Abstract
Mitochondrial reactive oxygen species (mROS) that are overproduced by mitochondrial dysfunction are linked to pathological conditions including sensory abnormalities. Here, we explored whether mROS overproduction induces itch through transient receptor potential canonical 3 (TRPC3), which is sensitive to ROS. Intradermal injection of antimycin A (AA), a selective inhibitor of mitochondrial electron transport chain complex III for mROS overproduction, produced robust scratching behavior in naïve mice, which was suppressed by MitoTEMPO, a mitochondria-selective ROS scavenger, and Pyr10, a TRPC3-specific blocker, but not by blockers of TRPA1 or TRPV1. AA activated subsets of trigeminal ganglion neurons and also induced inward currents, which were blocked by MitoTEMPO and Pyr10. Besides, dry skin-induced chronic scratching was relieved by MitoTEMPO and Pyr10, and also by resveratrol, an antioxidant. Taken together, our results suggest that mROS elicit itch through TRPC3, which may underlie chronic itch, representing a potential therapeutic target for chronic itch.
Supplementary Information
The online version contains supplementary material available at 10.1007/s12264-022-00837-6.
Keywords: Mitochondria, Reactive oxygen species, TRPC3, Itch, Dry skin, Trigeminal ganglia
Introduction
Mitochondria are the powerhouses of most eukaryotic organisms; they convert oxygen and nutrients into adenosine triphosphate (ATP) energy and function in cellular metabolic homeostasis, immunity, differentiation, apoptosis, and aging. Mitochondria are the major sources of the production of reactive oxygen species (ROS), which are reactive oxygen molecules such as superoxide anion, hydrogen peroxide, and hydroxyl radical derived from molecular oxygen, and can also serve as cell signaling or toxic molecules for both normal and abnormal biological processes, respectively. Mitochondrial ROS (mROS) are ROS that are produced by mitochondria in physiological systems, including adaptation to hypoxia and the regulation of autophagy, immunity, differentiation, and longevity [1]. Most of the mROS generated by the one-electron reduction of oxygen during the process of oxidative phosphorylation are removed by multiple antioxidant enzymes including superoxide dismutase, catalase, glutathione peroxidase, and glutathione reductase, through the mROS scavenging system to balance their production and elimination [2].
Under pathological conditions, mitochondrial dysfunction or damage is often characterized by the overproduction of mROS, either as a result of genetic defects [3] or through cell damage correlated with many diseases such as cancer and neurodegenerative diseases [4, 5]. Mitochondrial dysfunction can result from the mitochondrial electron transport chain (mETC) due to an imbalance between cellular oxidant and antioxidant systems [6]. It has recently been reported that mitochondrial dysfunction is linked to sensory abnormalities such as nociceptor hyperexcitability [7–9] and that malfunctioning mitochondria is one of important causes of painful peripheral neuropathies caused by genetic defects, diabetes, or chemotherapy for cancer and human immunodeficiency virus (HIV) [10]. It has also been reported that intrathecal injection of the mETC complex III inhibitor antimycin A (AA) induces mechanical hyperalgesia in normal mice in a dose-dependent manner, suggesting a critical role of mROS in pain processing [11]. Besides, inhibition of mETC complex III by AA also activates nociceptive vagal sensory nerves. The nociceptive neuronal activation is reduced by pharmacological inhibition or a genetic deletion of either TRPA1 or TRPV1 [7]. On the other hand, intradermal injection of antimycin attenuates vincristine- or streptozotocin-induced mechanical pain in a dose-dependent manner [12]. However, it has not been explored yet whether mitochondrial dysfunction and the resulting mROS overproduction contribute to itch sensation.
It is well-known that not only pain-sensitive neurons but also itch-initiating neurons are predominantly small-diameter, unmyelinated C-fiber neurons in sensory ganglia [13]. Although pain and itch are distinct sensory modalities, they also share largely overlapping mediators and receptors in primary sensory neurons [14–16]. Itch is often classified into histamine-dependent and histamine-independent itch, and TRPV1 and TRPA1 mediate histamine-dependent and histamine-independent itch, respectively [17]. While ROS has been demonstrated to directly activate both TRPA1 and TRPV1 to produce itch [18], TRPC3 is another ROS-sensitive channel [19–21] almost exclusively expressed in non-peptidergic isolectin B4 (IB4)-positive small-diameter DRG neurons [22–24]. Given these previous findings, it is likely that TRPC3 may mediate itch in addition to TRPA1 and TRPV1 [25].
In this study, we thus aimed to identify a functional link between mROS-induced itch and TRPC3 in mice. We investigated whether AA would excite small trigeminal ganglion (TG) neurons and elicit itch through TRPC3. We further examined whether mROS level in the affected skin was altered in a dry skin-induced chronic itch model, and also determined the contribution of mROS and TRPC3 to dry skin-induced chronic itch.
Materials and Methods
Animals
The C57BL/6 wild-type and TRPV1-knockout (KO) mice (5–8 weeks old) were purchased from the Jackson Laboratory. TRPA1-KO mice were obtained from Dr. Justin C. Lee at the Institute for Basic Science (Daejeon, Republic of Korea). Animals were housed in groups of three to five, with free access to water and food under a 12-h light/dark cycle. The protocol of the present study was approved by the Institutional Animal Care and Use Committee at the School of Dentistry, Seoul National University (SNU-151019-1). All efforts were made to minimize animal suffering and to reduce the number of animals used, in accordance with the Guide for the International Association for the Study of Pain.
Chronic Itch Model
For the cheek model of dry skin-induced chronic itch, the shaved right cheek was treated twice daily (09:00 and 17:00) on five consecutive days with a 1:1 mixture of acetone and ether (15 s) immediately followed by distilled water (30 s), AEW treatment, as described previously [26]. Solutions were gently applied onto the skin with a cotton swab under brief isoflurane (1.5%) anesthesia. Mice were immediately returned to their cage for recovery after each treatment.
Drug Preparation and Administration
All drugs were from Sigma-Aldrich (St. Louis, MO, USA). For experiments with AA, 25 mmol/L stock solution was prepared in ethanol and diluted with phosphate-buffered saline (PBS) to final working concentrations. MitoTEMPO was dissolved in PBS to a final concentration of 100 µmol/L, which has been shown to abolish mROS production in various cells including neurons [27]. Pyr10, HC-030031, and AMG-9810 were first dissolved in DMSO to 10- or 100-mmol/L stock solution, and then diluted to final concentrations with PBS. The concentrations of drugs were chosen by previous functional assays of drug efficacy: Pyr10 blocks carbachol-induced Ca2+ entry into TRPC3-transfected HEK293 cells with an IC50 value of 0.72 μmol/L [28]; HC-030031 antagonizes formalin-evoked Ca2+ influx with an IC50 of 5.3 μmol/L in TRPA1-expressing HEK293 cells [29]; and AMG-9810 blocks capsaicin-induced rat TRPV1 activation with an IC50 of 85.6 nmol/L [30]. Resveratrol at 40 mg/mL was dissolved in DMSO, and then diluted to final concentrations with PBS. Resveratrol improves in vivo mitochondrial function and biogenesis in mouse skeletal muscle at a dose of 25–30 mg/kg body weight per day [31]. Corresponding vehicles were prepared in an identical manner without addition of the drug. All stock solutions were kept at − 20 °C and diluted to final concentrations immediately before behavioral testing.
Mice were gently restrained by hand without anesthesia for a drug administration. All drugs, except resveratrol, were intradermally (i.d.) injected with a 31G insulin needle into the shaved right cheek. The injection volume was 20 µL. Intraperitoneal (i.p.) injections of resveratrol 100 μL were performed 20 min before each AEW treatment (twice a day for 5 days).
Behavioral Tests
For behavioral tests (cheek assay), all tested mice were shaved and then acclimated for 2 days (2 h/day) prior to the testing day. On the day of experiment, naïve mice were subjected to drug injection immediately after a 1-h adaptation period. For experiments with the chronic dry skin model, mice were acclimated 1 h before the 2nd AEW treatment on day 5, and then subjected to drug injection 10 min after AEW treatment (Fig. 5A). All mice were returned to the observation chambers and video recorded for 30 min immediately after drug injection. Itch or pain behaviors were evaluated as described previously [32]. Briefly, itch behavior was quantified by counting scratching bouts. A scratching bout was defined as lifting a hindlimb from the ground and scratching the skin behind the ears and on the back, and then placing the paw back on the ground or grooming it, as described previously [33]. Evident pain behavior was quantified by counting the number of unilateral wipes of injected site with the forelimb. All behavioral experiments were scored by experimenters blinded to the drug treatments.
Fig. 5.
Mitochondrial dysfunction, overproduction of mROS and TRPC3 contribute to dry skin-induced chronic itch. A Experimental designs used for behavioral experiments shown in (B). B Dry skin-induced scratching is elicited by repeated AEW treatments, and this was attenuated by i.d. injection of MitoTEMPO (100 µmol/L), a mitochondria-selective ROS scavenger, or Pyr10 (10 and 25 µmol/L), a selective TRPC3 blocker, compared to the vehicle-treated group (0.25% DMSO, n = 7–12 per group). Repeated i.p. injection of resveratrol, a mitochondrial biogenesis enhancer, suppresses dry skin-induced scratching compared to vehicle-treated control (5% DMSO, n = 7–12 per group). C–F Elevated mROS and increased thickness in epidermis of dry skin. C Cell nuclei, nerve fibers, and mROS in control and AEW-treated cheek skin stained by DAPI (blue), β-tubulin III (green), and MitoSox (red), a mitochondria-targeted ROS indicator (overlays in far-left panels; white dotted lines, the epidermal-dermal junction; scale bar, 40 µm; DIC). D, E The average intensity of MitoSox-Red in (D) epidermis, but not (E) dermis, is elevated in the dry skin itch model compared to control tissue (n = 4–5 per group. F Epidermal thickness of AEW-treated skin is increased compared to control tissue (n = 4–5 per group). Data are represented as the mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001.
Primary Culture of Trigeminal Ganglion (TG) Neurons
TG neurons were aseptically removed from 5 to 8-week-old mice and digested with collagenase (0.2 mg/mL)/dispase II (3 mg/mL) for 120 min. Dissociated cells were placed on glass coverslips coated with poly-D-lysine and grown in Neurobasal medium (with 10% fetal bovine serum and 2% B27 supplement) at 37 °C with 5% CO2 for 24 h before experiments. This primary culture excluded the possibility for indirect crosstalk between TG neurons and other cell types.
Whole-Cell Patch Clamp Recordings
Whole-cell voltage- and current-clamp recordings were performed in small (< 25 μm in diameter) TG neurons at room temperature using an EPC10 amplifier with PatchMaster software (HEKA Elektronik, Lambrecht/Pfalz, Germany) or a Multiclamp 700B amplifier with Clampex 11.2 software (Axon Instruments, Union City, CA, USA). The patch pipettes were pulled from borosilicate capillaries (World Precision Instruments, Sarasota, FL, USA). When filled with pipette solution, the resistance of the pipettes was 4–5 MΩ. The recording chamber (300 µL) was continuously superfused (3–4 mL/min). Series resistance was compensated for (> 80%), and leak subtraction was performed. Data were low-pass-filtered at 2 kHz and sampled at 10 kHz. The pipette solution contained (in mmol/L): 136 K-gluconate, 10 NaCl, 1 MgCl2, 5 EGTA, 10 HEPES, 2 Mg-ATP, adjusted to pH 7.3 with KOH. The external solution was composed of (in mmol/L): 140 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, 10 glucose, adjusted to pH 7.3 with NaOH. In voltage-clamp experiments, currents were recorded at a holding potential of − 60 mV.
Skin Biopsy Procedure
Immediately after sacrifice with isoflurane and cervical dislocation, naive cheek skin was taken using a biopsy punch (2 mm in diameter) and rinsed in PBS for 10 min. After removing residual PBS, the biopsied skin was incubated in MitoSox-Red (50 µmol/L) (Sigma-Aldrich, St. Louis, MO, USA) for 30 min. The tissue was rinsed again with PBS and fixed in 4% paraformaldehyde in PBS overnight at 4 °C. For AEW-treated skin collection, the same procedure was performed 10 min after the last AEW treatment on day 5. To prepare AA-treated skin, biopsy skin was incubated in AA (50 μmol/L) for 30 min with following PBS rinse for 10 min. MitoSox-Red (50 μmol/L) was then applied to the skin for 30 min with following PBS rinse for 10 min. The skin sample was fixed in 4% paraformaldehyde in PBS overnight at 4 °C.
Immunostaining
Fixed skin samples were rinsed with PBS and placed in 30% sucrose in 1× PBS for at least 3 days. Then, the samples were frozen and cut at 20 µm in the vertical plane on a vibrating microtome (VT1000 Plus, Leica, IL, USA). The sections were washed 5 times for 10 min each in PBS and immunostained on slides overnight at 4 °C with an antibody against β-tubulin III (rabbit anti-TuJ1, 1:500, Sigma-Aldrich, St. Louis, MO, USA), a neuron-specific marker. Following 5 rinses with PBS for 30 min each, the sections were incubated in donkey anti-rabbit FITC-conjugated secondary antibody for 90 min (1:200, Jackson ImmunoResearch, West Grove, PA, USA). The sections were then rinsed again 3 times in PBS for 30 min each and mounted with Vectashield with DAPI (Vector labs, Burlingame, CA, USA).
Image Analysis
Data were acquired on a laser scanning confocal microscope (LSM 700, Carl Zeiss GmbH, Jena, Germany). The targeted skin area including epidermis and dermis was captured with 40× objective. Single-plane and multi-focal z-stack images were acquired for differential interference contrast (DIC) and fluorescence images, respectively. The fluorescence intensity of MitoSox-Red was measured in epidermis and dermis separately using Zen software (Carl Zeiss GmbH, Jena, Germany). Skin sections that included hair shafts and follicles were excluded due to the high fluorescence activity and uneven distribution. The outermost layer of the epidermis consisting of dead cells and DAPI-stained areas that did not have mitochondria were also excluded from data analysis. Average fluorescence intensity from each section was calculated as follows:
Two to four sections were obtained from each mouse for data analysis. The epidermal thickness was measured from DIC images taken at 2–3 random fields per section using Zen software. All sections were stained and imaged together with the same settings.
Single-Cell Reverse Transcription Polymerase Chain Reaction (scRT-PCR)
ScRT-PCR was performed as previously described [34]. Briefly, the targeted cell was collected using a patch pipette with tip diameter of about 20 μm and put into PCR tube containing reverse transcription reagents. The reagents were incubated for 10 min at 25 °C, 90 min at 50 °C, then 5 min at 85 °C for cDNA synthesis. The cDNA products were stored at − 20 °C until further processing. All PCR amplifications were performed with nested primers (Bioneer, South Korea, information listed in Table 1). The first round of PCR was performed in 50 µL of PCR buffer containing 0.2 mmol/L dNTPs (Invitrogen, Carlsbad, CA, USA), 0.2 µmol/L ‘‘outer’’ primers, 1–3 µL RT product, and 0.2 µL platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA). For the second round of amplification, the reaction buffer (50 µL) contained 0.2 mmol/L dNTPs, 0.2 µmol/L ‘‘inner’’ primers, 2 µL products from the first round, and 0.2 µL platinum Taq DNA polymerase. The PCR products were then displayed on Safe-Pinky-stained 1.5% agarose gel. The gels were photographed using a UV digital camera.
Table 1.
Primer sequences for single-cell RT-PCR.
| Target gene | Outer primer sequences (5′–3′) | Inner primer sequences (5′–3′) | Product length (bp) | GeneBank accession no. |
|---|---|---|---|---|
| Trpc3 |
(For) TCAGCCAACACGATATCAGC (Rev) GGTCAACTGCTGGAACCATT |
(For) GAACCCCAGTGTGCTGAGAT | Outer; 420 | NM_019510 |
| (Rev) GGTCAACTGCTGGAACCATT | Inner; 210 | |||
| Calca | (For) TGGTGCAGGACTATATGCAG | (For) GCCCCAGAATGAAGGTTACA | Outer; 547 | NM_001289444 |
| (Rev) TATCCCCTTGAGGTTTAGCA | (Rev) CAACACGATGCACAATAGGC | Inner; 187 | ||
| Trpa1 | (For) AGCCACCCGGACTTTTAGTT | (For) AAACCAGGGTTGTTGGAATG | Outer; 471 | NM_177781 |
| (Rev) GTCATGTGTGATGGGACGAG | (Rev) ATGTGTGATGGGACGAGGAG | Inner; 219 | ||
| Trpv1 | (For) CATGCTCATTGCTCTCATGG | (For) CATGGGCGAGACTGTCAAC | Outer; 352 | NM_001001445 |
| (Rev) AACCAGGGCAAAGTTCTTCC | (Rev) CTGGGTCCTCGTTGATGATG | Inner; 248 | ||
| Mrgpra3 | (For) GGGACATCTTTATCGGAGCA | (For) GATTGCACCTGGTGTGTTTG | Outer; 483 | NM_153067 |
| (Rev) ACAGTGGTCAAGTGCAGCAG | (Rev) ATCACGGCTCTGCTTTGTTT | Inner; 218 | ||
| Mrgprd | (For) AGGCTCCTTTCATCCCAAGT | (For) GCTCCTTTCATCCCAAGTGA | Outer; 366 | NM_203490 |
| (Rev) CCATGCTGGGGAGAAACTTA | (Rev) TAACCCCTGGACCACACTTC | Inner; 277 | ||
| Gapdh | (For) AACAGCAACTCCCACTCTTC | (For) ACTCCCACTCTTCCACCTTC | Outer; 329 | NM_008084 |
| (Rev) TGGGTGCAGCGAACTTTAT | (Rev) TGAGGGAGATGCTCAGTGTT | Inner; 230 |
Statistical Analysis
All data are represented as the mean ± SEM. These tests were performed using an unpaired t-test or one-way ANOVA followed by Tukey’s post hoc test and were analyzed using Prism 5.0 (GraphPad Software, CA, USA). P values < 0.05 were considered statistically significant. *P < 0.05, **P < 0.01, ***P < 0.001.
Results
Overproduction of mROS Induces Scratching Behavior in Mice
We first investigated whether ROS specifically derived from mitochondria induces scratching behavior [32]. AA has been widely used to generate mROS overproduction through mitochondrial modulation by inhibiting mETC complex III in a variety of cells including neurons [35, 36]. As shown in Fig. 1A, i.d. injection of AA (10, 25, 50, and 100 µmol/L) elicited itch-like scratching behavior for 30 min (n = 8 per group) in a dose-dependent manner, similar to the inverted U-shaped dose responses reported with some other pruritogens [37–40]. The response at 50 µmol/L AA, which was the most effective dose to elicit scratching behavior, started after a 10-min delay, peaked between 10 and 20 min after injection, and then weakened afterward (Fig. 1B). Interestingly, AA-induced scratching behavior was exclusively itching without wiping behavior, which represented a pain response by the forelimb, at least in our tested drug concentration ranges (Fig. 1C), suggesting that overproduction of mROS by AA injection may be related to itch but not pain signaling, while ethanol (0.4%)-vehicle did not induce noticeable scratching or wiping behavior. AA-induced scratching behavior was markedly suppressed by co-injection with a mitochondria-selective ROS scavenger, MitoTEMPO (100 µmol/L), compared to the PBS-vehicle group (P < 0.05, unpaired t-test, n = 7 per group, Fig. 1D). MitoSox-Red, which is a mitochondria-specific ROS indicator, was evidently increased both in epidermal and dermal layers of cheek skin compared to naive tissue (50 µmol/L of AA, P < 0.01, unpaired t-test, n = 5–7 per group, Fig. 1F, G). While a strong MitoSox-Red signal was detected in the epidermal layer, ROS expression was comparatively low in the dermal layer after AA-intradermal injection. MitoSox-Red-IR co-labeled with β-tubulin was detected along nerve fibers in the dermis, indicating direct production of mROS from nerve terminals themselves (Fig. 1E–H).
Fig. 1.
Antimycin A (AA) treatment induces scratching behavior with elevated mROS in cheek skin. A i.d. injection of AA, a selective inhibitor of mETC complex III resulting in mROS overproduction, elicits scratching behavior in a dose-dependent manner (n = 8 per group). B, C Time courses of scratching (B) and wiping (C) following injection of 50 µmol/L AA or vehicle (0.4% ethanol). D AA-induced scratching behavior is attenuated by co-injection with 100 µmol/L MitoTEMPO, a mitochondria-selective ROS scavenger, but not with PBS-vehicle (n = 7 per group). (E–H) Elevated mROS in AA-treated skin and nerve fibers revealed by immunohistochemical analysis. E Cell nuclei, nerve fibers, and mROS in control and AA-treated cheek skin stained by DAPI (blue), β-tubulin III (green), and MitoSox-Red (red), a mitochondrial targeted ROS indicator, respectively (overlays in far-left panels; white dotted lines, epidermal-dermal junction; scale bar, 40 µm; DIC). F, G The average intensities of MitoSox-Red in epidermis (F) and dermis (G) is markedly elevated by AA treatment, compared to control tissue (n = 4–6 per group). H Representative image of MitoSox-Red-IR along nerve fibers in dermis (scale bar, 20 µm). Data are represented as the mean ± SEM. *P < 0.05, **P < 0.01.
Overproduction of mROS Activates Small TG Neurons
We next determined whether mROS evoked by mitochondrial dysfunction activates TG neurons using whole-cell patch clamp recordings. As shown in Fig. 2A and B, the application of AA depolarized the membrane potential in 55.5% (n = 10 of 18) of small TG neurons while it was never recorded with vehicle treatment (unpaired t-test, P < 0.001, n = 18 per group). The majority of neurons (80%, n = 8 of 10) generated action potentials with AA application but not vehicle treatment (unpaired t-test, P < 0.05, n = 10 per group, Fig. 2C). To address the mechanism of AA-induced depolarization, we tested AA-induced inward currents in small TG neurons at a holding potential of − 60 mV and found that 66.6% (n = 10 of 15) of neurons showed such currents (Fig. 2D). Then, the AA-induced inward currents were completely prevented in 90% (n = 9 of 10) cells by MitoTEMPO (100 µmol/L, P < 0.05, unpaired t-test, n = 10–15 per group, Fig. 2D, F). Interestingly, stepwise inward currents were recorded in all tested AA-responsive neurons; these were not washed out but were prevented by MitoTEMPO, suggesting that persistent generation of mROS by AA application induced the activation of ion channels and elicited membrane depolarization in small TG neurons.
Fig. 2.
Overproduction of mROS by antimycin A (AA) treatment depolarizes the membrane potential and evokes inward currents in small TG neurons. A Representative trace of 50 µmol/L AA-induced action potentials. B, C Changes of membrane potential (B) and number of action potentials (C) by 50 µmol/L AA compared to vehicle (0.05% DMSO, n = 10–18 per group). D Representative traces of 50 µmol/L AA-induced inward currents in the presence of MitoTEMPO (100 µmol/L), a mitochondria-selective ROS scavenger, or PBS-vehicle. E AA-induced currents are markedly blocked by MitoTEMPO (100 µmol/L), compared to vehicle (n = 10–15 per group). Data are represented as the mean ± SEM. *P < 0.05, ***P < 0.001.
TRPC3 Mediates Both mROS-Induced Scratching Behavior and Inward Currents
To explore whether TRPC3 is involved in the modulation of mROS-induced itch, we assessed the effect of Pyr10, a selective inhibitor of TRPC3 channels [28], on AA-induced scratching behavior. As shown in Figure 3A, co-injection with Pyr10 (1, 10, and 25 µmol/L) inhibited the AA (50 µmol/L)-induced scratching in a dose-dependent manner. Pyr10 at 25 µmol/L significantly suppressed AA-induced scratching behavior compared to the vehicle group (0.25% DMSO, P < 0.05, one-way ANOVA followed by Tukey’s post hoc test, n = 7–9 per group). In addition, we investigated whether TRPA1 and TRPV1, which are ROS-sensitive and itch-related channels, contribute to AA-induced scratching behavior. The results showed that AA-induced scratching behavior was not affected by co-injection with HC-030031 (100 µmol/L or 1 mmol/L), a selective TRPA1 blocker, or AMG-9810 (100 µmol/L), a potent TRPV1 antagonist, compared to the vehicle-treated group (one-way ANOVA followed by Tukey’s post hoc test, n = 8–15 per group, Fig. 3B). The efficacy of HC-030031 was confirmed by Ca2+ imaging experiments, in which pre-treatment with HC-030031 at 50 µmol/L for 10 min almost completely blocked the formalin (0.02%)-induced Ca2+ transient (data not shown). AA-induced scratching behaviors in TRPA1-KO and TRPV1-KO mice were comparable with that of the vehicle-treated group (one-way ANOVA followed by Tukey’s post hoc test, n = 8–15 per group, Fig. 3B). We also examined whether AA-induced current was mediated via TRPC3 in small TG neurons. As noted previously, stepwise inward currents were induced by 50 µmol/L AA. We found that AA-induced currents in TRPA1-KO and TRPV1-KO did not differ from those of wild-type mice in small TG neurons (one-way ANOVA followed by Dunnett’s post hoc test, n = 4–12 per group, Fig. 3C). The IC50 of Pyr10 for TRPC3, 1 µmol/L [28], decreased the AA-induced inward currents by about half (50.63 ± 7.6% for 1 µmol/L AA, P < 0.001, paired t-test, n = 8 per group, Fig. 3D, E). When the currents reached a plateau in the presence of AA, co-application of Pyr10 (10 or 25 µmol/L) almost completely abolished them (Fig. 3F, G). The reversible blockade effects were found at both 10 µmol/L (P < 0.0001, paired t-test, n = 5 per group) and 25 µmol/L (P < 0.001, paired t-test, n = 6 per group) of Pyr10 compared to the vehicle groups (0.1% DMSO, Fig. 3F, G). These results showed that the AA-induced inward current was mediated by TRPC3 but not TRPA1 or TRPV1 in small TG neurons.
Fig. 3.
Antimycin A (AA)-induced scratching and inward current are TRPC3-dependent but independent of TRPA1 and TRPV1. A AA-induced scratching bouts are suppressed by co-injection with Pyr10 (25 µmol/L), a selective TRPC3 blocker, but not vehicle (0.25% DMSO, n = 7–9 per group). B AA-induced scratching bouts are not affected by co-injection with HC-030031 (100 µmol/L or 1 mmol/L), a selective TRPA1 blocker, or AMG-9810 (100 µmol/L), a selective TRPV1 blocker, compared to the vehicle-treated group (0.25% DMSO). TRPA1-KO and TRPV1-KO mice show similar AA-induced scratching behavior, compared to wild-type mice (n = 4–18 per group). C AA-induced currents are not different in TRPA1-KO and TRPV1-KO as increased wild-type mice (n = 4–12 per group). D Representative trace of 50 µmol/L AA-induced inward current, which is blocked by Pyr10 (1 µmol/L), a selective TRPC3 blocker. E–G AA-induced inward currents are markedly blocked by (E) 1 µmol/L, (F) 10 µmol/L, and (G) 25 µmol/L of Pyr10 (n = 5–8 per group). Data are represented as the mean ± SEM. *P < 0.05, ***P < 0.001.
TRPC3 is Co-expressed with Itch-Related Mediators and Receptors in Small TG Neurons
To determine a functional interaction between well-known itch-related mediators and receptors in nociceptive primary afferent TG neurons, we investigated transcripts corresponding to Trpc3, Calca, Trpa1, Trpv1, Mrgpra3, and Mrgprd, which are Mas-related G-protein-coupled receptors, in small TG neurons using scRT-PCR. As shown in Figure 4A and Table S1, Trpc3, Trpa1, and Trpv1, members of the subfamily of TRP channels, were detected in 35.2 % (n = 12 of 34), 32.3% (n = 11 of 34), and 23.5% (n = 8 of 34) of small TG neurons, respectively. The expression of Mrgpra3 (5.8%, n = 2 of 34), which is known to mediate itch-evoked responses to chloroquine, was not or rarely detected, while 47.0% (n = 16 of 34) of cells expressed Mrgprd. Calca was detected in the majority of small TG neurons (61.7%, n = 21 of 34). Especially, we focused on the two subgroups based on co-expression of either Calca, Trpa1, and Trpv1 with Trpc3 or Calca, Mrgpra3, and Mrgprd with Trpc3. In Trpc3-positive small TG neurons, Trpa1 and Trpv1 were found in half (n = 6 of 12) and 33.3% (n = 4 of 12), respectively, suggesting that each receptor was highly co-expressed with Trpc3 (Fig. 4B, D, Table S1). Furthermore, Trpc3 was not only highly co-expressed in Mrgprd (n = 9 of 16) but also in Mrgpra3 (n = 2 of 2) (Fig. 4D, Table S1). Our data indicate that Mrgprd and Mrgpra3 are co-expressed with Trpc3 in small TG neurons.
Fig. 4.
scRT-PCR shows that TRPC3 co-expresses itch-related mediators and receptors in small TG neurons. A Representative expression pattern of itch-related mediators and receptor mRNAs including Trpc3, Calca, Trpa1, Trpv1, Mrgpra3, and Mrgprd in individual small TG neurons by single-cell RT-PCR. Predicted product sizes are Trpc3 (210 bp), Calca (187 bp), Trpa1 (219 bp), Trpv1 (248 bp), Mrgpra3 (218 bp), and Mrgprd (277 bp). B, C Venn diagrams illustrating the mutual relationship of Trpc3+, Calca+, Trpa1+, Trpv1+, Mrgpra3+, and Mrgprd+ in small TG neurons. The number of neurons is shown for each population and was obtained from a total of 34 small TG neurons. D Patterns of co-expression with Trpc3 in different itch-related mediators and receptors.
Overproduced mROS Mediate Dry Skin-Induced Chronic Itch Through TRPC3
Next, we investigated whether the mROS level of the affected skin was altered in the dry skin-induced itch model, and also determined the contribution of mROS and TRPC3 in dry skin-induced chronic itch. The experimental procedure is illustrated in Figure 5A. We established that repeated AEW treatments elicited robust scratching behavior. i.d. injection of either MitoTEMPO (100 µmol/L) or Pyr10 (10 µmol/L or 25 µmol/L) inhibited the scratching compared to the vehicle group (0.25% DMSO, P < 0.01, P < 0.001 and P < 0.05, respectively, unpaired t-test, n = 7–12 per group, Fig. 5B). In addition, improving mitochondrial function and biogenesis by repeated treatment with resveratrol, which is a mitochondrial biogenesis enhancer, (25–30 mg/kg; twice per day) markedly attenuated the scratching compared to the vehicle-treated group (5% DMSO, P < 0.001, unpaired t-test, n = 7–12 per group, Fig. 5B). The average intensity of MitoSox-Red in the epidermis of AEW-treated dry skin was remarkably increased compared to naive tissue, but not in the dermis (P < 0.05, unpaired t-test, n = 4–5 per group, Fig. 5C–E). Furthermore, the observed thickness of stained epidermis showed an apparent increase in intensity compared to control tissue (P < 0.001, unpaired t-test, Fig. 5F). This result demonstrated the involvement of mROS and TRPC3 in dry skin-induced chronic itch.
Discussion
Itch (or pruritus) is defined as an unpleasant sensation which evokes the impulse to scratch, and is one of the most common dermatological complaints of patients. Although the most studied and well-characterized pruritogen is histamine, anti-histamine treatment is of limited efficacy in most types of chronic itch [41], indicating the involvement of complex underlying mechanisms. We demonstrated in this study that mitochondrial modulation by inhibiting mETC complex III using AA induces acute itch behavior through TRPC3, and overproduced mROS from malfunctioning mitochondria elicit dry skin-induced chronic itch via TRPC3. These findings reveal that the TRPC3 channel is a potential target for the treatment of chronic itch.
Overproduction of mROS Excites Small TG Neurons to Elicit Itch, But Not Pain
It is known that mitochondria are densely packed at the peripheral terminals of sensory nerves [42] and one of the most common consequences of mitochondrial dysfunction is the overproduction of mROS from the mETC [3, 4]. Although previous studies have indicated that ROS are differentially involved in both pain and itch under pathophysiological conditions [12, 43], it is yet to be determined whether mROS cause pain and/or itch. We found that i.d. injection of AA, which is known to generate ROS by inhibiting mETC complex III [44], elicited only robust scratching behavior in naïve mice, suggesting that AA-induced mROS mediate itch, but not pain (Fig. 1C).
The scratching was suppressed by an mROS-specific scavenger (Figs. 1 and 2). These findings indicate that local elevation of mROS generation by mitochondrial modulation in nerve terminals and surrounding skin cells is sufficient to excite primary afferent neurons to elicit itch. In accordance with a previous study showing that ROS and antioxidant proteins are more abundant in the murine epidermis than the dermis [45], we found that the mROS level in the epidermis was about 20-fold higher than that in the dermis in both control and AA-treated tissue (Fig. 1F, G). In addition, the hyperexcitability of primary afferent neurons elicited by local mROS overproduction is supported by a previous study [7, 8] showing that peripheral application of AA activates bronchopulmonary C-fibers via the selective gating of TRPA1 in a mouse ex vivo lung-vagal ganglia preparation.
The effect of AA on behavioral outcome has been evaluated in previous studies. Although intrathecal injection of AA results in mechanical hypersensitivity in naive mice [11], i.d. injection of AA into the hind paw significantly attenuates the mechanical hypersensitivity caused by some forms of HIV/acquired immune deficiency syndrome therapy, cancer chemotherapy, and diabetes-induced neuropathy [46, 47]. AA also alleviates the mechanical hypersensitivity in certain inflammatory pain models [12], implying the involvement of mitochondrial function in pain signaling under pathological conditions. However, itch behavior by peripheral application of AA has not yet been reported. Our results showed that i.d. injection of AA induced itch exclusively, without unilateral wiping behavior (Fig. 1A–C), which is indicative of pain and has been reported following injection of algogenic substances such as capsaicin [32]. Taken together with a previous study, in which i.d. injection of oxidants such as hydrogen peroxide (H2O2) and tert-butyl hydroperoxide led to much more prominent itch than pain [40], it is likely that itch is the major behavioral response to elevated mROS production in peripheral skin tissue at least in the concentration range of drugs tested. Although 20 µmol/L of AA is almost the maximal dose for mETC complex III inhibition according to previous studies [48, 49], it remained necessary to test whether a higher dose of AA could result in more evident pain in an in vivo system. Our result revealed that a higher dose (50 µmol/L) of AA only elicited itching behavior but not pain behavior (Fig. 1C).
TRPC3, But Neither TRPA1 Nor TRPV1, Mediates mROS-Induced Itch and Inward Currents
Our results showed that local blockade of TRPC3 markedly inhibited AA-induced itch (Fig. 3A) and inward currents (Fig. 3D–G), suggesting that TRPC3 contributes to itch resulting from mitochondrial dysfunction and subsequent mROS overproduction. TRPC3 belongs to the TRPC family (TRPC1–TRPC7), whose members assemble as homo- or heterotetramers to form non-selective Ca2+-permeable cation channels. Recent studies have reported that TRPC4 is involved in selective serotonin reuptake inhibitor-induced itch [50] and TRPC3 might be a good candidate for mediating β-alanine and cholestatic itch in addition to TRPA1 [51]. In contrast, a previous study has reported that TRPC3 is not required for β-alanine-induced acute pruritus [52]. On the other hand, accumulating evidence indicates that TRPC channels, including TRPC3, are activated by ROS [19–21, 53]. Although a previous study proposed that TRPC3 and TRPC4 contribute subunits to the redox-sensitive channel in endothelial cells [19], it still remains elusive whether co-expression of TRPC4 is required for ROS sensing by TRPC3 in peripheral sensory systems, considering that the gene expression of TRPC4 is very low in mouse DRG neurons [24] and we found a high incidence of AA-induced current that was completely blocked by a TRPC3-specific blocker in wild-type mice (Fig. 3D–G).
Pain and itch sensation are known to be conveyed via the same primary afferent neurons, called nociceptive neurons [54], with which the nerves to the TG are densely packed [55]. Nociceptive neurons are categorized into two types: peptidergic neurons expressing neuropeptides such as substance P or CGRP, and non-peptidergic neurons expressing IB4 [56, 57]. Our scRT-PCR results showed that itch-related mediators and receptors in pruriceptive primary afferent TG neurons were co-expressed with Trpc3 (Fig. 4), suggesting that TRPC3 contributes to itch resulting from mitochondrial dysfunction and subsequent mROS overproduction. TRPC3 is known to be expressed in non-peptidergic small-diameter sensory neurons [22–24] and is found almost exclusively in MrgprA3+ and MrgprD+ cells [52]. MrgprA3 receptors directly activated by chloroquine evoke scratching behavior in mice [58] and MrgprD mediates β-alanine-induced itch sensations [59]. In accordance with the previous study, our data showed co-expression of Trpc3 in Mrgpra3 (100%, n = 2 of 2) and in Mrgprd (56.2%, n = 9 of 16) in small TG neurons (Fig. 4A, C and Table S1).
Also, TRPC3 is co-localized with MrgprA3 and is responsible for the chloroquine-induced excitation of TRPA1-negative DRG neurons, implying the involvement of TRPC3 acting along with TRPA1 to mediate chloroquine-induced itch [25]. Although it is well known that TRPV1 is involved in histaminergic itch [60], TRPA1 plays a crucial role in acute non-histaminergic itch [61] and MrgprA3 is important for non-histaminergic and TRPV1-independent itch [61], we showed that AA-induced itch was independent of both TRPA1 and TRPV1 (Fig. 3B) which are also ROS-sensitive and activated by AA [7]. Our results seem contradictory to a previous report which showed that i.d.-injected H2O2 elicits robust itch that is blocked by a TRPA1-selective antagonist or in TRPA1-KO mice [40]. This apparent discrepancy might be resolved as follows: (1) In our study, drugs were injected into cheek rather than back skin, implying a possible difference between the trigeminal and spinal itch transduction systems. For example, it has not yet been thoroughly determined whether the expression patterns of various itch-related receptors in TG neurons are similar to DRG neurons. (2) We used AA to generate excessive ROS specifically from intracellular mitochondria, whereas a single type of oxidant was exogenously injected in a previous study. It is not clear whether exogenously-injected oxidant mimics the action of ROS elicited from intracellular mitochondria in vivo, considering that ROS are extremely reactive. (3) The actual production levels of mROS by inhibiting mETC III are not clear in the in vivo system. Our behavioral and electrophysiology data (Fig. 3) indicate a functional role of TRPC3 in mROS-evoked itch.
Although we showed the role of TRPC3 in mROS-evoked itch, it remains to be determined how intracellular mROS activates TRPC3 to induce itch. There are at least two possible mechanisms for mROS-induced TRPC3 activation. First, mROS may directly activate TRPC3 through modification of cysteine residues, like its action on other channels such as TRPA1, TRPV1, and TRPC5 [18]. On the other hand, given that our scRT-PCR revealed that TRPC3 was co-expressed with itch-related MrgprA3 (Fig. 4), mROS might modulate TRPC3 activation through downstream pathways, like PLCβ3, PKC, and MAPK, which are known to activate TRPA1 [25, 62, 63]. Further work is required to confirm the underlying molecular mechanisms of ROS-mediated TRPC3 activation to produce itch.
mROS and TRPC3 are Involved in Dry Skin-Induced Chronic Itch
Our data demonstrated that i.d. injection of an mROS-specific scavenger markedly inhibited dry skin-induced itch (Fig. 5B), suggesting that mROS plays a crucial role in chronic itch. Several lines of evidence further support the idea that malfunction of mitochondria is one important factor in various kinds of chronic itch. First, mitochondrial dysfunction is involved in skin diseases accompanied by chronic itch such as psoriasis and atopic dermatitis [64, 65]. Second, some other diseases associated with mitochondrial dysfunction, but not directly related to skin disorders, e.g. diabetes, chronic liver diseases, cholestasis, and peripheral neuropathy, also frequently accompany chronic itch [10, 66–68]. Third, itch is a predominant skin complaint especially in the elderly who are usually more prone to dry skin than younger people. It is widely accepted that aging is associated with mitochondrial dysfunction and increased ROS production [69]. Our data showing that repeated treatment with resveratrol, a mitochondrial biogenesis enhancer, markedly suppressed dry skin-induced itch (Fig. 5B) are also in good accordance with the critical role of mitochondrial function in chronic itch.
Dry skin-induced chronic scratching was also significantly relieved by blocking of TRPC3 in skin tissue (Fig. 5B), indicating that TRPC3 mediates, at least in part, dry skin-induced chronic itch. This was not surprising, considering that mROS-induced itch (Fig. 3A) and mROS-induced inward current (Fig. 3D–G) were suppressed by a TRPC3-selective blocker. Furthermore, specific innervation of nerve fibers with MrgprA3 [58] and MrgprD [70] in the epidermis, and enhanced non-peptidergic intra-epidermal fiber density in a dry skin-induced itch model [71] support the hypothesis that TRPC3 contributes to dry skin-induced chronic itch. However, co-expression or interaction with TRPA1, which has been suggested to be a key player in dry skin itch [26], and other itch receptors remains to be determined. The activation of TRPC3 by diverse pruritogens, e.g. histamine [72], 5-HT [73] and chloroquine [25], further raises the possibility that TRPC3 is also an important player in various other itchy conditions.
It is interesting to note the differential expression of mROS between AA-treated and AEW-treated mice. The MitoSox signal was highly expressed in the epidermal layer in both AA-treated (Fig. 1E, F) and AEW-treated mice (Fig. 5C, D). However, the MitoSox signal significantly increased along nerve fibers in the dermal layer in AA-treated mice (Fig. 1E, G, H) while AEW treatment had no effect on mROS expression in the dermis (Fig. 5C, E). The discrepancy in the expression of mROS between the two models might be due to the different routes of drug application. i.d. injection of AA directly exposed the dermis to the drug and might lead to the production of mROS. On the contrary, the dermis of AEW-treated mice was unaffected as the drug (i.e. AEW) was applied to the surface of the skin.
In summary, our results indicate that locally elevated mROS production by mitochondrial dysfunction elicits itch through TRPC3, which might be one of underlying mechanisms of chronic itch. Given that mitochondrial dysfunction and mROS overproduction are broadly associated with diseases accompanying chronic itch and that TRPC3 is activated by diverse pruritogens [25, 72, 73], pharmacological approaches that restore mitochondrial function and block excessive mROS or TRPC3 might be considered to relieve various types of chronic itch.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
We thank Dr. Justin C. Lee for the kind gift of TRPA1-KO mice and Alexander J. Davies for valuable comments on the manuscript. This research was supported by the National Research Foundation (NRF) funded by the Ministry of Science, ICT & Future Planning (NRF-2018R1A5A2024418 and NRF-2021R1A2C3003334) and the Basic Science Research Program through the NRF funded by the Ministry of Education (NRF-2020R1I1A1A01068037).
Conflict of interest
The authors declare no competing interests.
Footnotes
Seong-Ah Kim and Jun Ho Jang contributed equally to this work.
Contributor Information
Kihwan Lee, Email: key1479@gmail.com.
Seog Bae Oh, Email: odolbae@snu.ac.kr.
References
- 1.Sena LA, Chandel NS. Physiological roles of mitochondrial reactive oxygen species. Mol Cell. 2012;48:158–167. doi: 10.1016/j.molcel.2012.09.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gopčević KR, Rovčanin BR, Tatić SB, Krivokapić ZV, Gajić MM, Dragutinović VV. Activity of superoxide dismutase, catalase, glutathione peroxidase, and glutathione reductase in different stages of colorectal carcinoma. Dig Dis Sci. 2013;58:2646–2652. doi: 10.1007/s10620-013-2681-2. [DOI] [PubMed] [Google Scholar]
- 3.Bonawitz ND, Rodeheffer MS, Shadel GS. Defective mitochondrial gene expression results in reactive oxygen species-mediated inhibition of respiration and reduction of yeast life span. Mol Cell Biol. 2006;26:4818–4829. doi: 10.1128/MCB.02360-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Lin MT, Beal MF. Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases. Nature. 2006;443:787–795. doi: 10.1038/nature05292. [DOI] [PubMed] [Google Scholar]
- 5.Nunnari J, Suomalainen A. Mitochondria: in sickness and in health. Cell. 2012;148:1145–1159. doi: 10.1016/j.cell.2012.02.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Holmström KM, Finkel T. Cellular mechanisms and physiological consequences of redox-dependent signalling. Nat Rev Mol Cell Biol. 2014;15:411–421. doi: 10.1038/nrm3801. [DOI] [PubMed] [Google Scholar]
- 7.Nesuashvili L, Hadley SH, Bahia PK, Taylor-Clark TE. Sensory nerve terminal mitochondrial dysfunction activates airway sensory nerves via transient receptor potential (TRP) channels. Mol Pharmacol. 2013;83:1007–1019. doi: 10.1124/mol.112.084319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hadley SH, Bahia PK, Taylor-Clark TE. Sensory nerve terminal mitochondrial dysfunction induces hyperexcitability in airway nociceptors via protein kinase C. Mol Pharmacol. 2014;85:839–848. doi: 10.1124/mol.113.091272. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kim HY, Lee KY, Lu Y, Wang JG, Cui L, Kim SJ, et al. Mitochondrial Ca2+ uptake is essential for synaptic plasticity in pain. J Neurosci. 2011;31:12982–12991. doi: 10.1523/JNEUROSCI.3093-11.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sui BD, Xu TQ, Liu JW, Wei W, Zheng CX, Guo BL, et al. Understanding the role of mitochondria in the pathogenesis of chronic pain. Postgrad Med J. 2013;89:709–714. doi: 10.1136/postgradmedj-2012-131068. [DOI] [PubMed] [Google Scholar]
- 11.Kim HY, Chung JM, Chung K. Increased production of mitochondrial superoxide in the spinal cord induces pain behaviors in mice: The effect of mitochondrial electron transport complex inhibitors. Neurosci Lett. 2008;447:87–91. doi: 10.1016/j.neulet.2008.09.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Joseph EK, Levine JD. Mitochondrial electron transport in models of neuropathic and inflammatory pain. Pain. 2006;121:105–114. doi: 10.1016/j.pain.2005.12.010. [DOI] [PubMed] [Google Scholar]
- 13.LaMotte RH, Dong XZ, Ringkamp M. Sensory neurons and circuits mediating itch. Nat Rev Neurosci. 2014;15:19–31. doi: 10.1038/nrn3641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ward L, Wright E, McMahon SB. A comparison of the effects of noxious and innocuous counterstimuli on experimentally induced itch and pain. Pain. 1996;64:129–138. doi: 10.1016/0304-3959(95)00080-1. [DOI] [PubMed] [Google Scholar]
- 15.Sun YG, Zhao ZQ, Meng XL, Yin J, Liu XY, Chen ZF. Cellular basis of itch sensation. Science. 2009;325:1531–1534. doi: 10.1126/science.1174868. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Dong XT, Dong XZ. Peripheral and central mechanisms of itch. Neuron. 2018;98:482–494. doi: 10.1016/j.neuron.2018.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Xiao BL, Patapoutian A. Scratching the surface: A role of pain-sensing TRPA1 in itch. Nat Neurosci. 2011;14:540–542. doi: 10.1038/nn.2813. [DOI] [PubMed] [Google Scholar]
- 18.Ogawa N, Kurokawa T, Mori YS. Sensing of redox status by TRP channels. Cell Calcium. 2016;60:115–122. doi: 10.1016/j.ceca.2016.02.009. [DOI] [PubMed] [Google Scholar]
- 19.Poteser M, Graziani A, Rosker C, Eder P, Derler I, Kahr H, et al. TRPC3 and TRPC4 associate to form a redox-sensitive cation channel. J Biol Chem. 2006;281:13588–13595. doi: 10.1074/jbc.M512205200. [DOI] [PubMed] [Google Scholar]
- 20.Cioffi DL. Redox regulation of endothelial canonical transient receptor potential channels. Antioxid Redox Signal. 2011;15:1567–1582. doi: 10.1089/ars.2010.3740. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Balzer M, Lintschinger B, Groschner K. Evidence for a role of Trp proteins in the oxidative stress-induced membrane conductances of porcine aortic endothelial cells. Cardiovasc Res. 1999;42:543–549. doi: 10.1016/S0008-6363(99)00025-5. [DOI] [PubMed] [Google Scholar]
- 22.Luo WQ, Wickramasinghe SR, Savitt JM, Griffin JW, Dawson TM, Ginty DD. A hierarchical NGF signaling cascade controls Ret-dependent and Ret-independent events during development of nonpeptidergic DRG neurons. Neuron. 2007;54:739–754. doi: 10.1016/j.neuron.2007.04.027. [DOI] [PubMed] [Google Scholar]
- 23.Alkhani H, Ase AR, Grant R, O'Donnell D, Groschner K, Séguéla P. Contribution of TRPC3 to store-operated calcium entry and inflammatory transductions in primary nociceptors. Mol Pain. 2014;10:43. doi: 10.1186/1744-8069-10-43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Usoskin D, Furlan A, Islam S, Abdo H, Lönnerberg P, Lou DH, et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci. 2015;18:145–153. doi: 10.1038/nn.3881. [DOI] [PubMed] [Google Scholar]
- 25.Than JYXL, Li L, Hasan R, Zhang XM. Excitation and modulation of TRPA1, TRPV1, and TRPM8 channel-expressing sensory neurons by the pruritogen chloroquine. J Biol Chem. 2013;288:12818–12827. doi: 10.1074/jbc.M113.450072. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Wilson SR, Nelson AM, Batia L, Morita T, Estandian D, Owens DM, et al. The ion channel TRPA1 is required for chronic itch. J Neurosci. 2013;33:9283–9294. doi: 10.1523/JNEUROSCI.5318-12.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Pelizzoni I, Macco R, Morini MF, Zacchetti D, Grohovaz F, Codazzi F. Iron handling in hippocampal neurons: Activity-dependent iron entry and mitochondria-mediated neurotoxicity. Aging Cell. 2011;10:172–183. doi: 10.1111/j.1474-9726.2010.00652.x. [DOI] [PubMed] [Google Scholar]
- 28.Schleifer H, Doleschal B, Lichtenegger M, Oppenrieder R, Derler I, Frischauf I, et al. Novel pyrazole compounds for pharmacological discrimination between receptor-operated and store-operated Ca2+ entry pathways. Br J Pharmacol. 2012;167:1712–1722. doi: 10.1111/j.1476-5381.2012.02126.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.McNamara CR, Mandel-Brehm J, Bautista DM, Siemens J, Deranian KL, Zhao M, et al. TRPA1 mediates formalin-induced pain. Proc Natl Acad Sci USA. 2007;104:13525–13530. doi: 10.1073/pnas.0705924104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Gavva NR, Tamir R, Qu YS, Klionsky L, Zhang TJ, Immke D, et al. AMG 9810 [(E)-3-(4-t-butylphenyl)-N-(2, 3-dihydrobenzo[b][1, 4]dioxin-6-yl)acrylamide], a novel vanilloid receptor 1 (TRPV1) antagonist with antihyperalgesic properties. J Pharmacol Exp Ther. 2005;313:474–484. doi: 10.1124/jpet.104.079855. [DOI] [PubMed] [Google Scholar]
- 31.Price NL, Gomes AP, Ling AJY, Duarte FV, Martin-Montalvo A, North BJ, et al. SIRT1 is required for AMPK activation and the beneficial effects of resveratrol on mitochondrial function. Cell Metab. 2012;15:675–690. doi: 10.1016/j.cmet.2012.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Shimada SG, LaMotte RH. Behavioral differentiation between itch and pain in mouse. Pain. 2008;139:681–687. doi: 10.1016/j.pain.2008.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Ehling S, Butler A, Thi S, Ghashghaei HT, Bäumer W. To scratch an itch: Establishing a mouse model to determine active brain areas involved in acute histaminergic itch. IBRO Rep. 2018;5:67–73. doi: 10.1016/j.ibror.2018.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Park CK, Kim MS, Fang Z, Li HY, Jung SJ, Choi SY, et al. Functional expression of thermo-transient receptor potential channels in dental primary afferent neurons. J Biol Chem. 2006;281:17304–17311. doi: 10.1074/jbc.M511072200. [DOI] [PubMed] [Google Scholar]
- 35.Turrens JF, Alexandre A, Lehninger AL. Ubisemiquinone is the electron donor for superoxide formation by complex III of heart mitochondria. Arch Biochem Biophys. 1985;237:408–414. doi: 10.1016/0003-9861(85)90293-0. [DOI] [PubMed] [Google Scholar]
- 36.Vesce S, Kirk L, Nicholls DG. Relationships between superoxide levels and delayed calcium deregulation in cultured cerebellar granule cells exposed continuously to glutamate. J Neurochem. 2004;90:683–693. doi: 10.1111/j.1471-4159.2004.02516.x. [DOI] [PubMed] [Google Scholar]
- 37.Green AD, Young KK, Lehto SG, Smith SB, Mogil JS. Influence of genotype, dose and sex on pruritogen-induced scratching behavior in the mouse. Pain. 2006;124:50–58. doi: 10.1016/j.pain.2006.03.023. [DOI] [PubMed] [Google Scholar]
- 38.Liu Q, Tang ZX, Surdenikova L, Kim S, Patel KN, Kim A, et al. Sensory neuron-specific GPCR Mrgprs are itch receptors mediating chloroquine-induced pruritus. Cell. 2009;139:1353–1365. doi: 10.1016/j.cell.2009.11.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Liu T, Xu ZZ, Park CK, Berta T, Ji RR. Toll-like receptor 7 mediates pruritus. Nat Neurosci. 2010;13:1460–1462. doi: 10.1038/nn.2683. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Liu T, Ji RR. Oxidative stress induces itch via activation of transient receptor potential subtype ankyrin 1 in mice. Neurosci Bull. 2012;28:145–154. doi: 10.1007/s12264-012-1207-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Grundmann S, Ständer S. Chronic pruritus: Clinics and treatment. Ann Dermatol. 2011;23:1–11. doi: 10.5021/ad.2011.23.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Hung KS, Hertweck MS, Hardy JD, Loosli CG. Ultrastructure of nerves and associated cells in bronchiolar epithelium of the mouse lung. J Ultrastruct Res. 1973;43:426–437. doi: 10.1016/S0022-5320(73)90019-1. [DOI] [PubMed] [Google Scholar]
- 43.Sivaranjani N, Rao SV, Rajeev G. Role of reactive oxygen species and antioxidants in atopic dermatitis. J Clin Diagn Res. 2013;7:2683–2685. doi: 10.7860/JCDR/2013/6635.3732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Alexandre A, Lehninger AL. Bypasses of the antimycin a block of mitochondrial electron transport in relation to ubisemiquinone function. Biochim Biophys Acta. 1984;767:120–129. doi: 10.1016/0005-2728(84)90086-0. [DOI] [PubMed] [Google Scholar]
- 45.Carr WJ, Oberley-Deegan RE, Zhang YP, Oberley CC, Oberley LW, Dunnwald M. Antioxidant proteins and reactive oxygen species are decreased in a murine epidermal side population with stem cell-like characteristics. Histochem Cell Biol. 2011;135:293–304. doi: 10.1007/s00418-011-0786-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Joseph EK, Levine JD. Multiple PKCε-dependent mechanisms mediating mechanical hyperalgesia. Pain. 2010;150:17–21. doi: 10.1016/j.pain.2010.02.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Joseph EK, Levine JD. Comparison of oxaliplatin- and cisplatin-induced painful peripheral neuropathy in the rat. J Pain. 2009;10:534–541. doi: 10.1016/j.jpain.2008.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Gonzalez-Dosal R, Horan KA, Paludan SR. Mitochondria-derived reactive oxygen species negatively regulates immune innate signaling pathways triggered by a DNA virus, but not by an RNA virus. Biochem Biophys Res Commun. 2012;418:806–810. doi: 10.1016/j.bbrc.2012.01.108. [DOI] [PubMed] [Google Scholar]
- 49.Liu M, Liu H, Dudley SC., Jr Reactive oxygen species originating from mitochondria regulate the cardiac sodium channel. Circ Res. 2010;107:967–974. doi: 10.1161/CIRCRESAHA.110.220673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Lee SH, Cho PS, Tonello R, Lee HK, Jang JH, Park GY, et al. Peripheral serotonin receptor 2B and transient receptor potential channel 4 mediate pruritus to serotonergic antidepressants in mice. J Allergy Clin Immunol. 2018;142:1349–1352.e16. doi: 10.1016/j.jaci.2018.05.031. [DOI] [PubMed] [Google Scholar]
- 51.Sun SH, Dong XZ. Trp channels and itch. Semin Immunopathol. 2016;38:293–307. doi: 10.1007/s00281-015-0530-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Dong P, Guo CX, Huang SX, Ma MH, Liu Q, Luo WQ. TRPC3 is dispensable for β-alanine triggered acute itch. Sci Rep. 2017;7:13869. doi: 10.1038/s41598-017-12770-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Takahashi N, Mori YS. TRP channels as sensors and signal integrators of redox status changes. Front Pharmacol. 2011;2:58. doi: 10.3389/fphar.2011.00058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Ikoma A, Steinhoff M, Ständer S, Yosipovitch G, Schmelz M. The neurobiology of itch. Nat Rev Neurosci. 2006;7:535–547. doi: 10.1038/nrn1950. [DOI] [PubMed] [Google Scholar]
- 55.Dixon AD. The ultrastructure of nerve fibers in the trigeminal ganglion of the rat. J Ultrastruct Res. 1963;8:107–121. doi: 10.1016/S0022-5320(63)80023-4. [DOI] [PubMed] [Google Scholar]
- 56.Molliver DC, Radeke MJ, Feinstein SC, Snider WD. Presence or absence of TrkA protein distinguishes subsets of small sensory neurons with unique cytochemical characteristics and dorsal horn projections. J Comp Neurol. 1995;361:404–416. doi: 10.1002/cne.903610305. [DOI] [PubMed] [Google Scholar]
- 57.Snider WD, McMahon SB. Tackling pain at the source: New ideas about nociceptors. Neuron. 1998;20:629–632. doi: 10.1016/S0896-6273(00)81003-X. [DOI] [PubMed] [Google Scholar]
- 58.Han L, Ma C, Liu Q, Weng HJ, Cui YY, Tang ZX, et al. A subpopulation of nociceptors specifically linked to itch. Nat Neurosci. 2013;16:174–182. doi: 10.1038/nn.3289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Liu Q, Sikand P, Ma C, Tang ZX, Han L, Li Z, et al. Mechanisms of itch evoked by β-alanine. J Neurosci. 2012;32:14532–14537. doi: 10.1523/JNEUROSCI.3509-12.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Kim BM, Lee SH, Shim WS, Oh U. Histamine-induced Ca2+ influx via the PLA2/lipoxygenase/TRPV1 pathway in rat sensory neurons. Neurosci Lett. 2004;361:159–162. doi: 10.1016/j.neulet.2004.01.019. [DOI] [PubMed] [Google Scholar]
- 61.Wilson SR, Gerhold KA, Bifolck-Fisher A, Liu Q, Patel KN, Dong XZ, et al. TRPA1 is required for histamine-independent, Mas-related G protein-coupled receptor-mediated itch. Nat Neurosci. 2011;14:595–602. doi: 10.1038/nn.2789. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Kittaka H, Tominaga M. The molecular and cellular mechanisms of itch and the involvement of TRP channels in the peripheral sensory nervous system and skin. Allergol Int. 2017;66:22–30. doi: 10.1016/j.alit.2016.10.003. [DOI] [PubMed] [Google Scholar]
- 63.Giorgi S, Nikolaeva-Koleva M, Alarcón-Alarcón D, Butrón L, González-Rodríguez S. Is TRPA1 Burning down TRPV1 as druggable target for the treatment of chronic pain? Int J Mol Sci. 2019;20:E2906. doi: 10.3390/ijms20122906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Bickers DR, Athar M. Oxidative stress in the pathogenesis of skin disease. J Invest Dermatol. 2006;126:2565–2575. doi: 10.1038/sj.jid.5700340. [DOI] [PubMed] [Google Scholar]
- 65.Feichtinger RG, Sperl W, Bauer JW, Kofler B. Mitochondrial dysfunction: A neglected component of skin diseases. Exp Dermatol. 2014;23:607–614. doi: 10.1111/exd.12484. [DOI] [PubMed] [Google Scholar]
- 66.Mela M, Mancuso A, Burroughs AK. Review article: Pruritus in cholestatic and other liver diseases. Aliment Pharmacol Ther. 2003;17:857–870. doi: 10.1046/j.1365-2036.2003.01458.x. [DOI] [PubMed] [Google Scholar]
- 67.Weisshaar E, Dalgard F. Epidemiology of itch: Adding to the burden of skin morbidity. Acta Derm Venereol. 2009;89:339–350. doi: 10.2340/00015555-0662. [DOI] [PubMed] [Google Scholar]
- 68.Carstens E, Akiyama T. Neuropathic itch—itch: Mechanisms and treatment. 2014. CRC Press/Taylor & Francis, 2014. [PubMed]
- 69.Bratic A, Larsson NG. The role of mitochondria in aging. J Clin Invest. 2013;123:951–957. doi: 10.1172/JCI64125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Zylka MJ, Rice FL, Anderson DJ. Topographically distinct epidermal nociceptive circuits revealed by axonal tracers targeted to Mrgprd. Neuron. 2005;45:17–25. doi: 10.1016/j.neuron.2004.12.015. [DOI] [PubMed] [Google Scholar]
- 71.Valtcheva MV, Samineni VK, Golden JP, Gereau RW, 4th, Davidson S. Enhanced nonpeptidergic intraepidermal fiber density and an expanded subset of chloroquine-responsive trigeminal neurons in a mouse model of dry skin itch. J Pain. 2015;16:346–356. doi: 10.1016/j.jpain.2015.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Kwan HY, Wong CO, Chen ZY, Chan TWD, Huang Y, Yao XQ. Stimulation of histamine H2 receptors activates TRPC3 channels through both phospholipase C and phospholipase D. Eur J Pharmacol. 2009;602:181–187. doi: 10.1016/j.ejphar.2008.10.054. [DOI] [PubMed] [Google Scholar]
- 73.Zhou FM, Lee CR. Intrinsic and integrative properties of substantia nigra pars reticulata neurons. Neuroscience. 2011;198:69–94. doi: 10.1016/j.neuroscience.2011.07.061. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.





