eid0501.990104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Lam KM, DaMassa AJ, Morishita TY, Shivaprasad HL, Bickford AA. Pathogenicity of Campylobacter jejuni for turkeys and chickens. Avian Dis. 1992;36(2):359–363. doi: 10.2307/1591513. [DOI] [PubMed] [Google Scholar]
  • 9.Hollamby S, Sikarskie JG, Stuht J. Survey of peafowl (Pavo cristatus) for potential pathogens at three Michigan zoos. J Zoo Wildl Med. 2003;34(4):375–379. doi: 10.1638/03-077. [DOI] [PubMed] [Google Scholar]
  • 10.Yogasundram K, Shane SM, Harrington KS. Prevalence of Campylobacter jejuni in selected domestic and wild birds in Louisiana. Avian Dis. 1989;33(4):664–667. doi: 10.2307/1591142. [DOI] [PubMed] [Google Scholar]
  • 11.Misawa N, Shinohara S, Satoh H, Itoh H, Shinohara K, Shimomura K, Kondo F, Itoh K. Isolation of Campylobacter species from zoo animals and polymerase chain reaction-based random amplified polymorphism DNA analysis. Vet Microbiol. 2000;71(1–2):59–68. doi: 10.1016/S0378-1135(99)00156-X. [DOI] [PubMed] [Google Scholar]
  • 12.Banik DC, Ray HN. On a new coccidium, Eimeria pavonina. n. sp. from peacock, Pavo cristatus linn. Bull Calcutta Sch Trop Med.1961;9:61.
  • 13.Banik DC, Ray HN. On a new coccidium, Eimeria mandalin n sp from peacock Bull Calcutta Sch Trop Med 1964;12:27. [PubMed]
  • 14.Mandal AK. Studies on some aspects of avian coccidia (Protozoa: Sporozoa), vol. 3. Five new species of the genus Eimeria (Schneider), and a new subspecies of Eimeria roscoviensis (Labbe) Proc Zool Soc (Calcutta) 1965;18:47–57. [Google Scholar]
  • 15.Bhatia BB, Pande BP. A new coccidium, Eimeria mayurai (Sporozoa. Eimeriidiae) from the common peafowl Pavo cristatus. Proc Natl Acad Sci India Section B. 1966;36:39–42. [Google Scholar]
  • 16.Amoudi MA. Two new species of Eimeria from peacocks (Pavo cristatus) in Saudi Arabia. J Protozool. 1988;3:546–548. doi: 10.1111/j.1550-7408.1988.tb04149.x. [DOI] [PubMed] [Google Scholar]
  • 17.El-Shahawy IS. Eimeria pavoaegyptica sp. nov. (Apicomplexa: Eimeriidae) in faeces of Indian peacocks, Pavo cristatus Linnaeus, 1758 Galliformes: Phasianidae) from Egypt. Mem Inst Oswaldo Cruz 2010;105:965–969. [DOI] [PubMed]
  • 18.Qamar MF, Shahid H, Aftab AMA, Farooq U. Prevalence of Coccidiosis in Peacock at Lahore- Pakistan Available from: https://www.semanticscholar.org/author/M.-F.-Qamar/50233624
  • 19.Williams RB. Notes on some coccidia of peafowl, pheasants and chickens. Vet Parasitol. 1978;4:193–197. doi: 10.1016/0304-4017(78)90011-0. [DOI] [Google Scholar]
  • 20.Hauck R, Hafez HM. Description of Eimeria pavonina (coccidia) of peafowl in Germany. Avian Dis. 2012;56(1):238–242. doi: 10.1637/9864-072711-Case.1. [DOI] [PubMed] [Google Scholar]
  • 21.Macdonald SE, van Diemen PM, Martineau H, Stevens MP, Tomley FM, Stabler RA, Blake DP. Impact of Eimeria tenella coinfection on Campylobacter jejuni colonization of the chicken. Infect Immun. 2019;87(2):e00772–e00718. doi: 10.1128/IAI.00772-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Loss Chaves S, Dias I, Pomilla C. Extraction of genomic DNA from carnivore fecal samples using QIAamp DNA Stool Mini Kit. (Modified from QIAamp® DNA Stool Handbook) Stool Extraction Protocol. 2010. [Google Scholar]
  • 23.Miska KB, Schwarz RS, Jenkins MC, Rathinam T, Chapman HD. Molecular characterization and phylogenetic analysis of Eimeria from turkeys and gamebirds: implications for evolutionary relationships in Galliform birds. J Parasitol. 2010;96:982–986. doi: 10.1645/GE-2344.1. [DOI] [PubMed] [Google Scholar]
  • 24.On SLW, Jordan PJ. Evaluation of 11 PCR Assays for Species-Level Identification of Campylobacter jejuni and Campylobacter coli. J. Clin Micr. 2003;41(1):330–336. doi: 10.1128/JCM.41.1.330-336.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.The European Committee on Antimicrobial Susceptibility Testing . Breakpoints tables for interpretation of MICs and zone diameters. Version 11.0. 2021. [Google Scholar]
  • 26.CLSI, editor. Methods for antimicrobial susceptibility testing of infrequently isolated or fastidious Bacteria isolated from animals. 1st ed. CLSI supplement VET06. Clinical and Laboratory Standards Institute: Wayne; 2017. [Google Scholar]
  • 27.Chatur YA, Brahmbhatt MN, Modi S, Nayak JB. Fluoroquinolone resistance and detection of topoisomerase gene mutation in Campylobacter jejuni isolated from animal and human sources. Int J Curr Microbiol Appl Sci. 2014;3(6):773–778. [Google Scholar]
  • 28.Nachamkin I, Bohachick K, Patton CM. Flagellin gene typing of Campylobacter jejuni by restriction fragment length polymorphism analysis. J Clin Microbiol. 1993;31:1531–1536. doi: 10.1128/jcm.31.6.1531-1536.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Konkel ME, Gray SA, Kim BJ, Gravis SG. Yoon J:identification of enteropathogenes Campylobacter jejuni and Campylobacter coli based on the cadF virulence gene and its product. J Clin Microbiol. 1999;37:510–517. doi: 10.1128/JCM.37.3.510-517.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hickey TE, McVeigh AL, Scott DA, Michielutti RA, Bixby A, Carroll SA, Bourgeois AL, Guerry P. Campylobacter jejuni cytolethal distending toxin mediates release of interleukin-8 from intestinal epithelial cells. Infect Immun. 2000;68:6535–6541. doi: 10.1128/IAI.68.12.6535-6541.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Datta S, Niwa H, Itoh K. Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. J Med Microbiol. 2003;52(4):345–348. doi: 10.1099/jmm.0.05056-0. [DOI] [PubMed] [Google Scholar]
  • 32.Goon S, Kelly JF, Logan SM, Ewing CP, Guerry P. Pseudaminic acid, the major modification on Campylobacter flagellin, is synthesized via the Cj1293 gene. Mol Microbiol. 2003;50:659–671. doi: 10.1046/j.1365-2958.2003.03725.x. [DOI] [PubMed] [Google Scholar]
  • 33.Zheng J, Meng J, Zhao S, Singh R, Song W. Adherence to and invasion of human intestinal epithelial cells by Campylobacter jejuni and Campylobacter coli isolates from retail meat products. J Food Prot. 2006;69:768–774. doi: 10.4315/0362-028X-69.4.768. [DOI] [PubMed] [Google Scholar]
  • 34.Flanagan RC, Neal-McKinney JM, Dhillon AS, Miller WG, Konkel ME. Examination of Campylobacter jejuni putative adhesins leads to the identification of a new protein, designated FlpA, required for chicken colonization. Infect Immun. 2009;77(6):2399–2407. doi: 10.1128/IAI.01266-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sproston EL, Wimalarathna H, Sheppard SK. Trends in fluoroquinolone resistance in Campylobacter. Microb genom. 2018;4(8):e000198. doi: 10.1099/mgen.0.000198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Cooper KK, Songer JG, Uzal FA. Diagnosing clostridial enteric disease in poultry. J Vet Diagn Investig. 2013;25:314–327. doi: 10.1177/1040638713483468. [DOI] [PubMed] [Google Scholar]
  • 37.Uzal FA, Sentíes-Cué CG, Rimoldi G, Shivaprasad HL. Non-Clostridium perfringens infectious agents producing necrotic enteritis-like lesions in poultry. Avian Pathol. 2016;45(3):326–333. doi: 10.1080/03079457.2016.1159282. [DOI] [PubMed] [Google Scholar]
  • 38.Awad WA, Hess C, Hess M. Re-thinking the chicken-Campylobacter jejuni interaction: a review. Avian Pathol. 2018;47(4):352–363. doi: 10.1080/03079457.2018.1475724. [DOI] [PubMed] [Google Scholar]
  • 39.Ruiz-Palacios GM, Escamilla E, Torres M. Experimental Campylobacter diarrhea in chickens. Infect Immun. 1981;34:250–255. doi: 10.1128/iai.34.1.250-255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lamb-Rosteski J, Kalischuk L, Douglas Inglis G, Buret G. Epidermal growth factor inhibits Campylobacter jejuni-induced claudin-4 disruption, loss of epithelial barrier function, and Escherichia coli translocation. Infect Immun. 2008;76:3390–3398. doi: 10.1128/IAI.01698-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Humphrey S, Chaloner G, Kemmett K, Davidson N, Williams N, Kipar A, Humphrey T, Wigley P. Campylobacter jejuni is not merely a commensal in commercial broiler chickens and affects bird welfare. mBio. 2014;5:e01364. doi: 10.1128/mBio.01364-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Clark AG, Bueschkens DH. Response of the chick embryo to live and heat-killed Campylobacter jejuni injected into the yolk sac. Epidemiol Infect. 1989;103:577–585. doi: 10.1017/S0950268800030971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Flammer K. Antymicrobial Therapy. In: Ritchie B, Harrison G, Harrison L, editors. Avian Medicine Principles and Application. Lake Worth: Wingers Publishing, Inc.; 1994. pp. 434–450. [Google Scholar]
  • 44.Gesek M, Sokół R, Welenc J, Tylicka Z, Korzeniowska P, Kozłowska A, Małgorzata W, Otrocka-Domagała I. Histopathological observations of the internal organs during toltrazuril (Baycox®) treatment against naturally occurring coccidiosis in Japanese quail. Pak Vet J. 2015;35(4):479–483. [Google Scholar]
  • 45.Greuel E, Mundt HC, Cortez S. Sulfonamide and toltrazuril therapy of experimental turkey coccidiosis. Dtsch Tierarztl Wochenschr. 1991;98(4):129–132. [PubMed] [Google Scholar]
  • 46.Zhang M, Li X, Zhao Q, She R, Xia S, Zhang K, Zhang L, Wang X, Wang M, Liu Y, Wang C, Zhang J, Xue F, Fei C. Anticoccidial activity of novel triazine compounds in broiler chickens. Vet Parasitol. 2019;267:4–8. doi: 10.1016/j.vetpar.2019.01.006. [DOI] [PubMed] [Google Scholar]
  • 47.Liu X, Zhu H, Meng W, Dong H, Han Q, An Z, Qi M, Ge Y, Wang R. Occurrence of a Cryptosporidium xiaoi-like genotype in peafowl (Pavo cristatus) in China. Parasitol Res. 2019;118(12):3555–3559. doi: 10.1007/s00436-019-06517-1. [DOI] [PubMed] [Google Scholar]
  • 48.Rodrigues B, Salgado PAB, Gonzalez IHL, Quadrini A, Holcman MM, Ramos PL, Chagas CRF. Comparative analyses of coproscopical techniques to diagnose enteroparasites in a group of captive Indian peafowl (Pavo cristatus) Ann Parasitol. 2020;66(3):397–406. doi: 10.17420/ap6603.279. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1. (5.4MB, jpg)
Additional file 2. (8.2MB, jpg)
Additional file 3. (5.2MB, jpg)
Additional file 4. (5.6MB, jpg)
Additional file 5. (5.5MB, jpg)
Additional file 6. (886.7KB, jpg)

Data Availability Statement

The data generated or analyzed during this study are included in this published article and its supplementary files. The raw data of DNA- sequencing are available from the NCBI database under accession number PRJNA819941. (SRX14610090 and SRX14609836) https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA819941.


Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES