Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Nov 4.
Published in final edited form as: Mol Cancer Ther. 2022 May 4;21(5):786–798. doi: 10.1158/1535-7163.MCT-21-0613

A Preclinical Study to Repurpose Spironolactone for Enhancing Chemotherapy Response in Bladder Cancer

Dongbo Xu 1, Qiang Cao 1,#, Li Wang 1, Jianmin Wang 2, Bo Xu 3, Kristopher Attwood 2, Lei Wei 2, Yue Wu 1, Gary Smith 1, Eriko Katsuta 4, Kazuaki Takabe 4, Gurkamal Chatta 5, Khurshid Guru 1, David W Goodrich 6, Qiang J Li 1,6,*
PMCID: PMC9081199  NIHMSID: NIHMS1783716  PMID: 35247903

Abstract

Neoadjuvant chemotherapy (NAC) followed by radical cystectomy is the standard of care for patients with muscle-invasive bladder cancer (MIBC). Defects in nucleotide excision repair (NER) are associated with improved responses to NAC. Excision Repair Cross-Complementation group 3 (ERCC3) is a key component of NER process. No NER inhibitors are available for treating bladder cancer patients. We have developed an ex vivo cell-based assay of 6–4 pyrimidine–pyrimidinone (6-4PP) removal as a surrogate measure of NER capacity in human bladder cancer cell lines. The protein expression of ERCC3 was examined in human MIBC specimens and cell lines. Small molecule inhibitors were screened for NER inhibition in bladder cancer cell lines. Spironolactone (SP) was identified as a potent NER inhibitor. Combined effects of SP with chemo-drugs were evaluated in vitro and in vivo. The efficacy between platinum and SP on cytotoxicity was determined by combination index. A correlation between NER capacity and cisplatin sensitivity was demonstrated in a series of bladder cancer cell lines. Further, siRNA-mediated knockdown of ERCC3 abrogated NER capacity and enhanced cisplatin cytotoxicity. SP inhibited ERCC3 protein expression, abrogated NER capacity, and increased platinum-induced cytotoxicity in bladder cancer cells in vivo and in patient-derived organoids. Moreover, SP exhibited the potential synergism effects with other clinical chemotherapy regimens in bladder cancer cell lines. Our data support the notion of re-purposing SP for improving the chemotherapy response of NAC in MIBC patients. Further clinical trials are warranted to determine the safety and efficacy of SP in combination with chemotherapy.

Introduction

Neoadjuvant cisplatin-based chemotherapy (NAC) followed by radical cystectomy is the standard-of-care for patients with muscle-invasive bladder cancer (MIBC) (1). The survival benefit of neoadjuvant chemotherapy is significant in responders (no residual disease in 38% of treated patients), but not among non-responders (patients with residual invasive disease) (2). A doublet regimen of gemcitabine and cisplatin (GC) has been accepted as the standard-of-care given the similar efficacy and improved tolerability compared with the conventional combined regimens of methotrexate, vinblastine, adriamycin and cisplatin (MVAC) (3). However, due to the known variability in response to NAC, up to 70% of patients are exposed to toxic chemotherapy without clinical benefit (4). Therefore, it is critical to develop better strategies to select ideal patients for NAC and improve the response rate for non-responders.

In response to cisplatin, cancer cells activate multiple DNA damage response (DDR) pathways, however, the nucleotide excision repair (NER) pathway is the predominant mechanism responsible for the recognition and repair of cisplatin-induced DNA adducts (5, 6). Alterations in the NER pathway have been observed in multiple cancers, including bladder, ovarian, multiple myeloma and non-small cell lung cancer (7–12). ERCC2 (Excision Repair Cross-Complementation group 2) is the most commonly mutated DDR gene in MIBC (12%) (13, 14). Genomic biomarker studies demonstrate that all patients with loss-of-function mutations of ERCC2, a key component of NER, respond to NAC (15, 16). Multiple clinical trials are underway to select patients with ERCC2 mutations (or other DDR gene mutations) for NAC (17). However, no functional test is available to determine the NER activity in tumor samples to facilitate selection of MIBC patients for NAC. Future clinical trials with co-biomarker studies are needed to measure the level of NER proficiency for individual MIBC patients who undergo chemotherapy.

Targeting multiple components of DDR/NER pathways has been investigated as a mechanism to increase the sensitivity of various cancers to traditional chemotherapeutics (18). TFIIH (transcription factor IIH), containing both ERCC2 and ERCC3, is emerging as an important target for cancer therapy (19). Previously, we and others confirmed that loss of ERCC2 function was sufficient to confer NER deficiency and cisplatin sensitivity, suggesting the vulnerability of a perturbed TFIIH to chemotherapy (8, 20). However, only 10–20% bladder tumors are NER deficient due to mutations of ERCC2 or mutations in other NER genes (7, 8). Here, we aim to develop an assay for measuring NER activity and investigate a strategy to target the 80–90% NER proficient tumors by using available putative NER inhibitors (18). ERCC2 and ERCC3 are both essential helicases for the TFIIH complex and the NER process (21, 22), Since ERCC2 is not druggable, we seek to determine the biological function and targetability of ERCC3 in bladder cancer.

Spironolactone (SP) is a safe drug approved by the Food and Drug Administration (FDA) for treatment of hypertension, heart failure, acne and hirsutism due to its anti-mineralocorticoid and anti-androgenic activity. Unexpectedly, SP was also identified as a putative DNA repair inhibitor (23–25). Therefore, we hypothesize that repurposing SP as a DNA repair inhibitor would functionally impair the key NER process and improve response to NAC. We found ERCC3 is constitutively expressed in human MIBC cells and SP inhibited ERCC3 expression, abrogated NER activity and potentiated cisplatin toxicity in vitro and in vivo using preclinical models of MIBC. These data provide strong proof-of-concept evidence to suggest a clinical trial of combining neoadjuvant SP and NAC for the management of MIBC patients.

Materials and Methods

Human tissue specimens and patient-derived organoid culture

The studies were conducted in accordance with Declaration of Helsinki. Written informed consents for use of remnant bladder tissue for research were obtained from all de-identified patients. Fresh human bladder tumor specimens were collected under protocols (BDR 096618) approved by the Roswell Park Comprehensive Cancer Center (RPCCC) Institutional Review Board. Samples were used for the establishment of patient-derived organoids (PDOs) according to Lee’s methods (26). Organoid culture, passaging and freezing were performed as reported (26). A tissue microarray (TMA) of normal and malignant human bladder tissues was purchased from US Biomax (BL481b), including 40 bladder tumor tissues from 40 patients and 8 normal bladder tissues. The score of IHC staining of ERCC3 expression (percentage ERCC3 positive cells × staining positivity) was evaluated as previously described (27).

Cell lines

Human bladder cancer cell lines KU-19-19, KE1, RT-112, LB831-blc, HCV29, 5637, UMUC-3, J82 and BC-3C were provided by Dr. David Solit (Memorial Sloan Kettering Cancer Center, NY) or obtained from American Type Culture Collection. Cell line authentication was performed by short tandem repeat (STR) profiling and mycoplasma testing was conducted at IDEXX BioAnalytics. KU-19-19, KE1, RT-112, LB831-blc, HCV29 and 5637 were maintained in RPMI1640 (Corning) with 10% FBS. UMUC-3 cells were cultured in DMEM (Corning) with 10% FBS. J82 cells were cultured in MEM (Corning) with 10% FBS. BC-3C cells were cultured in supplemented McCoy’s 5A (Corning).

Cell viability assays

For drug sensitivity assays, cells were plated in 96-well plates at a density of 2000 cells per well. Drugs were serially diluted in media and added. After 72 hours, CellTiter Glo reagent (Promega) was added, and the plates were read using a Veritas Microplate Luminometer. For drug sensitivity assays in PDOs, 4000 cells were plated in an organoid culture medium and Matrigel mixture (v/v 1:1). Following overnight culture, drugs were serially diluted in media and added. After 7 days, 100 μL CellTiter Glo was added, and the plates were incubated for 30 min at 37 °C before being read. Drug sensitivity analyses were performed using GraphPad Prism, and the values of IC50 were calculated by applying nonlinear regression (curve fit) and the equation log(inhibitor) versus normalized response (variable slope). For drug combination analysis, the Chou-Talalay method was used to calculate the combination index (CI) using the software CompuSyn (28). CI was defined as additive effect (CI = 1), synergism (CI < 1) and antagonism (CI > 1).

qPCR analysis

Total RNA was isolated using TRIzol Reagent (Invitrogen) according to the manufacturer protocol. Total 2 μg RNA from each sample were subjected to reverse transcription using High-Capacity cDNA reverse transcription kits (Applied Biosystems). Real-time PCR was performed on a Bio-Rad CFX system with iTaq universal SYBR green supermix (Bio-Rad). The used primers were listed as follows: human ERCC3: F: ATGGGCAAAAGAGACCGAGC, R: CTTTGGTGCCTGACTCATCCA; human GAPDH: F: GCACCGTCAAGGCTGAGAAC, R: ATGGTGGTGAAGACGCCAGT.

Western blot analysis

Total cell lysates were prepared from human bladder cancer cell lines with RIPA lysis buffer supplemented with a Protease Inhibitor Cocktail (Thermo Fisher). Western blotting (WB) was performed using the primary and secondary antibodies listed in Supplementary Table S1. The protein expression levels were detected using the Clarity Western ECL and Clarity Max Western ECL (Bio-Rad). Equal protein sample loading was monitored by incubating the same nitrocellulose membrane with an anti-GAPDH or α-tubulin antibody.

NER assay

The assay of NER capacity was modified to a cell-based fluorescent assay that evaluates direct binding of an antibody specific for UV-induced 6-4PP (29, 30). Briefly, cells were seeded in a 24-well plate at a density of 100,000 cells per well. Cells were incubated for 4 h with drugs. Cells were irradiated with UV-C (80 J/m2, Stratalinker 1800, Energy mode). Following UV irradiation, cells were incubated with culture medium and collected at 0 h, 2 h, 4 h and 8 h. Immunofluorescent staining (IF) was performed as described in the product protocol (Anti-6-4PP Clone 64M-2 1:500, COSMO BIO). Immunofluorescent images were captured and processed using CellProfiler (31). Mean fluorescence intensity of the level of 6-4PP at 2 h, 4 h or 8 h were normalized to 100% intensity of 6-4PP at 0 h (11). NER capacity at 2 h, 4 h and 8 h were represented as % of 6-4PP removal (100% minus 6-4PP% at 2 h, 4 h and 8 h after UV). For measuring NER in 3D PDOs, organoids were disassociated, and cells were plated overnight as 2D adherent cell culture before 6-4PP assay. NER capacity in PDOs was measured by double immunofluorescence (IF) staining with rabbit anti-cytokeratin 7 (CK7) and mouse anti-6-4PP. Only CK7 positive cells (urothelial cells) were counted for NER capacity (32).

Immunohistochemistry and Immunofluorescence

Sections (5.0 μm) of paraformaldehyde-fixed and paraffin-embedded human bladder tumor specimens, xenograft specimens or PDOs were processed for immunostaining using primary antibodies listed in Supplementary Table S1. Immunohistochemistry (IHC) was processed according to the manufacturer’s instructions of VECTASTAIN Elite ABC kit (Vector Labs) with DAB substrate (Vector Labs). Incubation of IHC-IF slides with a primary antibody was followed by 1.0 h incubation with a secondary antibody labeled with Alexa Fluor 594 or 488 and mounted with DAPI mounting medium. IHC quantification of gene expression was performed using the software Qupath (33).

Small interfering RNA interference and overexpression of ERCC3

ERCC3 small interfering RNA (siRNA) (Thermo Fisher S4796) was used following the manufacturer’s instructions. Non-targeting scrambled negative control siRNA (Thermo Fisher AM4611) was used as a negative control. KU-19-19, HCV29 or Bca0928 cells were transiently transfected with 50 pmol Si-ERCC3 or control siRNA by Lipofectamine RNAiMAX (Thermo Fisher). The transfected cells were collected after 48 h transfection for WB analysis or re-plated into 96-well plates for cell viability assays or into 24-well plates for NER assays. LentiORF human ERCC3 (clone ID: PLOHS_100006334, Cat. No. OHS5897) and LentiORF control (Cat. No. OHS5832) were obtained from Horizon Discovery. Lentivirus particles were produced in HEK293T cells by co-transfection with pMD2.G and psPAX2. Lentivirus particles were used to transfect indicated cells using TransDux™ (System Biosciences) for 48 h. The stable transfected cells were selected by Blasticidin S.

Cell cycle and apoptosis analysis

Cell cycle and apoptosis were analyzed using a Fortessa BD flow cytometry analyzer. After 48 h of drug treatment, cells were processed and stained with Propidium Iodide for cell cycle analysis, as described previously (34). For apoptosis detection, a FITC Annexin V apoptosis detection kit I (BD) was used to identify the apoptotic cells, as indicated in the manufacturer’s protocol. All experiments were performed in triplicate samples.

In vivo Xenograft studies in SCID

All animal procedures were approved by Institutional Animal Care and Use Committee (IACUC) at RPCCC (1395M). For xenograft establishment, 2 ×106 KU-19-19 cells were resuspended in 50% Matrigel/PBS and subcutaneously injected into the right flank of 6–8 weeks old male SCID mice. Tumor nodules were monitored until they reached approximately 50 to 100 mm3. Tumor bearing mice were randomly assigned into different experimental groups:

  1. cisplatin and SP groups: mice received one of four treatment regimens: (a) vehicle; (b) cisplatin (intraperitoneal injection-I.P., 3 mg/kg, twice weekly); (c) SP (oral gavage, 80 mg/kg, 5 weekdays/week); or (d) combination of cisplatin (3 mg/kg) and SP (80 mg/kg).

  2. carboplatin and SP groups: mice received one of four treatments: (a) vehicle; (b) carboplatin (I.P. 50 mg/kg, twice weekly); (c) SP (gavage, 60 mg/kg, daily); or (d) combination of carboplatin (50 mg/kg) and SP (60 mg/kg).

  3. gemcitabine/cisplatin (GC) and SP groups: mice were treated with one of four treatment regimens: (a) vehicle; (b) two cycles of 14-days GC (gemcitabine I.P. 50 mg/kg at day 1, 8 and cisplatin I.P. 2.5 mg/kg at day 2 and 9); (c) two cycles of 14-days GC and SP (gavage, 20 mg/kg, daily); or (d) two cycles of 14-days GC and SP (gavage, 40 mg/kg, daily). The mice treated with vehicle were killed on day 15 due to ulcerated large tumors. There was a 7-day gap period between the first cycle and second cycle to allow emergence of tumor relapse.

After completion of treatment, tumor tissues were removed, weighed, and fixed in 4% paraformaldehyde in PBS and processed for histologic analysis. Sections were stained with hematoxylin and eosin, Ki-67, cleaved caspase-3 and γ-H2AX. Tumors were measured with a caliper in two dimensions and volumes were calculated by the formula V = (Width × Width × Length)/2. All in vivo experiments were repeated at least twice, and one representative experiment was shown.

Statistical analysis

GraphPad Prism 8 program was used to perform all statistical analyses. Results are presented as mean ± standard error (SD). Two-tailed unpaired t-tests with Welch’s correction were used to compare the means of two groups. One-way analysis of variance (ANOVA) with Tukey’s or Dunnett’s multiple comparisons tests were used for more than 2 groups. Cisplatin IC50 concentrations were plotted against NER capacity, with their association determined by the Pearson correlation coefficient. In all tests, significant differences were considered at the values of P < 0.05 (*), P < 0.01 (**), and P < 0.001 (***).

Results

Cisplatin sensitivity correlates with NER capacity in bladder cancer cell lines

To investigate the association between NER and cisplatin sensitivity, we employed a cell-based fluorescent assay for the removal of 6-4PP as a surrogate of NER capacity. First, NER capacity and cisplatin cytotoxicity were measured in KU-19-19 and KE1 cells, an isogenic pair of wild-type (WT) and mutant ERCC2 MIBC cells (8). The NER process indicated by the percentage of 6-4PP removal was accomplished at 4h. Therefore, for studies in all bladder cancer cell lines, NER capacity was defined as % 6-4PP removal (100% minus 6-4PP%) at 4 h. The 6-4PP removal in KE1 cells was significantly lower than that of the parental KU-19-19 cells (18.1% Vs 95.1%) (Fig. 1A and B). Consistent with the observed NER capacity, IC50 concentrations of cisplatin in the KU-19-19 and KE1 cell lines were 1.97 and 0.54 μM, respectively (Fig. 1C). Subsequently, a broad spectrum of cisplatin sensitivities (IC50 values ranging from 0.54 μM to 7.51 μM) was observed for the 9 bladder cancer cell lines. A significant correlation was observed between cisplatin IC50 and NER capacity (6-4PPs removal) at both 2 h (P = 0.002, Fig. 1D) and 4 h (P = 0.045, Fig. 1E) after UV exposure. These data suggest that the removal of 6-4PP by NER may be used as a surrogate to measure NER capacity and that defective NER might represent a mechanism that confers cisplatin sensitivity on bladder cancer cells.

Figure 1.

Figure 1.

Open in a new tab

Cisplatin sensitivity correlated with NER capacity in bladder cancer cell lines. A, Representative IF images of 6-4PP staining shown in NER proficient KU-19-19 and NER deficient KE1 cells. Cells were stained with anti 6-4PP antibody (red) and DAPI (blue). B, Quantitative data of 6-4PP removal at 2 h, 4 h and 8 h in KU-19-19 and KE1 cells. 6-4PP fluorescence intensity at 2, 4 or 8 h were normalized to 100% of 6-4PP at 0 h. Values represent the mean ± SD of 3 replicates. C, Cisplatin sensitivity of KU-19-19 (IC50 = 1.97 μM) and KE1 cells (IC50 = 0.54 μM). Error bars represent the SD of three independent experiments. D and E, Cisplatin IC50 correlated with NER capacity in 9 bladder cancer cell lines. Cisplatin IC50 values were plotted against the % of 6-4PP removal at 2 h (P = 0.002) and 4 h (P = 0.045) after UV irradiation. P value, Pearson correlation.

Figure 4.

Figure 4.

Open in a new tab

Combination of cisplatin and SP enhanced DNA double-strand breaks and apoptosis. A, KU-19-19 cells were treated with DMSO, cisplatin, SP or a combination of both for 24 h. WB analysis of ERCC3, γ-H2AX, pCHK1, pCHK2, cleaved caspase-3 and cleaved PARP were shown. B, KU-19-19 cells were treated with DMSO, carboplatin, SP or a combination of both for 48 h. WB analysis of ERCC3, γ-H2AX, cleaved caspase-3 and cleaved PARP were shown. C, KU-19-19 cells were treated with DMSO, 5 μM cisplatin, 80 μM carboplatin, 40 μM SP, a combination of cisplatin and SP, and a combination of carboplatin and SP for 48 h. Cell-cycle analysis was determined by propidium iodide/RNase flow cytometry. D, KU-19-19 cells were treated with DMSO, 5 μM cisplatin, 80 μM carboplatin, 40 μM SP, a combination of cisplatin and SP, and a combination of carboplatin and SP for 48 h. Apoptosis was evaluated using a flow cytometry assay with Annexin V–propidium iodide staining. The P values were calculated using the one-way ANOVA with Tukey’s multiple comparisons.

ERCC3 is a therapeutic target

Genomic biomarker studies demonstrated that all patients with loss-of-function mutations in ERCC2 responded to NAC, suggesting the genetic vulnerability to chemotherapy of MIBC with a perturbed TFIIH (15, 16). Previously, we and others demonstrated that loss-of-function mutations of ERCC2 were sufficient to confer both NER deficiency and cisplatin sensitivity (8, 20). To understand if inactivation of ERCC3 in bladder cancer has comparable clinical relevance, the protein expression of ERCC3, impact of ERCC3 knockdown on NER activity and cisplatin sensitivity were examined. There was no association between ERCC3 mRNA expression and overall survival in the TCGA cohort (Supplementary Fig. S1). A TMA containing samples of 48 bladder cancer and 8 normal tissues was examined for ERCC3 protein expression. Weak or moderate ERCC3 staining was observed predominantly in the nucleus of normal bladder mucosa, whereas, moderate or strong ERCC3 expression was observed in the nucleus of bladder cancer cells (Fig. 2A and B). In addition, all 9 bladder cancer cell lines displayed constitutive expression of ERCC2 and ERCC3, while heterogeneous protein expression of other NER-related proteins and other TFIIH complex subunits were observed (Fig. 2C). These results indicate intact ERCC3 in MIBC may represent an unexploited “Achilles’ heel” (35) for cancer cells and that loss of NER vis ERCC3 inhibition in malignant bladder cancer cells may confer increased sensitivity to cytotoxic drugs. SiRNA-mediated knockdown of ERCC3 (Fig. 2D) rendered the NER competent KU-19-19 (ERCC2 WT and ERCC3 WT) cells more sensitive to cisplatin (Fig. 2E) and abrogated NER-mediated removal of 6-4PPs (Fig. 2F and G). Moreover, the rescue experiment demonstrated that overexpression of ERCC3 in KU-19-19 ERCC3 knockdown cells (Fig. 2H) reversed cisplatin sensitivity (Fig. 2I). The same results were observed in HCV29 cells (ERCC2 WT and ERCC3 WT) in response to siRNA mediated knockdown of ERCC3 (Supplementary Figs. S2A–S2C). These results suggest ERCC3 might represent a therapeutic target to improve cisplatin resistance in ERCC2 WT patients.

Figure 2.

Figure 2.

Open in a new tab

ERCC3 is a therapeutic target. A, Bladder cancers exhibited higher ERCC3 protein expression than normal bladder tissue. ERCC3 protein expression was quantified in a TMA, including 40 bladder cancer and 8 normal bladder tissues. The P values were calculated using t-test (P < 0.01). B, Representative IHC staining images of ERCC3 in normal and tumor bladder tissues from the TMA. C, Protein expression levels of key NER genes in 9 human bladder cancer cell lines were measured using Western blot (WB) analysis. WB images were cropped to conserve presentation space. D, KU-19-19 cells were transfected with control-siRNA (Si-Ctrl) or ERCC3-siRNA (Si-ERCC3) and incubated for 48 h. Total protein lysates were harvested and the levels of ERCC3 and α-tubulin expression were measured using WB analysis. E, ERCC3 siRNA knockdown increased cisplatin sensitivity compared with Si-Ctrl. Cell viability in Si-Ctrl and Si-ERCC3 cells were measured using CellTiter Glo at 72 h after cisplatin treatment. F, Representative IF images of 6-4PPs in KU-19-19 transfected cells with Si-Ctrl and Si-ERCC3 at 48 h. G, ERCC3 knockdown abrogated NER activity. The average % of 6-4PP removal of KU-19-19 transfected cells with Si-Ctrl or Si-ERCC3 was shown (P < 0.001). H, KU-19-19 cells were transfected with Si-Ctrl, Si-ERCC3, or co-transfected with Si-ERCC3/O.E. Ctrl (Control overexpression) and Si-ERCC3/O.E. ERCC3 (ERCC3 overexpression). Briefly, KU-19-19 cells were transfected with Si-Ctrl, Si-ERCC3 respectively. After 40 h SiRNA transfection, KU-19-19 Si-ERCC3 cells were further transfected with Ctrl or O.E. ERCC3 lentivirus for additional 48 h. Total protein lysates were harvested for WB analysis. I, Cell viability in Si-Ctrl, Si-ERCC3, Si-ERCC3/O.E. Ctrl and Si-ERCC3/O.E. ERCC3 cells were measured using CellTiter Glo at 72 h after cisplatin treatment. ERCC3 overexpression (red) rescued the cisplatin sensitivity in ERCC3 knockdown cells (green).

SP inhibits ERCC3 protein expression and enhances platinum cytotoxicity

DNA repair targeted therapy, including NER inhibitors, has been proposed as a mechanism to increase sensitivity of cancer cells to conventional chemotherapy. However, no NER inhibitors have progressed to clinical evaluation due to the lack of preclinical evaluation. Using the 6-4PP assay as a surrogate for ability to remove cisplatin DNA damage, the efficacy of NER inhibition by 14 DDR inhibitors was examined. SP was the most potent molecule for abrogation of NER capacity (Supplementary Fig. S2D and S2E). SP inhibited ERCC3 protein expression in a dose-dependent manner (Fig. 3A; Supplementary Fig. S2F), and completely inhibited ERCC3 expression within 2 h, but not other NER factors protein (Supplementary Figs. S2G and S2H). Further, SP decreased protein expression levels of other members of the TFIIH complex (ERCC2, CDK7, p62 and p52) after 24 h and 48 h incubation (Fig. 3B). Treatment with SP (20 μM and 40 μM) or DMSO showed no differences in the levels of ERCC3 mRNA (Fig. 3C), suggesting a direct effect of SP on the ERCC3 protein. The addition of MG-132 (a proteasome inhibitor) or PYR-41 (a ubiquitin-activating enzyme inhibitor) was sufficient to preserve ERCC3 protein expression (Fig. 3D; Supplementary Figs. S3A and S3B). These findings suggest that SP inhibits ERCC3 protein expression via ubiquitin-activating enzymes and proteasome protein degradation.

Figure 3.

Figure 3.

Open in a new tab

SP inhibited ERCC3 protein expression and enhanced platinum sensitivity. A, Total protein lysates were collected after a 4 h treatment with DMSO or SP in KU-19-19 cells. ERCC3 and ERCC2 protein expression were measured by WB analysis. B, KU-19-19 cells were treated with DMSO or 40 μM SP. Total protein lysates were collected after 24 and 48 h treatments. WB analysis of TFIIH subunits was shown. C, KU-19-19 cells were treated with DMSO or SP (20 μM and 40 μM) for 4 h. Cells were collected for total RNA extraction. ERCC3 mRNA levels were quantified by RT-qPCR. Values are normalized relative to GAPDH expression. D, KU-19-19 cells were pretreated with 10 μM MG132 or 50 μM PYR-41 for 4 h before addition of DMSO or 40 μM SP for additional 4 h. Total protein lysates were collected and analyzed by WB analysis. E, SP decreased NER capacity in a dose-dependent manner. KU-19-19 cells were pretreated with SP or DMSO for 4 h and subjected to 6-4PP assay. The % of 6-4PP removal was determined at 4 h after UV exposure. F, Combination treatment of SP and cisplatin exhibited significant synergism. KU-19-19 cells were treated with cisplatin, SP or the combination of cisplatin and SP. Cell viability was measured with CellTiter Glo after 72 h treatment. Chou-Talalay combination index (CI) are indicated: CI > 1, antagonism; CI = 1, additive effect; CI < 1, synergism. G, Combination treatment of SP and carboplatin exhibited significant synergism in KU-19-19. Cell viability was measured by CellTiter Glo after 72 h treatment. H, KU-19-19 cells were transfected with O.E. Ctrl or O.E. ERCC3. Transfected cells were treated with DMSO or 20 μM SP for 4 h. Cell lysates were collected for WB analysis. I, KU-19-19 cells with O.E. control or O.E. ERCC3 were pretreated with 20 μM SP or DMSO for 4 h and subjected to the 6–4 PP assay. SP abrogated NER capacity in O.E. Ctrl cells (P < 0.001, t-test), whereas overexpression of ERCC3 completely restored 6–4 PP removal. J, Combination treatment of SP and cisplatin exhibited significant synergism in KU-19-19 cells transfected with O.E. Ctrl. K, Combination treatment of SP and cisplatin exhibited no synergism in KU-19-19 cells transfected with O.E. ERCC3.

Incubation with SP resulted in a dramatic, dose-dependent decrease of NER capacity in KU-19-19 cells (Fig. 3E; Supplementary Fig. S2E). To test for synergistic effects, co-treatment with SP and two platinum-containing chemotherapeutic agents (cisplatin or carboplatin) were tested in two bladder cancer cell lines. Using the Chou and Talalay method for dose response assays, a significant synergism was observed between SP and cisplatin or carboplatin in treatment of KU-19-19 (Fig. 3F and G). The same effect of SP on cisplatin sensitivity and NER capacity was observed in HCV29 cells (Supplementary Figs. S3C and S3D). The synergistic effect of cisplatin and SP was observed for all bladder cancer cell lines (RT112, UMUC3, J82, 5637 and KE1), in addition to KU-19-19 and HCV29 cells (Supplementary Figs. S3E–S3I). Finally, overexpression of ERCC3 in the KU-19-19 cells (Fig. 3H) restored the NER activity that was inhibited by SP (Fig. 3I) and abrogated the synergistic effect of cisplatin and SP (Fig. 3J and (K), suggesting the effect of SP on NER and enhanced cisplatin toxicity is dependent on ERCC3 expression. Taken together, these data indicate that SP inhibited ERCC3 expression, impacted the function of the TFIIH complex, and increased platinum-induced cytotoxicity of human bladder cancer cells.

SP enhances DNA double-strand breakage and apoptosis

The effect of SP on downstream DDR pathways and cell cycle checkpoints was investigated in bladder cancer cells treated with platinum. SP treatment of KU-19-19 cells did not induce DNA double-strand breaks, as indicated by the protein level of γ-H2AX, and did not induce cell apoptosis, as assayed by cleaved caspase-3 and cleaved PARP. Treatment of KU-19-19 cells with cisplatin or with carboplatin alone induced a modest increase in γ-H2AX levels suggestive of the presence of double strand breaks. Co-treatment with either cisplatin or carboplatin with SP potentiated DNA damage and triggered apoptosis as indicated by increased expression of γ-H2AX, cleaved PARP and cleaved caspase 3 (Fig. 4A and B). Similar effects were observed in HCV29 cells (Supplementary Fig. S4A). While cisplatin alone triggered the DNA damage checkpoints, co-treatment of SP and cisplatin markedly reduced CHK1/2 phosphorylation compared to cisplatin alone (Fig. 4A). These data are consistent with the notion that reduced activation of the DNA damage checkpoint by reduced phosphorylation of CHK1/2 augments the killing effect of cisplatin.

To investigate the impact of SP on activation of the DDR pathway after cisplatin treatment, cell cycle analysis and apoptosis assay were performed using the Propidium Iodide and Annexin V assay. Analyses in KU-19-19 cells treated only with SP showed no significant change in the fraction of cells with a sub-G1 phase or the percentage of apoptotic cells. Co-treatment with SP and cisplatin caused a significant reduction in the fraction of cells in the G2/M phase of the cell cycle (8.5% vs 71.1%, P < 0.001) and an increased fraction of cells with a sub-G1 phase DNA content (19.3% vs 4.1%, P < 0.001, Fig. 4C) compared to cisplatin treatment alone. Treatment with SP in combination with cisplatin for 48 hours resulted in more apoptotic cells (65.3% vs 12.8% P < 0.001, Fig. 4D) than cisplatin treatment alone. Similarly, SP combined with carboplatin resulted in more cells with a sub-G1 phase DNA content (14.7% vs 9.0%, P < 0.001, Fig. 4C) and apoptosis (52.8% vs 13.3% P < 0.001, Fig. 4D) than treatment with carboplatin alone. Representative Annexin V/PI data for apoptosis in KU-19-19 and HCV29 cells is shown in Supplementary Fig. S4B–S4D. Taken together, these results suggest that SP enhances cisplatin and carboplatin cytotoxicity by inducing more DNA damage and more apoptosis in bladder cancer cell lines.

SP enhances chemotherapy response to platinum in mice

The synergistic effect of SP on both cisplatin and carboplatin sensitivity was investigated using an in vivo xenograft model. Co-treatment with SP and cisplatin significantly decreased tumor growth (Fig. 5A) compared to treatment with either drug alone (P < 0.001). Similarly, co-treatment with SP and carboplatin significantly impaired tumor growth (Fig. 5B) compared with SP or carboplatin treated alone (P < 0.05). Endpoint studies in tumors harvested after treatment included cell proliferation (Ki-67), DNA damage (γ-H2AX) and apoptosis (cleaved caspase-3). In tumors from mice co-treated with SP and cisplatin, a significant reduction in proliferation (Ki-67+ cells, P < 0.001) was observed, and this was accompanied by increased DNA damage (γ-H2AX+ cells, P < 0.001) and apoptosis (cleaved caspase-3+ cells, P < 0.01), compared to tumors treated with cisplatin or SP alone (Fig. 5C). Co-treatment with SP and cisplatin significantly decreased tumor weight (Supplementary Figs. S5A and S5B). Co-treatment with SP and carboplatin significantly decreased tumor weight (Supplementary Figs. S5C and S5D). Importantly, SP treatment in combination did not induce significant weight loss compared to weight loss observed in mice treated with cisplatin or carboplatin treatment alone (Supplementary Figs. S5E and S5F). Similarly, significant reductions in proliferation (P < 0.001) and increases in apoptosis (P < 0.001) were also observed in the SP plus carboplatin co-treatment group compared with tumors treated with carboplatin or SP alone (Supplementary Fig. S5G). Collectively, these data support SP as a promising therapeutic addition for use in combination with cisplatin or carboplatin for MIBC patients, potentially without additional systemic toxicity as indicated by weight change.

Figure 5.

Figure 5.

Open in a new tab

SP enhanced tumor cell response to platinum in mice. A, Co-treatment with SP and cisplatin significantly decreased tumor growth (P < 0.001). Tumor volume changes [means with SD (error bars)] were shown for mice treated with vehicle (corn oil), 3 mg/kg cisplatin twice a week, 80 mg/kg SP daily by oral gavage, and a combination treatment group (n = 5). B, Co-treatment with SP and carboplatin decreased tumor growth (P < 0.05). Tumor volume changes in mice treated with vehicle (corn oil), 50 mg/kg carboplatin I.P. (twice a week), 60 mg/kg SP daily by oral gavage and a combination treatment group (n = 5). C, Representative immunohistochemistry images and quantification of Ki-67, cleaved caspase-3 and γ-H2AX were shown from mice treated with vehicle, cisplatin, SP and a combination of both. Results are presented as mean ± SD for at least three random fields of view for three different mice. D, SP combined with GC impaired tumor growth significantly (P < 0.001). Tumor volume changes in mice treated with vehicle (corn oil), 2.5 mg/kg cisplatin + 50 mg/kg gemcitabine (GC) and a combination of 20 or 40 mg/kg SP and GC (n = 6). Gemcitabine was given on day 1 and day 8, and cisplatin was injected at days 2 and 9 in a 14-day GC cycle.

To recapitulate the clinical regimen of MIBC patients, the multi-drug regimen of GC was tested over two treatment cycles with or without SP. During the first 14-day cycle of chemotherapy, KU-19-19 xenografts were completely responsive (no tumor growth) to chemotherapy (GC) or combination therapy (GC and SP). However, chemoresistance developed progressively after completion of the first chemotherapy cycle. After the second cycle of chemotherapy, the SP combination treatment (SP plus GC) demonstrated significantly impaired tumor growth (P < 0.001, Fig. 5D) and decreased tumor weight (Supplementary Figs. S5H and S5I) compared to treatment with GC alone. GC+SP treatment did not induce significant weight loss compared to weight loss observed in mice treated with GC alone (Supplementary Fig. S5J). Therefore, these data suggest that SP can be re-purposed and added to the established GC clinical regimen as an oral medication to render MIBC patients more sensitive to platinum chemotherapy.

Measure and target NER in patient-derived organoids

To determine the clinical relevance of NER to the response of bladder cancers to platinum treatment, the effect of SP on NER was measured in bladder cancer PDOs. High inter-patient heterogeneity was observed in bladder specimens from individual patients since the ratio of tumor cells (% of CK7 positive cells) ranged from 0–93% (Supplementary Fig. S6A). We established 4 stable organoids (PDO) (>= passage 5 with 76–100% CK7 positive cells) from four independent patients. SP significantly decreased NER (6-4PP removal) in all 4 established PDOs (P < 0.001, Fig. 6A). The effect of inhibition of NER capacity was observed in both a basal-like PDO (Bca0928 CK8 negative and p63 positive) and a luminal-like PDO (Bca0801, CK8 positive, p63 negative) (Supplementary Fig. S6B). SP in combination with cisplatin also induced more cell death than cisplatin alone in these two PDOs (P <0.001, Fig. 6B). Consistent with results in KU-19-19 cells, siRNA-mediated knockdown of ERCC3 sensitized Bca0928 cells to cisplatin (Supplementary Figs. S6C), and SP inhibited ERCC3 expression and increased cisplatin-induced DNA damage (γ-H2AX) and cell apoptosis (cleaved caspase-3) (Fig. 6C and D; Supplementary Figs. S6D and S6E). These data suggest the proposed combination of SP and standard chemotherapy may be effective in these tested patients and that SP may be re-purposed to enhance chemotherapy response. Moreover, we also observed synergism effects of SP and clinical chemotherapies for human bladder cancer (gemcitabine, mitomycin, docetaxel, and etoposide) in KU-19-19, HCV29 and 5637 cells (Supplementary Fig. S7). Hence, SP could be a potential sensitizer for current chemotherapy drugs that are available for bladder cancer patients.

Figure 6.

Figure 6.

Open in a new tab

Combination of cisplatin and SP induced more cell death in patient-derived organoid models. A, SP significantly decreased the NER capacity in 4 PDOs. Four PDOs were pre-treated with SP for 4 h. The adherent cells were irradiated UV 80 J/m2 and double-stained for 6-4PP (red) and CK7 (green). The NER capacity was measured by % of 6-4PP removal at 4 h in CK7 positive cells only. B, SP enhanced cisplatin cytotoxicity in two PDOs. Bca0928 and Bca0801 organoid cells were plated and treated with DMSO, cisplatin, SP or cisplatin/SP for 7 days. CellTiter Glo assay was used to measure cell viability. Mean cell viability and standard error were shown. C, Bca0928 cells were treated with DMSO, cisplatin, SP or cisplatin/SP for 48 h. WB analysis of ERCC3, γ-H2AX, cleaved caspase-3, cleaved PARP and GAPDH were shown. D, Bca0928 PDOs were treated with DMSO, 20 μM cisplatin, 20 μM SP or a combination for 48 h. The PDOs were processed for IHC staining of Ki-67, cleaved caspase-3 and γ-H2AX. Quantification of IHC staining with Ki-67 (Left), cleaved caspase-3 (Medium) and γ-H2AX (Right) were shown.

Discussion

The functional role and clinical value of targeting components of the NER pathway in bladder cancer has not been fully characterized. In this study, ERCC3 was found to be constitutively expressed in bladder cancer cells and genetic knock-down of ERCC3 was sufficient to confer an enhanced response to platinum-based chemotherapy. SP inhibited ERCC3 protein expression, abrogated NER capacity and increased DNA damage and apoptosis caused by cisplatin in bladder cancer cell lines. Further, overexpression of ERCC3 abrogated the effect of SP on NER and the synergy effect with cisplatin. We provide strong preclinical experimental evidence that NER capacity can be measured in individual MIBC patients, and that SP can be re-purposed as a NER inhibitor and added to the current standard-of-care chemotherapy regimens.

Cisplatin binds covalently to DNA resulting in about 90% intra-strand crosslinks and < 10% inter-strand crosslinks (36). The principal mechanism for repair of cisplatin-induced DNA adducts is the process of NER (6). However, due to variations in chemotherapy sensitivity in bladder cancer patients, treatment of all patients with NAC could result in 60–70% of patients (non-responders) being exposed to toxic chemotherapy without clinical benefit (4). Currently, no functional assay is available to measure NER capacity in individual patients. Researchers have developed a variety of assays to measure NER capacity, such as the 6-4PPs assays (37, 38), and fluorescence microscopy-based assays for Damage specific DNA Binding protein 2 (DDB2) (8, 39). In humans, NER is the only pathway for the removal of 6-4PPs (37, 38). The 6-4PP removal was chosen because it directly monitors the NER process. The 6-4PP can be easily employed to both cell line and fresh bladder specimens. The significant correlation between NER capacity and cisplatin sensitivity (Fig. 1D and E) suggests that defective NER can be measured using the ex vivo NER assay and may represent a surrogate biomarker of NER in clinical trials for patients who are undergoing chemotherapy.

Recent studies identified that MIBC patients with loss-of-function mutations in ERCC2 responded to NAC (15, 16), suggesting vulnerability to chemotherapy was causally associated with a defective “Achilles’ heel” (TFIIH) (35). ERCC2 and ERCC3 work together to accomplish essential steps of NER. Thus, we hypothesized that inhibition/loss of ERCC3 function may lead to similar defects in NER as loss of ERCC2 function. As expected, we found siRNA-mediated knockdown of ERCC3 abrogated NER capacity and rendered NER-proficient KU-19-19 cells more sensitive to cisplatin (Fig. 2D and E). Consistent with our findings, other studies showed genetic inhibition, either siRNA knockdown of ERCC3 in multiple myeloma cells (11) or CRISPR/Cas9-mutated ERCC3 in breast cell lines (40) and led to enhanced sensitivity to DNA-damaging agents. Taken together, ERCC3 appears to be a promising therapeutic target in MIBCs.

Pharmacological inhibition of specific DNA repair proteins by small molecules offers a valuable tool to induce “chemical-based synthetic lethality” and overcome chemotherapy resistance (41, 42). However, no NER inhibitors have demonstrated clinical utility or progressed to pre-clinical evaluation as a means to increase sensitivity to cisplatin therapy (13, 43). Among publicly available NER/helicase inhibitors, we found SP to be the most potent NER inhibitor using an in vitro 6-4PP assay (Supplementary Fig. S2D). SP down-regulated ERCC3 protein expression and impacted levels of several TFIIH proteins and abrogated NER capacity in KU-19-19 and HCV29 cells. Further, a significant synergism was observed between SP and cisplatin/carboplatin both in vitro (Fig. 3F and G) and in vivo (Fig. 5A and B). Further optimization of SP dosage/interval in combination of cisplatin at different dosages may improve the in vivo efficacy of SP in combination with cisplatin-based chemotherapy. SP is an FDA-approved drug used for hypertension, heart failure, acne, excessive hair growth and primary hyper-aldosteronism. SP is given orally in doses of 25–400 mg daily depending on indication (400 mg/day in patients with primary hyper-aldosteronism) (44). The in vivo oral dose of 40 mg/kg of SP in mice is equivalent to a dose of 200mg/day in humans, assuming biological equivalency (45). Taken together, these findings suggest the efficacy of re-purposing SP as an anti-tumor NER inhibitor since the therapeutic range of dosage is within those approved by the FDA for other indications. To determine the safety and efficacy of co-treatment with SP and platinum-based drugs, we plan to launch a phase I/II trial that adds SP to current chemotherapy regimens (GC) for treatment of MIBC patients. A dose escalation schedule can be utilized to increase SP dose from 100 mg/daily to 200 mg/daily.

Despite emerging evidence suggesting that genetic or molecular characteristics can identify patients likely to benefit from NAC, no predictive molecular biomarkers have shown clinical utility in bladder cancer (46). PDOs represent a relevant model for ex vivo modeling of the treatment response of bladder cancer (26). Importantly, PDOs can be selected that maintain the mutational profile present in the primary bladder tumor and/or that retain tumor heterogeneity (26). In this study, the synergic effect of SP and cisplatin was confirmed in our PDO models and combining SP with cisplatin synergistically increased DNA damage and apoptosis (Fig. 6C and D). Therefore, PDOs appear to be a useful model for functional assessment of NER capacity and treatment response in individual patients.

In summary, the present study measures NER capacity in MIBC cell lines and PDOs from individual patients and validates that SP, an FDA-approved small molecule drug, improves platinum-based chemotherapy responses in pre-clinical models. Re-purposing old drugs for new applications saves time and costs. SP could be re-purposed rapidly for cancer treatment due to the known pharmacological characteristics and side-effect profile. Further clinical trials are warranted to determine the safety and efficacy of SP in combination with conventional chemotherapy regimens.

Supplementary Material

1

Acknowledgments

This research work was sponsored in part by NIH Grants, K08CA252161 (PI: Li), P30CA016056 (NCI Cancer Center Core Support Grant), Roswell Park Alliance Foundation (PI: Li), and Friends of Urology Foundation (PI: Li). We thank Marisa Blask for editorial proofreading of the manuscript. We thank Drs. David Solit and Dharmesh Gopalakrishnan for reviewing the manuscript and comments.

Footnotes

Authors’ Disclosures

No disclosures were reported by all authors.

The authors declare no potential conflicts of interest

References

  • 1.Advanced Bladder Cancer Meta-analysis Collaboration. Neoadjuvant chemotherapy in invasive bladder cancer: update of a systematic review and meta-analysis of individual patient data advanced bladder cancer (ABC) meta-analysis collaboration. Eur Urol 2005;48:202–5; discussion 205–6. [DOI] [PubMed] [Google Scholar]
  • 2.Grossman HB, Natale RB, Tangen CM, Speights VO, Vogelzang NJ, Trump DL, et al. Neoadjuvant chemotherapy plus cystectomy compared with cystectomy alone for locally advanced bladder cancer. N Engl J Med 2003;349:859–66. [DOI] [PubMed] [Google Scholar]
  • 3.Von der Maase H, Hansen SW, Roberts JT, Dogliotti L, Oliver T, Moore MJ, et al. Gemcitabine and cisplatin versus methotrexate, vinblastine, doxorubicin, and cisplatin in advanced or metastatic bladder cancer: results of a large, randomized, multinational, multicenter, phase III study. J Clin Oncol 2000;18:3068–77. [DOI] [PubMed] [Google Scholar]
  • 4.Hermans TJN, Voskuilen CS, van der Heijden MS, Schmitz-Drager BJ, Kassouf W, Seiler R, et al. Neoadjuvant treatment for muscle-invasive bladder cancer: The past, the present, and the future. Urol Oncol 2018;36:413–22. [DOI] [PubMed] [Google Scholar]
  • 5.Basu A, Krishnamurthy S. Cellular responses to cisplatin-induced DNA damage. J Nucleic Acids 2010;2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kelland L The resurgence of platinum-based cancer chemotherapy. Nat Rev Cancer 2007;7:573–84. [DOI] [PubMed] [Google Scholar]
  • 7.Knijnenburg TA, Wang L, Zimmermann MT, Chambwe N, Gao GF, Cherniack AD, et al. Genomic and molecular landscape of DNA damage repair deficiency across The Cancer Genome Atlas. Cell Rep 2018;23:239–54 e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Li Q, Damish AW, Frazier Z, Liu D, Reznichenko E, Kamburov A, et al. ERCC2 helicase domain mutations confer nucleotide excision repair deficiency and drive cisplatin sensitivity in muscle-invasive bladder cancer. Clin Cancer Res 2019;25:977–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kim J, Mouw KW, Polak P, Braunstein LZ, Kamburov A, Kwiatkowski DJ, et al. Somatic ERCC2 mutations are associated with a distinct genomic signature in urothelial tumors. Nat Genet 2016;48:600–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Selvakumaran M, Pisarcik DA, Bao R, Yeung AT, Hamilton TC. Enhanced cisplatin cytotoxicity by disturbing the nucleotide excision repair pathway in ovarian cancer cell lines. Cancer Res 2003;63:1311–16. [PubMed] [Google Scholar]
  • 11.Szalat R, Samur MK, Fulciniti M, Lopez M, Nanjappa P, Cleynen A, et al. Nucleotide excision repair is a potential therapeutic target in multiple myeloma. Leukemia 2018;32:111–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Olaussen KA, Dunant A, Fouret P, Brambilla E, Andre F, Haddad V, et al. DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy. N Engl J Med 2006;355:983–91. [DOI] [PubMed] [Google Scholar]
  • 13.Cancer Genome Atlas Research Network. Comprehensive molecular characterization of urothelial bladder carcinoma. Nature 2014;507:315–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Abbosh PH, Plimack ER. Molecular and clinical insights into the role and significance of mutated DNA repair genes in bladder cancer. Bladder Cancer 2018;4:9–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Pietzak EJ, Zabor EC, Bagrodia A, Armenia J, Hu W, Zehir A, et al. Genomic differences between “primary” and “secondary” muscle-invasive bladder cancer as a basis for disparate outcomes to cisplatin-based neoadjuvant chemotherapy. Eur Urol 2019;75:231–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Van Allen EM, Mouw KW, Kim P, Iyer G, Wagle N, Al-Ahmadie H, et al. Somatic ERCC2 mutations correlate with cisplatin sensitivity in muscle-invasive urothelial carcinoma. Cancer Discov 2014;4:1140–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Grivas P DNA damage response gene alterations in urothelial cancer: Ready for practice? Clin Cancer Res 2019;25:907–9. [DOI] [PubMed] [Google Scholar]
  • 18.Gavande NS, VanderVere-Carozza PS, Hinshaw HD, Jalal SI, Sears CR, Pawelczak KS, et al. DNA repair targeted therapy: The past or future of cancer treatment? Pharmacol Ther 2016;160:65–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zurita M, Cruz-Becerra G. TFIIH: New discoveries regarding its mechanisms and impact on cancer treatment. J Cancer 2016;7:2258–2265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang G, Guan Y, Zhao Y, van der Straaten T, Xiao S, Xue P, et al. ERCC2/XPD Lys751Gln alter DNA repair efficiency of platinum-induced DNA damage through P53 pathway. Chem Biol Interact 2017;263:55–65. [DOI] [PubMed] [Google Scholar]
  • 21.Compe E, Egly JM. Nucleotide excision repair and transcriptional regulation: TFIIH and beyond. Annu Rev Biochem 2016;85:265–290. [DOI] [PubMed] [Google Scholar]
  • 22.Marteijn JA, Lans H, Vermeulen W, Hoeijmakers JH. Understanding nucleotide excision repair and its roles in cancer and ageing. Nat Rev Mol Cell Biol 2014;15:465–481. [DOI] [PubMed] [Google Scholar]
  • 23.Gabbard RD, Hoopes RR, Kemp MG. Spironolactone and XPB: an old drug with a new molecular target. Biomolecules 2020;10:756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Alekseev S, Ayadi M, Brino L, Egly JM, Larsen AK, Coin F. A small molecule screen identifies an inhibitor of DNA repair inducing the degradation of TFIIH and the chemosensitization of tumor cells to platinum. Chem Biol 2014;21:398–407. [DOI] [PubMed] [Google Scholar]
  • 25.Shahar OD, Kalousi A, Eini L, Fisher B, Weiss A, Darr J, et al. A high-throughput chemical screen with FDA approved drugs reveals that the antihypertensive drug Spironolactone impairs cancer cell survival by inhibiting homology directed repair. Nucleic Acids Res 2014;42:5689–701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lee SH, Hu W, Matulay JT, Silva MV, Owczarek TB, Kim K, et al. Tumor evolution and drug response in patient-derived organoid models of bladder cancer. Cell 2018;173:515–28 e17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Xu B, Thong N, Tan D, Khoury T. Expression of thyroid transcription factor-1 in colorectal carcinoma. Appl Immunohistochem Mol Morphol 2010;18:244–9. [DOI] [PubMed] [Google Scholar]
  • 28.Chou TC. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol Rev 2006;58:621–81. [DOI] [PubMed] [Google Scholar]
  • 29.Choi JY, Park JM, Yi JM, Leem SH, Kang TH. Enhanced nucleotide excision repair capacity in lung cancer cells by preconditioning with DNA-damaging agents. Oncotarget 2015;6:22575–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kuschal C, DiGiovanna JJ, Khan SG, Gatti RA, Kraemer KH. Repair of UV photolesions in xeroderma pigmentosum group C cells induced by translational readthrough of premature termination codons. Proc Natl Acad Sci U S A 2013;110:19483–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Carpenter AE, Jones TR, Lamprecht MR, Clarke C, Kang IH, Friman O, et al. CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome Biol 2006;7:R100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Tumiati M, Hietanen S, Hynninen J, Pietila E, Farkkila A, Kaipio K, et al. A functional homologous recombination assay predicts primary chemotherapy response and long-term survival in ovarian cancer patients. Clin Cancer Res 2018;24:4482–93. [DOI] [PubMed] [Google Scholar]
  • 33.Bankhead P, Loughrey MB, Fernandez JA, Dombrowski Y, McArt DG, Dunne PD, et al. QuPath: Open source software for digital pathology image analysis. Sci Rep 2017;7:16878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Zhu H Propidium Iodide Staining of Cells for FACS Analysis. Bio-protocol 2012;2:e195. [Google Scholar]
  • 35.Berico P, Coin F. Is TFIIH the new Achilles heel of cancer cells? Transcription 2018;9:47–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Belanger F, Rajotte V, Drobetsky EA. A majority of human melanoma cell lines exhibits an S phase-specific defect in excision of UV-induced DNA photoproducts. PLoS One 2014;9:e85294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Rouget R, Auclair Y, Loignon M, Affar el B, Drobetsky EA. A sensitive flow cytometry-based nucleotide excision repair assay unexpectedly reveals that mitogen-activated protein kinase signaling does not regulate the removal of UV-induced DNA damage in human cells. J Biol Chem 2008;283:5533–41. [DOI] [PubMed] [Google Scholar]
  • 38.Plimack ER, Dunbrack RL, Brennan TA, Andrake MD, Zhou Y, Serebriiskii IG, et al. Defects in DNA repair genes predict response to neoadjuvant cisplatin-based chemotherapy in muscle-invasive bladder cancer. Eur Urol 2015;68:959–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Dreze M, Calkins AS, Galicza J, Echelman DJ, Schnorenberg MR, Fell GL, et al. Monitoring repair of UV-induced 6–4-photoproducts with a purified DDB2 protein complex. PLoS One 2014;9:e85896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Vijai J, Topka S, Villano D, Ravichandran V, Maxwell KN, Maria A, et al. A Recurrent ERCC3 Truncating Mutation Confers Moderate Risk for Breast Cancer. Cancer Discov 2016;6:1267–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Hengel SR, Spies MA, Spies M. Small-molecule inhibitors targeting DNA repair and DNA repair deficiency in research and cancer therapy. Cell Chem Biol 2017;24:1101–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Datta A, Brosh RM, Jr. New insights into DNA helicases as druggable targets for cancer therapy. Front Mol Biosci 2018;5:59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Nickoloff JA, Jones D, Lee SH, Williamson EA, Hromas R. Drugging the cancers addicted to DNA repair. J Natl Cancer Inst 2017;109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Karagiannis A, Tziomalos K, Papageorgiou A, Kakafika AI, Pagourelias ED, Anagnostis P, et al. Spironolactone versus eplerenone for the treatment of idiopathic hyperaldosteronism. Expert Opin Pharmacother 2008;9:509–15. [DOI] [PubMed] [Google Scholar]
  • 45.Nair AB, Jacob S. A simple practice guide for dose conversion between animals and human. J Basic Clin Pharm 2016;7:27–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Buttigliero C, Tucci M, Vignani F, Scagliotti GV, Di Maio M. Molecular biomarkers to predict response to neoadjuvant chemotherapy for bladder cancer. Cancer Treat Rev 2017;54:1–9. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1783716-supplement-1.pdf (1.4MB, pdf)

RESOURCES