SHV-16, a β-Lactamase with a Pentapeptide Duplication in the Omega Loop

Abstract

A clinical isolate of Klebsiella pneumoniae was found to be resistant to ampicillin (MIC of 128 μg/ml), ticarcillin (MIC of 512 μg/ml), and ceftazidime (MIC of 128 μg/ml) and susceptible to all other β-lactams; a synergistic effect between clavulanate and ceftazidime suggested the presence of an extended-spectrum β-lactamase (ESBL). Transconjugants in Escherichia coli were obtained at low levels (10⁻⁷ per donor cell) and exhibited a similar β-lactam resistance pattern (resistant to ampicillin, ticarcillin, and ceftazidime at 64 μg/ml). The ESBL, pI 7.6, was encoded by a large plasmid (>100 kb) which did not carry any other resistance determinant. The ESBL-encoding gene was amplified by PCR using bla_SHV-specific primers and was sequenced. The deduced amino acid sequence of the SHV-16 ESBL showed that it differed from SHV-1 by only a pentapeptide insertion (163DRWET167) corresponding to a tandem duplication in the omega loop. The implication of the 163a-DRWET163b-DRWET sequence in ceftazidime resistance was confirmed by cloning either bla_SHV-1 or bla_SHV-16 in the same vector, subsequently introduced in the same E. coli strain. Under these isogenic conditions, SHV-16 conferred a 32-fold increase in ceftazidime MIC compared to that with SHV-1. Furthermore, site-directed mutagenesis experiments modifying either E166aA or E166bA revealed that the functional glutamic residue was that located in the first copy of the duplicated sequence. But surprisingly, the second E166b also conferred a low-level resistance to ceftazidime. This work is the first description of a class A enzyme exhibiting an extended substrate specificity due to an insertion instead of a nucleotide substitution(s) in a clinical isolate.

β-Lactamase production is the main mechanism of β-lactam resistance in gram-negative organisms (7). Among serine β-lactamases, the Ambler class A (2), and particularly the Bush group 2b (7), like the plasmid-mediated TEM-1, TEM-2, and SHV-1 enzymes, are the most commonly encountered in clinical isolates of Enterobacteriaceae (12, 31). The introduction of the extended-spectrum cephalosporins in the early 1980s was followed inexorably by the evolution of these so-called broad-spectrum β-lactamases towards mutants with an extended-spectrum substrate specificity (12). More than 50 members have been described in the TEM family, and more than 15 have been described in the SHV family (http://www.lahey.org/studies/webt.htm). All TEM and SHV variants in clinical isolates reported at present have been found to derive from the parental enzymes by point mutations leading to 1- to 5-amino-acid substitutions in the active-site vicinity (12, 15, http://www.lahey.org/studies/webt.htm).

All class A β-lactamases possess a conserved structural feature, the omega loop, which spans residues 161 to 179 (10) or 164 to 179 (33), and which form a portion of the active-site pocket of the enzyme (14). Recently, the X-ray crystallographic structure of the SHV-1 enzyme has been established (18). Although it showed that all important residues deviate very little from those of TEM-1, several solvation bridges would allow a more efficient stabilization of the omega loop (18). The omega loop serves as a structural scaffolding for the amino acid Glu-166 (4). Glutamic acid at position 166 is the only amino acid that is universally conserved among residues of the omega loop (20), and its function is to promote the water molecule for the second step (deacylation) of β-lactam hydrolysis (1, 21, 30). It has been hypothesized that the poor affinity of the group 2b penicillinases against extended-spectrum β-lactams such as ceftazidime and aztreonam is due to the steric hindrance exerted by the bulky 7-β side chains of these substrates relative to the omega loop in the active site (11, 15). This unfavorable steric interaction would indirectly affect the deacylation step of the catalytic process (11, 15). However, different mutational replacements can distort the highly flexible structure of the omega loop, and such restructured conformations may account for an enhanced activity of the corresponding mutant enzymes against extended-spectrum β-lactams (10, 25, 27, 33).

In this study we characterize a novel extended-spectrum β-lactamase (ESBL), designated SHV-16, produced by a clinical isolate of Klebstella pneumoniae. This enzyme conferred a low-level resistance to penicillins and a high-level resistance to ceftazidime. SHV-16 was demonstrated to derive from SHV-1 by the duplication of a 5-amino-acid sequence (163a-DREWET163b-DRWET), including Glu-166, in the omega loop. The role of this insertion in ceftazidime resistance was ascertained by comparing SHV-1 and SHV-16 under isogenic conditions. Furthermore, site-specific mutagenesis experiments were performed in order to fix the position of the functional residue E-166 either in a 163a-DRWET or in a 163b-DRWET position in this particular enzyme.

MATERIALS AND METHODS

Bacterial strains.

The SHV-16-producing strain K. pneumoniae Kp386 was isolated in 1996 from the urine of a 59-year-old patient hospitalized in a French hospital (Robert Boulin Hospital, Libourne, France). This man fell during an alcoholic fit and suffered from cranial trauma associated with multiple cerebral contusions. After 1 month in an intensive care unit he spent 2 weeks in neurosurgery, where he received ceftazidime (3 g/day) and vancomycin (2 g/day) for 8 days to treat an episode of pneumonia. Two months later this patient, who had been transferred into a physiotherapy unit for a regressive hemiplegia and a persistent aphasia, developed a urinary tract infection associated with an indwelling catheter and caused by K. pneumoniae strain Kp386. No antimicrobial chemotherapy was administered, and the patient was discharged after 4 weeks with a medical treatment and a planned follow-up of his alcoholism and neurologic sequellae.

Several strains of Escherichia coli were used in this study: P453 (Pit-2), as the source of the SHV-1 β-lactamase gene (5); a sodium azide-resistant (Az^r) mutant of C600 (a gift from D. Sirot), as the recipient in conjugation transfer; and XL1-Blue for cloning and site-directed mutagenesis experiments.

Antimicrobial susceptibility testing.

Antibiotic susceptibility patterns were determined by the disk diffusion method in Mueller Hinton agar using 22 disks (http://www.sfm.asso.fr). MICs of six β-lactams, alone or in combination with 2 μg of clavulanic acid per ml, were determined by a twofold dilution method in Mueller Hinton agar, using a final inoculum of 10⁴ to 10⁵ CFU per spot (http://www.sfm.asso.fr). Antibiotics tested in this study were kindly provided as standard powders by the following suppliers: ampicillin, Bristol-Myers Squibb Laboratories; ticarcillin, clavulanic acid, and aztreonam, Smith-Kline Beecham Pharmaceuticals; cephalothin, Eli-Lilly France SA; ceftazidime, Glaxo-Wellcome Laboratories; cefotaxime, Roussel Uclaf.

Isoelectric focusing.

Crude β-lactamase extracts were obtained by sonication and were analyzed by isoelectric focusing in polyacrylamide gels containing ampholines (Pharmacia LKB) with a pH range of 3.5 to 10.0 by using an LKB multiphor apparatus (Pharmacia LKB). β-Lactamase activities were detected by an iodine-starch procedure in agar gel, with either benzylpenicillin (75 μg/ml) or ceftazidime (125 μg/ml) as substrate. The isoelectric points (pIs) of the studied β-lactamases were determined by comparison with the pIs of reference β-lactamases (TEM-1 [pI 5.4], TEM-2 [pI 5.6], TEM-24 [pI 6.5], SHV-3 [pI 7.0], SHV-1 [pI 7.6], and SHV-4 [pI 7.8]).

Transfer experiments.

Conjugation between K. pneumoniae Kp386 and E. coli C600 Az^r was carried out by a broth mating procedure in brain heart infusion medium (8). Transconjugants were selected on Mueller-Hinton agar containing sodium azide (300 μg/ml) and ceftazidime (2 μg/ml).

Plasmid DNA analysis.

Plasmid DNA was extracted and purified using the protocol and reagents of a commercial kit (Qiagen Plasmid Midi kit) and then was analyzed by electrophoresis on 0.9% (wt/vol) agarose gel and visualized by ethidium bromide under UV light. The size of the plasmids was estimated, after enzymatic restriction, by comparison with the fragments of lambda phage DNA digested by PstI or HindIII.

PCR amplification of bla_SHV genes.

The ESBL-encoding genes from purified plasmids of Kp386 and Tc386 were first amplified by PCR using SHV-specific primers 0S0(F) [(F) for forward primer] and 0S5(R) [(R) for reverse primer], which were specifically designed from the SHV-1 sequence (22) (Table 1). Then bla_SHV-1 and bla_SHV-16 genes, used for cloning, were amplified by PCR with a pair of custom-made primers (Eurogentec), HIII-0S0(F) and EI-0S5(R) (Table 1), which harbored either a HindIII or an EcoRI restriction site at their 5′ ends, respectively. The amplification was performed with 5 ng of purified plasmid DNA mixed with 200 μM concentrations of each deoxynucleoside triphosphate, 0.5 μM concentrations of each primer, and 1.25 U of Taq polymerase (Fisher) in its adequate buffer. After a denaturation step at 94°C for 5 min, 35 subsequent cycles of amplification were performed, each one consisting of 1 min at 94°C, 1 min at 55°C, 1 min at 72°C, and a final step at 72°C for 10 min. PCR products were analyzed by electrophoresis on a 1.5% (wt/vol) agarose gel, and the amplicon size was evaluated by comparison with the fragments of the lambda phage DNA digested by PstI. The PCR products were purified using the microcolumns of the Microspin Sephacryl S-400 purification system (Pharmacia LKB).

TABLE 1.

Oligonucleotides used in this study

Primera	Sequence (5′→3′)	Nucleotide numberingb
Amplification and sequencing
0S0(F)	CTCGCCTTTATCGGCCCTCAC	78
0S5(F)	CGGCCACGCGGGTTAGCG	1007
HIII-0S0(F)c	CACACAAAGCTTGATGAAAAATGATGAAGGAAAAAAGAG	1
EI-0S5(R)c	CACACAGAATTCGGTGGCCACGTTTATGGCGTTACCTTTGA	1137
Sequencing
0S1(F)	GGACTACTCGCCGGTCAGC	414
0S2(R)	GCTGACCGGCGAGTAGTCC	432
0S3(F)	GATTGTCGCCCTGCTTTGG	852
0S4(R)	CCAAGCAGGGCGACAATC	869
Mutagenesis experimentsd
A-166a(F)	GCCTTGACCGCTGGGCAACTGACCGCTGGG	587
A-166a(R)	CCCAGCGGTCAGTTGCCCAGCGGTCAAGGC	616
A-166b(F)	GAAACTGACCGCTGGGCAACGGAACTGAATG	601
A-166b(R)	CATTCAGTTCCGTTGCCCAGCGGTCAGTTTC	631

^a(F) for forward primers and (R) for reverse primers. 

^bThe positions of the primers are given as the first 5′ base according to the numbering in Fig. 1. 

^cThe numbering of primers HIII-0S0(F) and EI-0S5(R) begins at the base indicated by a double underline. The HindIII and EcoRI restriction sites are underlined. 

^dMutagenic primers in which the codon Glu (GAA) was replaced by that for Ala (underlined GCA in forward and underlined TGC in reverse orientation). Bold characters denote the mismatched bases. 

Sequencing analysis.

All bla_SHV genes reported here were sequenced on both strands, with sets of custom-made bla_SHV-specific primers (Table 1) and M13 universal oligonucleotides (for the cloned genes), an automated fluorescent method using the dye terminator chemistry (AmpliTaq DNA polymerase FS Dye Terminator Cycle Sequencing Ready Reaction kit; Perkin-Elmer), and the ABI-Prism 377 sequencer (Applied Biosystems Division, Perkin-Elmer).

Cloning of PCR products of E. coli.

PCR products obtained from E. coli P453 and Tc386 using the HIII-0S0(F) and EI-0S5(R) oligonucleotides were digested by HindIII and EcoRI restriction enzymes and inserted into the cloning multisite of the phagemid pBK-CMV (Stratagene), a vector which contains the β-galactosidase lacZ gene and a kanamycin resistance gene, linearized beforehand with the same endonucleases. After electrotransformation of E. coli XL1-Blue strain, recombinant clones (white colonies obtained in presence of 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside [80 μg/ml] and isopropyl-β-d-thiogalactopyranoside [0.5 mM]) growing on Luria-Bertani (LB) agar medium supplemented with kanamycin (50 μg/ml) were selected.

Site-directed mutagenesis experiments.

Site-directed mutagenesis of the two glutamates, E-166a and E-166b, at positions 163a-DRWET and 163b-DRWET in the SHV-16 β-lactamase, was performed using the QuickChange site-directed mutagenesis kit, manufactured by Stratagene. Two pairs of complementary mutagenic oligonucleotide primers were designed: A-166a(F)/A-166a(R) and A-166b(F)/A-166b(R) (Table 1). Mutagenesis was carried out with the Pfu Turbo DNA polymerase provided with the kit. The plasmid pBSHV-16 was used as DNA template for the mutagenic PCR, and the cycling parameters were 95°C for 30 s, 55°C for 1 min, and 68°C for 10 min for a total of 16 cycles. After amplification, DpnI restriction enzyme was added to the digested methylated (parental) DNA. XL1-Blue supercompetent cells (Epicurian coli; Stratagene) were transformed with mutagenic DNA by heat pulse for 45 s at 42°C. After 1 h of incubation at 37°C, transformed cells were plated on LB agar medium containing 50 μg of kanamycin per ml.

SHV-16 nucleotide sequence accession number.

The SHV-16 nucleotide sequence is assigned accession number AF072684 in the Genbank nucleotide sequence database.

RESULTS

Antibiotic susceptibility patterns of Kp386 and Tc386.

By the disk diffusion method, K. pneumoniae strain Kp386 was resistant to ampicillin, ticarcillin, and ceftazidime but was susceptible to all other β-lactams tested according to French national guidelines (http://www.sfm.asso.fr); a slight synergistic effect was visible between the disks of amoxicillin-clavulanate and ceftazidime, suggesting the presence of an ESBL. Kp386 was also trimethoprim resistant. MICs confirmed the β-lactam antibiotic susceptibility pattern (Table 2): Kp386 was moderately resistant to ampicillin (MIC of 128 μg/ml) and ticarcillin (MIC of 512 μg/ml) and was highly resistant to ceftazidime (MIC of 128 μg/ml); the activity of the latter β-lactams was restored by the addition of clavulanic acid. Other β-lactams were active at clinically achievable levels (http://www.sfm.asso.fr). The transconjugant Tc386 exhibited the same antibiotype, except for trimethoprim susceptibility. Compared with the recipient strain E. coli C600, Tc386 was 8 times more resistant to ampicillin, 16 times more resistant to ticarcillin, 10 times more resistant to cefotaxime and aztreonam, and 320 times more resistant to ceftazidime and had an identical susceptibility level to cephalothin.

TABLE 2.

β-Lactam susceptibilities of the different strains used in this study^a

Strain	MIC (μg/ml)
	AMP	AMP + CA	TIC	TIC + CA	CEF	CTX	CTX + CA	ATM	ATM + CA	CAZ	CAZ + CA
K. pneumoniae Kp386	128	8	512	16	4	0.5	0.02	0.5	0.02	128	0.5
E. coli C600 Tc386	64	8	64	16	4	0.5	0.05	0.5	0.05	64	0.2
E. coli XL1-Blue + pBSHV-1	>512	8	>512	32	64	0.05	0.05	0.1	0.05	0.5	0.1
E. coli XL1-Blue + pBSHV-16	32	4	32	4	16	0.1	0.05	0.1	0.05	16	0.2
E. coli XL1-Blue + pBSHV-16/A-166a	4	4	4	4	8	0.2	0.05	0.2	0.1	4	0.2
E. coli XL1-Blue + pBSHV16/A-166b	16	4	32	4	8	0.1	0.05	0.2	0.1	16	0.2
E. coli C600 Azr	4	8	2	2	4	0.05	0.05	0.05	0.1	0.2	0.2
E. coli XL1-Blue	4	4	2	2	16	0.05	0.05	0.1	0.1	0.5	0.1

^aAMP, ampicillin; CA, clavulanic acid at 2 μg/ml; TIC, ticarcillin; CEF, cephalothin; CTX, cefotaxime; ATM, aztreonam; CAZ, ceftazidime. pBSHV-1 and pBSHV-16, recombinant plasmids from pBK-CMV containing the bla_SHV-1 or bla_SHV-16 gene, respectively. pBSHV-16/A-166a and pBSHV-16/A-166b, recombinant plasmids from pBSHV-16 containing an alanine codon in position 166-a or 166-b, respectively. 

β-Lactamase content of Kp386 and Tc386.

Analytical isoelectric focusing of crude β-lactamase extracts of K. pneumoniae Kp386 and its transconjugant, Tc386, gave a single band, which comigrated with the reference enzyme SHV-1 at pI 7.6 (data not shown). This band gave a weak but positive reaction with ceftazidime.

Conjugation transfer and plasmid content of Kp386 and Tc386.

Upon mating K. pneumoniae Kp386 with E. coli C600 Az^r, ceftazidime-resistant transconjugants were obtained at a low frequency (10⁻⁷ per donor). Analysis by agarose gel electrophoresis of plasmid DNA from Kp386 showed five bands. In contrast, plasmid DNA of the transconjugant Tc386 gave a single band of the same size as one of the bands with the highest molecular weight in strain Kp386. The size of the ESBL-encoding plasmid was estimated after digestion by the EcoRI endonuclease to be more than 100 kb (data not shown).

PCR amplification and sequencing analysis of the bla_SHV-16 gene.

According to the basic pI of the ESBL, PCR amplifications using purified plasmid DNA extracted from Kp386 and Tc386 were performed with commonly used SHV-specific primers [0S0(F) and 0S5(R)], and amplicons of the expected size (∼930 bp) were obtained. Then two other oligonucleotides [HIII-0S0(F) and EI-0S5(R)] were designed from the SHV-1 sequence (22) to flank the entire bla_SHV gene (876 bp) and additional sequences of 117 bp upstream and 139 bp downstream of the coding region. After size verification of the amplicons by agar gel electrophoresis, they were directly sequenced on both strands and the nucleotide analysis showed an identical sequence for the two PCR products obtained from the plasmids purified either from Kp386 or from Tc386. The sequence of the coding region was identical to that of bla_SHV-1, except for an insertion of 15 bp between positions 590 and 620, as indicated in Fig. 1. Indeed, this insertion corresponded to a tandem duplication in direct orientation. Consequently, the deduced amino acid sequence of the enzyme had a pentapeptide insertion (or duplication) of 5 amino acids: Asp-Arg-Trp-Glu-Thr (or DRWET), located at positions 163 to 167 and designated 163a-DRWET163b-DRWET. Such an insertion mutation had not been previously described, and this new β-lactamase was named SHV-16 (http://www.lahey.org/studies/webt.htm). Nucleotide analysis of the 117 bp upstream of the coding region showed a conserved sequence compared to the corresponding region upstream of the bla_SHV-1 structural gene (22). In particular, the transcription promoter regions −10 (TATTCT) and −35 (TTGTGA) located 57 and 81 bp, respectively, upstream of the initiation codon ATG and the ribosome binding sequence were identical to those of bla_SHV-1.

FIG. 1.

Nucleotide and peptide sequences of the SHV-16 β-lactamase. The −35 and −10 promoter regions and the ribosome binding sequence (RBS) are underlined. The position of the primers used for the amplification and the location of the a and b duplicated sequences (DRWET) are indicated by an arrow.

Analysis of isogenic strains of E. coli producing either SHV-1 or SHV-16 β-lactamases.

To confirm that the duplication mutation in the omega loop was the sole reason for the extended spectrum associated with the SHV-16 β-lactamase, two isogenic strains of E. coli XL1-Blue were constructed. The bla_SHV-1 gene from the R453 reference strain and the bla_SHV-16 gene described above were amplified by PCR using the oligonucleotides HIII-0S0(F) and EI-0S5(R). The amplicons were inserted into the HindIII and EcoRI sites of the pBK-CMV vector, leading to the construction of the recombinant plasmids pBSHV-1 and pBSHV-16, respectively. Each gene was inserted into the pBK-CMV vector in an orientation opposite to that of the β-galactosidase lacZ gene so that the expression of the bla_SHV-1 and bla_SHV-16 genes was controlled by their own transcriptional promoter sequences. Nucleotide sequence analysis of the coding region confirmed that the unique difference between the two genes was the 15-bp duplication in the omega loop.

Comparison of MICs for E. coli XL1-Blue carrying either pBSHV-1 or pBSHV-16 (Table 2) showed that, under these isogenic conditions, SHV-16 conferred a lower resistance than SHV-1 to ampicillin and ticarcillin (at least 32-fold) and cephalothin (8-fold) but conveyed a significant increase in the ceftazidime MIC (32-fold increase); the MICs of other β-lactams were either unchanged (aztreonam) or changed no more than 2-fold (cefotaxime).

Identification by site-directed mutagenesis of functional Glu-166 in SHV-16.

To determine the position of the functional Glu-166 (E-166a or E-166b) in the SHV-16 β-lactamase, each glutamate at position 166 was independently replaced by an alanine by site-directed mutagenesis experiments. An enzyme with such a mutational substitution is assumed not to be capable to ensure its role in deacylation (1, 16, 21). The substitution A→C in the first Glu codon (GAA) by the Ala codon (GCA) generated the recombinant plasmid pBSHV-16/A-166a, and the same replacement of the second Glu yielded the recombinant plasmid pBSHV-16/A-166b.

MICs for the strains of E. coli XL1-Blue carrying the recombinant plasmids pBSHV-16/A-166a or pBSHV-16/A-166b (Table 2) showed that the mutant with E-166a and A-166b exhibited β-lactam MICs similar to those given by E. coli XL1-Blue carrying the native plasmid pBSHV-16. Surprisingly, E. coli XL1-Blue carrying the recombinant plasmid pBSHV-16/A-166a gave the same β-lactam MICs as the host strain carrying no plasmid, except for that of ceftazidime (MIC of 4 μg/ml compared with 0.5 μg/ml for E. coli XL1-Blue).

DISCUSSION

This work reports, for the first time, a class A (and group 2be) ESBL derived from the parental enzyme by an insertion instead of a nucleotide substitution(s) in a clinical strain. This finding illustrates a new possibility for mutational changes to convert broad-spectrum β-lactamases into ESBLs in response to the selective pressure of antibiotic therapy. Indeed, K. pneumoniae Kp386 was isolated from a patient who had previously received a treatment by ceftazidime, and this clinical isolate probably escaped antimicrobial therapy by producing a mutant β-lactamase selectively active against this particular cephalosporin.

By the disk diffusion method, strain Kp386 exhibited an uncommon phenotype, suggesting the presence of an ESBL with a spectrum only extended to ceftazidime. MIC determination confirmed this β-lactam resistance profile. Ceftazidime resistance could be transferred by conjugation to E. coli at an unusually low frequency (10⁻⁷), and no other antibiotic resistance was cotransferred, even to aminoglycosides (as commonly observed with ESBLs of the TEM or SHV families) or to trimethoprim (to which Kp386 was resistant). Comparison of MICs for the transconjugant Tc386 and the recipient strain E. coli C600 showed that the ESBL conferred a low-level resistance to ampicillin and ticarcillin but a high level of ceftazidime resistance. Both Kp386 and its transconjugant, Tc386, gave, by isoelectrofocusing analysis, a single band with β-lactamase activity at pI 7.6. In K. pneumoniae Kp386, this band certainly resulted from the superimposition of two β-lactamases, the species-specific constitutive penicillinase (3) and the additional ESBL that was transferred to E. coli; this band gave a weak but positive reaction with ceftazidime. The higher penicillin resistance of Kp386 compared to that of Tc386 might be ascribed, at least in part, to the synthesis of the chromosomal enzyme.

While Kp386 harbored five plasmid bands, Tc386 harbored a single band, with a large molecular size (>100 kb), similar to that of most other conjugative ESBL-encoding plasmids (150 to 185 kb) (13). The basic pI of the ESBL produced by Kp386 suggested that it might belong to the SHV-family. Actually, PCR amplification using SHV-specific primers gave an amplicon of the expected size. Sequencing of the PCR product revealed that the ESBL-encoding genes found in Kp386 and Tc386 were identical and differed from bla_SHV-1 by a single remarkable feature: a 15-bp insertion sequence corresponding to a tandem duplication in direct orientation. Consequently, the amino acid sequence should exhibit an insertion of 5 amino acids: DRWET, in position 163 or 167, in the omega loop of the SHV-1 β-lactamase. According to the Ambler numbering, we designated this duplication 163a-DRWET163b-DRWET. The insertion of an additional DRWET sequence (one net negative charge, but a total pK_a of 6.92, close to neutrality) led to a mutant enzyme with the same pI as that of SHV-1. This new ESBL was called SHV-16 (http://www.lahey.org/studies/webt.htm).

This SHV-16 enzyme appeared unstable, and no enzymatic kinetics could be performed (data not shown). A high-level production of SHV-1, alone (26) or in combination with decreased permeability (29), may lead to ceftazidime resistance. To ensure that ceftazidime resistance associated with SHV-16 was due to the pentapeptide insertion mutation and not to another reason, two isogenic strains of E. coli XL1-Blue carrying either the bla_SHV-1 or the bla_SHV-16 gene cloned in the same vector (pBSHV-1 or pBSHV16) were constructed. Under these conditions, the SHV-16 enzyme still led to a dramatic loss of activity against penicillins and a considerable gain of activity against ceftazidime compared with those of SHV-1. The differences in MICs of extended-spectrum cephalosporins and aztreonam between the transconjugant Tc386 (in E. coli C600) and the E. coli XL1-Blue strain carrying pBSHV-16 might be explained by differences in strains, plasmids, and/or gene environment such as, in particular, the absence in the 117-bp amplified sequence upstream of the gene cloned in the XL1-Blue strain of another transcriptional promoter described previously (28, 29). These data unambiguously demonstrated that the decreased penicillin resistance and the significant ceftazidime resistance associated with SHV-16 were caused by the duplication of the 5 amino acids DRWET in the omega loop of SHV-1. Single amino acid mutations in this region (for example, the replacement of Asp-179 by Gly in the SHV-24 enzyme) have been previously shown to confer a high increase in ceftazidime resistance (17). All pentapeptide insertions obtained by in vitro mutagenesis experiments in TEM-1 that are associated with an enhanced ceftazidime resistance have been mapped in the omega loop region (10). Our results suggest that pentapeptide insertions also allow an increase of the conformational flexibility of the catalytic region of SHV-1, despite an expected higher stability (18), thereby facilitating the access of the bulky C-7 side chains of extended-spectrum cephalosporins, such as ceftazidime. Recently, the X-ray crystallographic structure of the expanded-spectrum class A PER-1 enzyme has also revealed a new, wider folding for the omega loop that may easily accommodate such substrates (32). Finally, a tripeptide duplication (Ala-Val-Arg) in similar positioning insertion of a class C β-lactamase from a clinical strain of Enterobacter cloacae has been reported to extend the substrate specificity to oxyiminocephalosporins and aztreonam (23, 24).

The class A omega loop is thought to provide a structural scaffolding for the invariant residue Glu-166, which plays a critical role in the catalytic process (14, 20, 21). However, the omega loop of the SHV-16 enzyme contains a glutamic acid in positions 166-a and 166-b. Site-directed mutagenesis experiments aiming to suppress the activity of each glutamic acid in either position were undertaken to identify which of them was the functional residue. E. coli XL1-Blue carrying the recombinant plasmid pBSHV-16/A-166b exhibited β-lactam MICs similar to those of the same strain carrying pBSHV-16, demonstrating that the functional glutamic residue was that located in the first copy of the duplicated sequence (E-166a). However, the second glutamic residue (E-166b) seemed to retain some hydrolytic activity against ceftazidime (eightfold increase). Accordingly, our data tend to show that the N-terminal part of the omega loop plays an essential role in conferring ampicillin resistance. Similarly, in the pentapeptide mutagenesis scanning of the TEM-1 omega loop, insertions at position 163 or 171 increased by 17 times the level of ceftazidime resistance, while only those at position 163 or 164 (N-terminal part) drastically reduced ampicillin hydrolysis (10). In SHV-16, the second pentapeptide might be flexible enough to bring a glutamic residue near the position normally occupied by the native Glu-166. In the same way, the X-ray structure of the class C mutant with a tripeptide duplication has shown that the second insertion was very flexible (9). Provided that instability of our mutant enzymes does not prevent purification and analysis, it would be interesting to determine their X-ray crystallographic structures to investigate the conformational changes conferred by the insertion in the omega loop of SHV-16.

Spontaneous mutations generally consist of single nucleotide substitutions, as exemplified by the evolution of the β-lactamases in the TEM and SHV families. However, transposable elements, as insertion sequences, are also natural mutagenic agents, whose insertion leads to a duplication (generally of 2 to 14 bp, according to the insertion sequence) in direct orientation of the DNA target sequence that persists after excision (19). Such a molecular event might have generated bla_SHV-16. Indeed, this is the explanation proposed for a variety of amino acid insertions observed when related proteins are aligned (6). Thus, this report is the first example of such a natural evolution in class A bacterial enzymes, thereby demonstrating the extended capacity of bacteria to resist extended-spectrum β-lactams.