Skip to main content
. 2022 Apr 11;11:e57642. doi: 10.7554/eLife.57642

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Antibody pMLC 2 (Ser19)(Rabbit monoclonal) Cell Signaling Cat. #3,671RRID:AB_330248 (1:100)
Antibody 6B6(recognizes C-cadherin)(mouse monoclonal) Developmental Studies Hybridoma Bank AB_528113RRID:AB_528113 (1:300)
Other phalloidin-Alexa 555 (Acti-stain, Cytoskelton.com) 8,953 Derivatized fluorescent dextran (1:100 at 4 C, 12–36 hours)
Sequence-based reagent MHC IIB morpholino Skoglund et al., 2008 Morpholino5’CTTCCTGCCCTGGTCTCTGTGACAT3’
Sequence-based reagent Xdd1 Sokol, 1996 RNA
Sequence-based reagent dnWnt11 Tada and Smith, 2000 RNA
Software, algorithm NIH Image 1.6 Wayne Rasband, National Institutes of Health; available at http://rsb.info.nih.gov/nih-image/ RRID:SCR_003073
Software, algorithm Object Image Norbert Vischer, University of Amsterdam; available at https://sils.fnwi.uva.nl/bcb/Object-Image/object-image.html RRID:SCR_015720
Software, algorithm Image J http://rsb.info.nih.gov/ij/ RRID:SCR_003070
Software, algorithm Metamorph https://www.moleculardevices.com/products/cellular-imaging-systems/acquisition-and-analysis-software/metamorph-microscopy#gref RRID:SCR_002368
Software, algorithm SquisherJoy (CellScale, Waterloo, Canada) Software for MicroSquisher; RRID:SCR_022034
Software, algorithm Axisymmetric Drop Shape Analysis del Río and Neumann, 1997 ADSA in MatlabRRID:SCR_001622 for Matlab
Software, algorithm curvature outline detection https://www.mathworks.com/products/matlab.html (Canny) in MATLABRRID:SCR_001622 for Matlab
Software, algorithm Surface tension determination in SquisherJoy Based on Brodland et al., 2009; Mgharbel et al., 2009