Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2022 Apr 18;88(9):e02497-21. doi: 10.1128/aem.02497-21

Structural and Functional Insights into a Nonheme Iron- and α-Ketoglutarate-Dependent Halogenase That Catalyzes Chlorination of Nucleotide Substrates

Longhai Dai a,#, Xiao Zhang a,#, Yumei Hu a,#, Jing Shen b, Qi Zhang b, Lilan Zhang a, Jian Min a, Chun-Chi Chen a, Yingle Liu b,✉, Jian-Wen Huang a,✉, Rey-Ting Guo a,✉
Editor: Haruyuki Atomic
PMCID: PMC9088281  PMID: 35435717

ABSTRACT

Nonheme iron- and α-ketoglutarate (αKG)-dependent halogenases (NHFeHals), which catalyze the regio- and stereoselective halogenation of the unactivated C(sp3)-H bonds, exhibit tremendous potential in the challenging asymmetric halogenation. AdeV from Actinomadura sp. ATCC 39365 is the first identified carrier protein-free NHFeHal that catalyzes the chlorination of nucleotide 2′-deoxyadenosine-5′-monophosphate (2′-dAMP) to afford 2′-chloro-2′-deoxyadenosine-5′-monophosphate. Here, we determined the complex crystal structures of AdeV/FeII/Cl and AdeV/FeII/Cl/αKG at resolutions of 1.76 and 1.74 Å, respectively. AdeV possesses a typical β-sandwich topology with H194, H252, αKG, chloride, and one water molecule coordinating FeII in the active site. Molecular docking, mutagenesis, and biochemical analyses reveal that the hydrophobic interactions and hydrogen bond network between the substrate-binding pocket and the adenine, deoxyribose, and phosphate moieties of 2′-dAMP are essential for substrate recognition. Residues H111, R177, and H192 might play important roles in the second-sphere interactions that control reaction partitioning. This study provides valuable insights into the catalytic selectivity of AdeV and will facilitate the rational engineering of AdeV and other NHFeHals for synthesis of halogenated nucleotides.

IMPORTANCE Halogenated nucleotides are a group of important antibiotics and are clinically used as antiviral and anticancer drugs. AdeV is the first carrier protein-independent nonheme iron- and α-ketoglutarate (αKG)-dependent halogenase (NHFeHal) that can selectively halogenate nucleotides and exhibits restricted substrate specificity toward several 2′-dAMP analogues. Here, we determined the complex crystal structures of AdeV/FeII/Cl and AdeV/FeII/Cl/αKG. Molecular docking, mutagenesis, and biochemical analyses provide important insights into the catalytic selectivity of AdeV. This study will facilitate the rational engineering of AdeV and other carrier protein-independent NHFeHals for synthesis of halogenated nucleotides.

KEYWORDS: nonheme iron- and α-ketoglutarate-dependent halogenase, halogenated nucleotide, crystal structure, catalytic mechanism

INTRODUCTION

Organohalogen compounds are ubiquitous in nature and play a vital role in chemical, agrochemical, and pharmaceutical industries (1, 2). Around 50% of top-marketed pharmaceutical drugs and a staggering 96% of agrochemicals produced since 2010 contain covalently attached halogen atoms (3, 4). The selective installation of halogen atoms onto small molecules can profoundly modulate their bioactivity and pharmacokinetics (5). Furthermore, C-H group functionalization via halogenation is of particular importance for selective chemical modification in metal-catalyzed cross-coupling reactions (6). Chemical halogenation is challenging and encounters numerous disadvantages such as poor regio- and stereoselectivities and the use of toxic and harmful chemicals (7). Conversely, halogenase-mediated halogenation utilizes simple salts as the halide source and can readily halogenate substrates at mild conditions with excellent regio- and stereoselectivities, endowing them with tremendous potential applications in synthetic biology and synthetic chemistry (8).

A considerable number of halogenases have been identified from all kingdoms of life (9). These halogenases can be broadly classified into three groups based on catalytic mechanisms, which include (i) the electrophilic halogenation mechanism exemplified by the most common heme- or vanadium-dependent haloperoxidases (HPOs) and flavin-dependent halogenases (FDHs) (10–12); (ii) the nucleophilic halogenation mechanism exemplified by the most rare S-adenosyl-l-methionine (SAM)-dependent halogenases (13, 14); (3) the radical halogenation mechanism exemplified by the latest identified nonheme iron- and α-ketoglutarate (αKG)-dependent halogenases (NHFeHals) (5). Aliphatic small molecules containing the inert sp3 hybridized carbons are ubiquitous in nature, thus highlighting the importance of regio- and stereocontrolled halogenation in aliphatic halide synthesis (15–17). The HPOs and FDHs generally exhibit poor stereoselectivity and are limited to halogenate electron-rich aromatic and heteroaromatic compounds (18, 19), while the NHFeHals generate a high-energy FeIV-oxo species to radically halogenate the unactivated sp3 carbon centers with exquisite regio- and stereoselectivities (20). Thus, NHFeHals exhibit tremendous potential in asymmetric halogenation of aliphatic compounds. The initially identified NHFeHals only recognize substrates tethered to a peptidyl carrier protein (PCP) or an acyl carrier protein (ACP), which greatly limits their applications in halogen chemistry (21–23). Only recently, several freestanding NHFeHals such as WelO5, BesD, AmbO5, and SaDAH were identified (24–27). These enzymes can directly halogenate the carrier protein-free aliphatic substrates, thus providing a new opportunity for aliphatic halide synthesis and the C-H group functionalization.

Halogenated nucleotides are a group of important antibiotics and clinically used as antiviral and anticancer drugs (28). Most of these compounds are chemically synthesized, and only a few naturally occurring halogenated nucleotides have been isolated from microorganisms (28–30). Recently, a freestanding NHFeHal from Actinomadura sp. ATCC 39365 (AdeV) involved in the biosynthesis of adechlorin (an approved antileukemia drug) was identified (31). AdeV catalyzes the FeII-, Cl-, αKG-, and O2-dependent chlorination of the carrier protein-free 2′-deoxyadenosine-5′-monophosphate (2′-dAMP) to afford 2′-chloro-2′-deoxyadenosine-5′-monophosphate (2′-Cl-2′-dAMP), a key intermediate in the biosynthetic pathway of adechlorin (Fig. 1A). AdeV is the first NHFeHal that can catalyze selective halogenation on nucleotides and exhibits restricted substrate specificity toward several 2′-dAMP analogues (31). To better understand the catalytic mechanism of AdeV, the complex crystal structures of AdeV/FeII/Cl and AdeV/FeII/Cl/αKG were solved. In addition, the molecular mechanism for the interactions between AdeV and 2′-dAMP and its analogues was clarified by molecular docking, mutagenesis, and biochemical analyses.

FIG 1.

FIG 1

Open in a new tab

Biofunction and crystal structures of AdeV/FeII/Cl and AdeV/FeII/Cl/αKG. (A) AdeV catalyzes the FeII-, Cl-, αKG-, and O2-dependent chlorination of 2′-dAMP to afford 2′-Cl-2′-dAMP, a key intermediate in the biosynthetic pathway of adechlorin. (B) Overall structure of AdeV in complex with FeII, Cl, and αKG. The electron density map between N93 and V103 is missing and indicated as a black dotted curve. (C) Superimposing crystal structures of AdeV/FeII/Cl and AdeV/FeII/Cl/αKG. (D) Surface representation of AdeV. The predicted substrate-binding pocket and substrate-covering lid are indicated by dashed magenta and green lines, respectively. (E) 2Fo−Fc electron map of the AdeV catalytic center. H194, H252, Cl (orange sphere), water molecule (W, marine sphere), and αKG coordinate FeII (red sphere). The electron map contoured to 2.0 σ is shown in gray mesh. Hydrogen-bonding interactions (distances < 3.5 Å) between αKG and R177, Y181, R265, and S267 are indicated with dash lines. The amino acids are presented as thick stick.

RESULTS AND DISCUSSION

Crystal structure of AdeV in complex with different ligands.

The complex crystal structures of AdeV/FeII/Cl and AdeV/FeII/Cl/αKG were solved by Hg-derivative crystals, and refined at a resolution of 1.76 and 1.74 Å, respectively (see Table S1 in the supplemental material). Both of the complexes crystallize in space group P212121 with one molecule in an asymmetric unit. AdeV should exist as a monomer as no oligomerization counterpart can be identified from symmetric mates, which is in line with the gel filtration chromatography analysis that measures the protein molecular mass in solution to 33 kDa (Fig. S1). AdeV possesses a β-sandwich topology (Fig. 1B), which is characteristic of the FeII/αKG-dependent cupin superfamily that catalyzes a group of important reactions, such as halogenation, hydroxylation, and olefin epoxidation (32). Superimposition of the structures of AdeV/FeII/Cl and AdeV/FeII/Cl/αKG yields an alpha carbon (C-α) root mean square deviation (RMSD) value of 0.181 Å, indicating that these two structures are virtually identical (Fig. 1C). Thus, the AdeV/FeII/Cl/αKG complex was used for further analysis in this study. The proposed substrate-binding pocket is a long and narrow hydrophilic tunnel (Fig. 1D), in keeping with accommodating 2′-dAMP and its analogues. A single FeII situates in the putative active site and coordinates two residues (H194 and H252), one αKG, one chloride, and one water molecule in an octahedral geometry (Fig. 1E). This coordination geometry is unique among the NHFeHals, while the coordination site occupied by the halide in NHFeHals is filled by residue Asp/Glu from the HXD/E motif in nonheme iron- and αKG-dependent oxygenases (32, 33). αKG coordinates FeII in a bidentate mode, with its C-1 carboxylate opposite residue H252 and C-2 ketone opposite the chloride (Fig. 1E). In addition, αKG anchors to the active site by hydrogen bonds between its C-1 carboxylate and R177 as well as between C-5 carboxylate and Y181, R265, and S267 (Fig. 1E). R177, Y181, and R265 are considerably conserved in the FeII/αKG-dependent oxygenases, which should help orient αKG (24, 25, 28).

Notably, the characteristic HXG/A motif of NHFeHals is observed in AdeV (Fig. 2). Residue G/A in the HXG/A motif plays an important role in the halogenation activity NHFeHals, which creates space for the halide to coordinate FeII (32). Replacing HXG/A motif by HXD/E motif that presents in the larger and more well-studied nonheme iron- and αKG-dependent hydroxylases could abolish the halogenation activity of NHFeHals (24, 32). Likewise, mutating HXD/E motif in nonheme iron- and αKG-dependent hydroxylases to HXG/A motif could render the enzymes halogenation activity (34, 35). A DALI server search reveals that AdeV is structurally more similar to the nonheme iron- and αKG-dependent hydroxylases than to the recently identified NHFeHals (Table S2). In addition, AdeV displays low sequence identity with other NHFeHals and nonheme iron- and αKG-dependent oxygenases (Table S2). Thus, the characteristic HXG/A motif should be an important clue for future isolation of AdeV homologs as well as other new NHFeHals. Notably, a β-hairpin structure (β10-β11) observed on the AdeV C terminus (Fig. 1B and D) might act as a covering lid to hold 2′-dAMP in the active pocket. This substrate-binding fashion is observed among the structurally characterized WelO5 and BesD and is distinct from those of the carrier protein-dependent NHFeHals (24, 25).

FIG 2.

FIG 2

Open in a new tab

Binding mode of 2′-dAMP in the modeled AdeV/FeII/Cl/αKG/2′-dAMP complex. Potential hydrogen bond interactions with distance < 3.5 Å labeled by dashed lines. H194, H252, Cl (orange sphere), water molecule (W, marine sphere), and αKG coordinate FeII (red sphere) are indicated. The conserved HXG motif (H194, S195, and G196) is indicated by the red arrow.

Substrate-binding mode of AdeV by molecular docking and site-directed mutagenesis.

Despite our efforts in cocrystallization or soaking 2′-dAMP with the AdeV/FeII/Cl or AdeV/FeII/Cl/αKG crystals, the attempts to obtain the substrate–bound complex were not successful. However, a phosphate ion (PO4) is observed in the proposed substrate-binding site when soaking the AdeV/FeII/CL crystals with d-fructose-6-phosphate disodium (Fig. S2), a structural analogue of 2′-dAMP. The absence of the fructose moiety in the PO4-binding complex might be attributed to the flexibility of the fructose moiety. The PO4 is stabilized by hydrogen bond interactions formed by K107, R177, and Y181 (Fig. S2), which is proposed to mimic the binding of the terminal phosphate moiety of 2′-dAMP in the substrate-binding pocket. Considering that 2′-dAMP and lysine are hydrophilic aliphatic compounds and might anchor to the substrate-binding pocket through a similar mode, we thus turned to the molecular docking to access the binding mode of 2′-dAMP by using freestanding BesD in complex with FeII, Cl, αKG, and lysine (PDB accession number 7JSD) as a reference (25). In the modeled AdeV/FeII/Cl/αKG/2′-dAMP complex, the adenine moiety of 2′-dAMP forms hydrogen bonds between its N-1 atom and Y273, N-3 atom and R177, and C-6 amino group and Q198 and Y273, as well as a parallel π-stacking interaction with F271 phenyl side chain (Fig. 2). The deoxyribose moiety of 2′-dAMP forms a hydrogen bond between its C-3′ hydroxyl and H192 and stacks to the H194 imidazole ring, making the target C-2′ of 2′-dAMP point to the iron complex (Fig. 2). In addition, the phosphate moiety of 2′-dAMP forms extensive hydrogen bond interactions with K107, R177, and Y181 (Fig. 2). Notably, the target C-2′ of 2′-dAMP is adjacent to the iron ion (5.9 Å) and chloride (5.3 Å) and far from the water molecule (7.6 Å) that is presumed to be occupied by the oxo moiety upon forming the high-energy FeIV-oxo intermediate (Fig. 2). As both nonheme iron- and αKG-dependent hydroxylases and NHFeHals abstract a hydrogen atom from the substrate using the high-energy FeIV-oxo intermediate (24, 25), the substrate/active-site positioning of AdeV might favor the subsequent chlorination versus hydroxylation, as observed in WelO5 and BesD (29).

To further probe the roles of the residues identified above, Ala variants were constructed and their halogenation activity toward 2′-dAMP was measured (Fig. 3 and Fig. S3). Notably, the catalytic activity of variant K107A, R177A, Q198A, and F271A was undetectable, and the residual activities of H192A and Y273A were only 13% and 6%, respectively (Fig. 3). These results reveal that the hydrophobic and hydrogen bond interactions between the substrate-binding pocket and the adenine, deoxyribose, and phosphate moieties of 2′-dAMP are essential for the halogenation. Notably, mutating a more distant residue H111 that forms two hydrogen bonds to R177 to alanine also completely abrogates the enzyme activity (Fig. 3). Although H111 does not directly contact the substrate, it should play a role in the enzyme action by holding R177 in position for the binding of 2′-dAMP and αKG (Fig. 2).

FIG 3.

FIG 3

Open in a new tab

The activity of Ala variants of AdeV. Each assay was conducted in triplicate, and average values with the error bars representing standard deviations are shown.

Structural basis for substrate specificity of AdeV.

AdeV exhibits restricted substrate specificity toward several 2′-dAMP analogues by distinguishing their phosphate, ribose, and nucleoside moieties (31). In addition to 2′-dAMP, AdeV can halogenate 2′,3′-ddAMP (2′-ddAMP) and 2′-deoxyinosine-5′-monophosphate (2′-dIMP) (Fig. 4A, no. 1 and 2, respectively). In the competition experiments by adding equal amounts of 2′-dAMP and 2′-ddAMP or 2′-dAMP and 2′-dIMP, the conversion rate of 2′-dAMP and 2′-dIMP is 10- and 20-fold higher than that of 2′-ddAMP (31). We speculated that 2′-ddAMP and 2′-dIMP might adopt a similar binding mode as that of 2′-dAMP in the substrate-binding pocket (Fig. 4B and C). In the modeled AdeV/FeII/Cl/αKG/2′-ddAMP and AdeV/FeII/Cl/αKG/2′-dIMP complexes, the substrate/active-site positioning of 2′-ddAMP and 2′-dIMP changes slightly compared with that of 2′-dAMP in the modeled AdeV/FeII/Cl/αKG/2′-dAMP (Fig. 4B and C). The target C-2′ of 2′-ddAMP is adjacent to the iron ion (5.9 Å) and chloride ion (6.3 Å) and far from the water molecule (8.1 Å). Similarly, target C-2′ of 2′-dIMP is adjacent to the iron ion and chloride ion and far from the water molecule, with a distance of 5.8 Å, 6.1 Å, and 7.9 Å, respectively. As the hydrogen bond interaction between C-3′ hydroxyl of 2′-dAMP and residue H192 is vital for the halogenation activity (Fig. 2 and 3), it is speculated that 2’-ddAMP lacks a C-3′ hydroxyl on the deoxyribose moiety and disfavors the orienting of the deoxyribose moiety, leading to a lower conversion rate of 2′-ddAMP compared with that of 2′-dAMP and 2′-dIMP.

FIG 4.

FIG 4

Open in a new tab

Chemical structure of 2′-dAMP analogues and molecular docking on AdeV. (A) Chemical structure of 2′-dAMP analogues. (B to D) Predicted binding mode of 2′-ddAMP, 2′-dIMP, and pentostatin in the modeled complexes. Pi and PPi represent the phosphate and pyrophosphate moiety, respectively.

AdeV cannot chlorinate pentostatin (3), deoxyadenosine (2′-dA), 2′-deoxyadenosine-5′-diphoshpate (2′-dADP), or 2′-deoxyadenosine-5′-triphosphate (2’-dATP) (Fig. 4A, no. 4 to 6, respectively). When docked into the AdeV/FeII/CLl/αKG complex, pentostatin binds to the substrate-binding pocket with a similar binding mode as that of 2′-dAMP (Fig. 4C). However, the π-stacking interaction between the seven-membered ring of pentostatin and the F271 phenyl side chain is weaker than that between 2′-dAMP and F271 (Fig. 2 and 4D). In addition, the target C-2′ of pentostatin is far from the iron ion (7.6 Å), chloride ion (7.1 Å), and water molecule (9.3 Å) (Fig. 4C). Thus, it is speculated that the inactivation of AdeV toward pentostatin might be due to the attenuation of the parallel π-stacking interaction between the seven-membered ring and F271 and the change of the substrate/active-site positioning of pentostatin in the substrate-binding pocket. As the phosphate moiety of 2′-dAMP is essential for the binding to the proposed substrate-binding pocket (Fig. 2 and 3), it is speculated that 2′-dA lacks a phosphate moiety and thus is unable to anchor to the substrate-binding pocket of AdeV. The proposed substrate-binding pocket of AdeV is large enough (Fig. S2); however, analysis of the proposed binding mode of 2′-dAMP indicates that AdeV may be unable to provide enough interactions with the extended biphosphate and triphosphate moiety in 2′-dADP and 2′-dATP, respectively (Fig. 2). Thus, it is presumed that neither 2′-dADP nor 2′-dATP can correctly bind to the substrate-binding pocket for chlorination.

Catalytic mechanism of AdeV.

Based on the results described above and by analogy with the catalytic mechanism of other NHFeHals such as BesD and WelO5 (24, 25), we propose a catalytic mechanism of AdeV-mediated halogenation (Fig. 5). In the resting state, H194, H252, αKG, chloride, and one water molecule coordinate FeII (Fig. 5). R177 adjacent to the iron complex should be vital for orienting the C-1 carboxylate of αKG in this stage, analogous to the proposed role of N219 in BesD and S189 in WelO5 (24, 25). H111 might play an important role in orienting R177 by forming hydrogen bond interactions with its side chain (Fig. 5). Subsequently, O2 replaces the water molecule, followed by decarboxylation of αKG to form the FeIV-oxo species and conformational rearrangement of the oxo ligand (Fig. 5). R177 coupled with H111 might help stabilize and orient the FeIV-oxo intermediate to favor the subsequent chlorination versus hydroxylation. The formed FeIV-oxo intermediate abstracts a hydrogen atom from 2′-dAMP. H192 hydrogen bonded to the C-3′ hydroxyl of 2′-dAMP might play an important role in orienting 2′-dAMP for effective halogenation (Fig. 2 and 3). Finally, the 2′-dAMP radically abstracts the chloride ion in the active site to produce 2′-Cl-2′-dAMP (Fig. 5).

FIG 5.

FIG 5

Open in a new tab

Proposed mechanism of action of AdeV. 2′-dAMP and 2′-Cl-2′-dAMP are framed by green dashed boxes. R1 and R2 represent, respectively, the phosphate and adenine moieties of 2′-dAMP, 2′-Cl-2′-dAMP, and 2′-dAMP radical. H192 hydrogen bonded to the C3′ hydroxyl of 2′-dAMP. Hydrogen-bonding interactions (distances < 3.5 Å) are indicated with dashed lines. The amino acids are presented as thick sticks.

In conclusion, the complex crystal structures of AdeV/FeII/Cl and AdeV/FeII/Cl/αKG were determined at a resolution of 1.76 and 1.74 Å, respectively. AdeV possesses the conserved HXG/A motif and a unique FeII coordination geometry that is characteristic of the NHFeHals. Our molecular docking, mutagenesis, and biochemical analyses reveal the catalytic mechanism of AdeV and provide valuable insights on its substrate specificity. These results will facilitate the future rational engineering of AdeV and its analogues for halogenated nucleotides synthesis.

MATERIALS AND METHODS

Chemicals and reagents.

2′-dAMP (2′-dAMP), αKG, and d-fructose-6-phosphate disodium were purchased from J&K Scientific, Ltd. (Beijing, China). Chromatography-grade methanol was obtained from Sigma-Aldrich (St. Louis, MO). Q5 high-fidelity DNA polymerase and restriction endonuclease DpnI were obtained from New England Biolabs (Ipswich, MA).

Plasmid construction and mutagenesis.

The AdeV gene (GenBank accession number AKQ99303.1) was chemically synthesized and subcloned into the pET32a vector by Genecreate Biotechnology Co., Ltd. (Wuhan, Hubei, China). The protein sequence of AdeV was listed in Table S3. Mutants of AdeV were constructed using PCR-based site-directed mutagenesis. The oligonucleotides are listed in Table 1. All of the mutants were verified by sequencing.

TABLE 1.

Primers used for site-directed mutagenesis

Mutanta Sequence (5′→3′)b
K107A_F GTTCCGGATCCGGCCGAATTTATTCATGTTAG
K107A_R CATGAATAAATTCGGCCGGATCCGGAACACC
H111A_F GAAAGAATTTATTGCCGTTAGCGGTGCCATGATTG
H111A_R GGCACCGCTAACGGCAATAAATTCTTTCGGATC
R177A_F GCAACCAATCTGGCAGTTATTCATTATCGTGATG
R177A_R CGATAATGAATAACTGCCAGATTGGTTGCATC
H192A_F GAAGTTCTGGCAGCAGAACATAGCGGTATTCAG
H192A_R CCGCTATGTTCTGCTGCCAGAACTTCACGATC
Q198A_F GAACATAGCGGTATTGCAATGCTGGGTCTGCAGCTG
Q198A_R CTGCAGACCCAGCATTGCAATACCGCTATGTTCATG
F271A_F CTGAGCAGCGTTCTGGCCGCATATCCGCAGCATAAAG
F271A_R GCTGCGGATATGCGGCCAGAACGCTGCTCAGACGTTC
Y273A_F GTTCTGTTTGCAGCACCGCAGCATAAAGCACG
Y273A_R CTTTATGCTGCGGTGCTGCAAACAGAACGCTGC
Open in a new tab
a

Amino acid numbering is based on the full-length sequence of AdeV.

b

The underlined nucleotides comprise mutation sites.

Protein expression and purification.

The recombinant plasmid pET32a-AdeV was transformed into Escherichia coli BL21(DE3) (TransGen Biotech, Beijing, China) for protein expression. Recombinant strains harboring plasmid pET32a-AdeV were cultured in Luria-Bertani medium at 37°C to an optical density at 600 nm (OD600) of approximate 0.8 and induced by 0.2 mM isopropyl-d-thiogalactopyranoside at 16°C for 18 h. Subsequently, the induced strains were harvested by centrifugation at 5,000 × g for 10 min, resuspended in lysis buffer [25 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5 mM (NH4)2Fe(SO4)2 and 20 mM imidazole], and disrupted with a French press (GuangZhou JuNeng Biology and Technology Co., Ltd., Guangzhou, China). Cell debris was removed by centrifugation at 17,000 × g for 1 h. The supernatant was applied to an AKTA Purifier fast protein liquid chromatography (FPLC) system coupled with a Ni-nitrilotriacetic acid (NTA) column (GE Healthcare). The target recombinant AdeV eluted at approximate 100 mM imidazole when using a 20 to 300 mM imidazole gradient. Purified AdeV was dialyzed against buffer containing 25 mM Tris-HCl (pH 7.5) and 150 mM NaCl, and subjected to the tobacco etch virus (TEV) protease digestion to remove the N-terminal His6 tag. The digested mixtures were passed through a Ni-NTA column again and eluted with a buffer containing 25 mM Tris-HCl (pH 7.5) and 150 mM NaCl. Fractions containing untagged AdeV protein were pooled and concentrated to 35 mg · mL−1 in buffer containing 25 mM Tris-HCl (pH 7.5). The protein purity was verified by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) analysis and stored at −80°C for use. All of the AdeV variants were prepared following the same expression and purification procedures as those of the wild-type AdeV. The molecular weight of AdeV was determined by size exclusion chromatography using a prepacked Superdex 200 10/300 GL column (GE Healthcare) as described in our previous study (36). A standard curve was obtained using molecular mass standards (Gel Filtration LMW calibration kit; GE Healthcare).

Crystallization, data collection, structure determination, and refinement.

Crystallization experiments were performed at 18°C using the sitting-drop vapor-diffusion method. A 1-μL aliquot AdeV protein solution (25 mM Tris-HCl [pH 7.5]; 35 mg · mL−1) was mixed with 1 μL of reservoir liquor and equilibrated against 100 μL of reservoir solution. The optimal crystallization conditions of AdeV were 0.1 M HEPES/sodium hydroxide (pH 7.5), 1.5 M ammonium sulfate, 7% polyethylene glycol (PEG) 400, and 5 mM K2HPO4. AdeV crystals in complex with αKG were obtained by soaking the AdeV crystals with reservoir liquor plus 5 mM αKG for 0.5 h. All of the crystals were soaked with cryoprotectant (1.5 M ammonium sulfate, 6% PEG 400, 5 mM potassium phosphate dibasic, 15% glycerol, and 0.1 M HEPES-NaOH [pH 7.5]) before data collection. The X-ray diffraction data sets of AdeV were collected on a D8 Venture single-crystal diffractometer (Bruker, Bremen, Germany) coupled with a complementary metal oxide semiconductor (CMOS) Photon II detector at Hubei University. X-ray diffraction data sets were processed using the Proteum software package. The complex crystal structures of AdeV/FeII/Cl and AdeV/FeII/Cl/αKG were solved by soaking the crystals with Heavy Atom Screen Hg (Hampton Research) as described previously (37, 38). Subsequent model adjustment and refinement were conducted using Refmac5 and Coot (39, 40). Prior to structure refinement, 5% of randomly selected reflections were set aside for calculating Rfree as a monitor of model quality. Graphics for the AdeV structures were prepared using the PyMOL program (http://pymol.sourceforge.net/).

Molecular docking analysis.

The docking of 2′-dAMP, 2′-ddAMP, 2′-dIMP, or pentostatin into AdeV/FeII/Cl/αKG complex was performed using the Discovery Studio 2020 (DS2020; Accelrys Software, Inc., San Diego, CA). BesD in complex with FeII, Cl, αKG, and lysine (PDB accession number 7JSD) was used as the reference (25). Before docking, all water molecules were removed, and hydrogen atoms were added to AdeV. The CDOCKER module of DS2020 was utilized to perform the molecular docking as described previously (36). The binding site is a sphere with a radius of 9 Å whose origin was set at x = 18.020, y = 33.988, z = 23.898. Results were saved as .mol2 or .csv files for further analysis.

Enzyme activity measurement.

Reaction mixtures (500 μL) containing 50 mM HEPES-NaOH (pH 7.5), 1 mg AdeV or the mutated forms, 1 mM 2′-dAMP, 5 mM αKG, 10 mM NaCl, 1 mM (NH4)2Fe(SO4)2, and 1 mM citric acid were incubated at 28°C for 2 h. The reactions were quenched by adding an equal volume of methanol. Subsequently, the samples were filtered with 0.22-μm filters before analysis with a Shimadzu CMB-20A high-performance liquid chromatography (HPLC) system equipped with an SPD-M20A photodiode array detector. The reverse phase column Obelisc R (4.6mm by 200 mm, 5 μm; SIELC Technologies, Wheeling, IL) was eluted with solvent A (20 mM potassium phosphate [pH 2.5]) and solvent B (acetonitrile) under the following gradient conditions: 5% to 20% B, 0 to 15 min, and 20% to 90% B, 15 to 30 min. The flow rate of the mobile phase was 0.4 mL/min. An Agilent 1260 HPLC system coupled with a Bruker micrOTOF-II mass spectrometer was used for mass spectrometry analysis of the samples as described previously (41). All assays were performed in triplicate, and average values with the error bars representing standard deviations were shown.

Data availability.

The crystallographic data and atomic coordinates demonstrated in this study have been deposited in the PDB database under accessions number 7W5S (AdeV/FeII/Cl), 7W5T (AdeV/FeII/Cl/αKG), and 7W5V (AdeV/FeII/Cl/PO4).

ACKNOWLEDGMENTS

This work was supported by the National Key Research and Development Program of China (2021YFC2100300 and 2018YFE0204503), Hubei Hongshan Laboratory, National Natural Science Foundation of China (32100711 and 81871251), China Postdoctoral Science Foundation (2020M682381, 2020M672316 and 2021T140190) and Natural Science Foundation Innovative Group Project of Hubei Province (2020CFA011).

Footnotes

Supplemental material is available online only.

Supplemental file 1
Tables S1 to S2 and Fig. S1 to S3. Download aem.02497-21-s0001.pdf, PDF file, 1.4 MB (1.4MB, pdf)

Contributor Information

Yingle Liu, Email: mvlwu@whu.edu.cn.

Jian-Wen Huang, Email: huangjianwen@hubu.edu.cn.

Rey-Ting Guo, Email: guoreyting@hubu.edu.cn.

Haruyuki Atomi, Kyoto University.

REFERENCES

  • 1.Crowe C, Molyneux S, Sharma SV, Zhang Y, Gkotsi DS, Connaris H, Goss RJ. 2021. Halogenases: a palette of emerging opportunities for synthetic biology-synthetic chemistry and C–H functionalisation. Chem Soc Rev 50:9443–9481. 10.1039/d0cs01551b. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang J, Zhou Y, Wang X, Duan L, Duan J, Li W, Zhang A. 2020. Synthesis and evaluation of halogenated 5-(2-hydroxyphenyl) pyrazoles as pseudilin analogues targeting the enzyme IspD in the methylerythritol phosphate pathway. J Agric Food Chem 68:3071–3078. 10.1021/acs.jafc.9b08057. [DOI] [PubMed] [Google Scholar]
  • 3.Ford MC, Ho PS. 2016. Computational tools to model halogen bonds in medicinal chemistry. J Med Chem 59:1655–1670. 10.1021/acs.jmedchem.5b00997. [DOI] [PubMed] [Google Scholar]
  • 4.Jeschke P. 2017. Latest generation of halogen‐containing pesticides. Pest Manag Sci 73:1053–1066. 10.1002/ps.4540. [DOI] [PubMed] [Google Scholar]
  • 5.Ludewig H, Molyneux S, Ferrinho S, Guo K, Lynch R, Gkotsi DS, Goss RJ. 2020. Halogenases: structures and functions. Curr Opin Struct Biol 65:51–60. 10.1016/j.sbi.2020.05.012. [DOI] [PubMed] [Google Scholar]
  • 6.Timmins A, De Visser SP. 2018. A comparative review on the catalytic mechanism of nonheme iron hydroxylases and halogenases. Catalysts 8:314. 10.3390/catal8080314. [DOI] [Google Scholar]
  • 7.Agarwal V, Miles ZD, Winter JM, Eustáquio AS, El Gamal AA, Moore BS. 2017. Enzymatic halogenation and dehalogenation reactions: pervasive and mechanistically diverse. Chem Rev 117:5619–5674. 10.1021/acs.chemrev.6b00571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gkotsi DS, Ludewig H, Sharma SV, Connolly JA, Dhaliwal J, Wang Y, Unsworth WP, Taylor RJK, McLachlan MMW, Shanahan S, Naismith JH, Goss RJM. 2019. A marine viral halogenase that iodinates diverse substrates. Nat Chem 11:1091–1097. 10.1038/s41557-019-0349-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gribble GW. 2015. A recent survey of naturally occurring organohalogen compounds. Environ Chem 12:396–405. 10.1071/EN15002. [DOI] [Google Scholar]
  • 10.Sundaramoorthy M, Terner J, Poulos TL. 1995. The crystal structure of chloroperoxidase: a heme peroxidase–cytochrome P450 functional hybrid. Structure 3:1367–1378. 10.1016/s0969-2126(01)00274-x. [DOI] [PubMed] [Google Scholar]
  • 11.Isupov MN, Dalby AR, Brindley AA, Izumi Y, Tanabe T, Murshudov GN, Littlechild JA. 2000. Crystal structure of dodecameric vanadium-dependent bromoperoxidase from the red algae Corallina officinalis. J Mol Biol 299:1035–1049. 10.1006/jmbi.2000.3806. [DOI] [PubMed] [Google Scholar]
  • 12.Mondal D, Fisher BF, Jiang Y, Lewis JC. 2021. Flavin-dependent halogenases catalyze enantioselective olefin halocyclization. Nat Commun 12:3268. 10.1038/s41467-021-23503-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Eustáquio AS, Pojer F, Noel JP, Moore BS. 2008. Discovery and characterization of a marine bacterial SAM-dependent chlorinase. Nat Chem Biol 4:69–74. 10.1038/nchembio.2007.56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dong C, Huang F, Deng H, Schaffrath C, Spencer JB, O’Hagan D, Naismith JH. 2004. Crystal structure and mechanism of a bacterial fluorinating enzyme. Nature 427:561–565. 10.1038/nature02280. [DOI] [PubMed] [Google Scholar]
  • 15.Chung W-J, Vanderwal CD. 2016. Stereoselective halogenation in natural product synthesis. Angew Chem Int Ed Engl 55:4396–4434. 10.1002/anie.201506388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Latham J, Brandenburger E, Shepherd SA, Menon BR, Micklefield J. 2018. Development of halogenase enzymes for use in synthesis. Chem Rev 118:232–269. 10.1021/acs.chemrev.7b00032. [DOI] [PubMed] [Google Scholar]
  • 17.Ren X, Fasan R. 2021. Engineered and artificial metalloenzymes for selective C–H functionalization. Curr Opin Green Sust Chem 31:100494. 10.1016/j.cogsc.2021.100494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Keller S, Wage T, Hohaus K, Hölzer M, Eichhorn E, van Pée KH. 2000. Purification and partial characterization of tryptophan 7‐halogenase (PrnA) from Pseudomonas fluorescens. Angew Chem Int Ed Engl 39:2300–2302. . [DOI] [PubMed] [Google Scholar]
  • 19.Kittilä T, Kittel C, Tailhades J, Butz D, Schoppet M, Büttner A, Goode RJA, Schittenhelm RB, van Pee K-H, Süssmuth RD, Wohlleben W, Cryle MJ, Stegmann E. 2017. Halogenation of glycopeptide antibiotics occurs at the amino acid level during non-ribosomal peptide synthesis. Chem Sci 8:5992–6004. 10.1039/c7sc00460e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hayashi T, Ligibel M, Sager E, Voss M, Hunziker J, Schroer K, Snajdrova R, Buller R. 2019. Evolved aliphatic halogenases enable regiocomplementary C−H functionalization of a pharmaceutically relevant compound. Angew Chem Int Ed Engl 58:18535–18539. 10.1002/anie.201907245. [DOI] [PubMed] [Google Scholar]
  • 21.Galonić DP, Vaillancourt FH, Walsh CT. 2006. Halogenation of unactivated carbon centers in natural product biosynthesis: trichlorination of leucine during barbamide biosynthesis. J Am Chem Soc 128:3900–3901. 10.1021/ja060151n. [DOI] [PubMed] [Google Scholar]
  • 22.Vaillancourt FH, Yin J, Walsh CT. 2005. SyrB2 in syringomycin E biosynthesis is a nonheme FeII α-ketoglutarate-and O2-dependent halogenase. Proc Natl Acad Sci USA 102:10111–10116. 10.1073/pnas.0504412102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gu L, Wang B, Kulkarni A, Geders TW, Grindberg RV, Gerwick L, Håkansson K, Wipf P, Smith JL, Gerwick WH, Sherman DH. 2009. Metamorphic enzyme assembly in polyketide diversification. Nature 459:731–735. 10.1038/nature07870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Mitchell AJ, Zhu Q, Maggiolo AO, Ananth NR, Hillwig ML, Liu X, Boal AK. 2016. Structural basis for halogenation by iron-and 2-oxo-glutarate-dependent enzyme WelO5. Nat Chem Biol 12:636–640. 10.1038/nchembio.2112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Neugebauer ME, Sumida KH, Pelton JG, McMurry JL, Marchand JA, Chang MC. 2019. A family of radical halogenases for the engineering of amino-acid-based products. Nat Chem Biol 15:1009–1016. 10.1038/s41589-019-0355-x. [DOI] [PubMed] [Google Scholar]
  • 26.Kim CY, Mitchell AJ, Glinkerman CM, Li F-S, Pluskal T, Weng J-K. 2020. The chloroalkaloid (−)-acutumine is biosynthesized via a Fe (II)-and 2-oxoglutarate-dependent halogenase in Menispermaceae plants. Nat Commun 11:1–7. 10.1038/s41467-020-15777-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hillwig ML, Zhu Q, Ittiamornkul K, Liu X. 2016. Discovery of a promiscuous non‐heme iron halogenase in ambiguine alkaloid biogenesis: implication for an evolvable enzyme family for late‐stage halogenation of aliphatic carbons in small molecules. Angew Chem Int Ed Engl 55:5780–5784. 10.1002/anie.201601447. [DOI] [PubMed] [Google Scholar]
  • 28.Gao Y, Xu G, Wu P, Liu J, Cai Y-S. 2017. Biosynthesis of 2′-chloropentostatin and 2′-amino-2′-deoxyadenosine highlights a single gene cluster responsible for two independent pathways in Actinomadura sp. strain ATCC 39365. Appl Environ Microbiol 83:e00078-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Mehmood R, Vennelakanti V, Kulik HJ. 2021. Spectroscopically guided simulations reveal distinct strategies for positioning substrates to achieve selectivity in nonheme Fe (II)/α-ketoglutarate-dependent halogenases. ACS Catal 11:12394–12408. 10.1021/acscatal.1c03169. [DOI] [Google Scholar]
  • 30.Zhao C, Qi J, Tao W, He L, Xu W, Chan J, Deng Z. 2014. Characterization of biosynthetic genes of ascamycin/dealanylascamycin featuring a 5′-O-sulfonamide moiety in Streptomyces sp. JCM9888. PLoS One 9:e114722. 10.1371/journal.pone.0114722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhao C, Yan S, Li Q, Zhu H, Zhong Z, Ye Y, Deng Z, Zhang Y. 2020. An Fe2+‐and α‐ketoglutarate‐dependent halogenase acts on nucleotide substrates. Angew Chem 132:9565–9571. 10.1002/ange.201914994. [DOI] [PubMed] [Google Scholar]
  • 32.Blasiak LC, Vaillancourt FH, Walsh CT, Drennan CL. 2006. Crystal structure of the non-haem iron halogenase SyrB2 in syringomycin biosynthesis. Nature 440:368–371. 10.1038/nature04544. [DOI] [PubMed] [Google Scholar]
  • 33.Hausinger RP. 2004. Fe (II)/α-ketoglutarate-dependent hydroxylases and related enzymes. Crit Rev Biochem Mol Biol 39:21–68. 10.1080/10409230490440541. [DOI] [PubMed] [Google Scholar]
  • 34.Mitchell AJ, Dunham NP, Bergman JA, Wang B, Zhu Q, Chang WC, Liu X, Boal AK. 2017. Structure-guided reprogramming of a hydroxylase to halogenate its small molecule substrate. Biochemistry 56:441–444. 10.1021/acs.biochem.6b01173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Papadopoulou A, Meierhofer J, Meyer F, Hayashi T, Schneider S, Sager E, Buller RMU. 2021. Re‐programming and optimization of a l‐proline cis‐4‐hydroxylase for the cis‐3‐halogenation of its native substrate. ChemCatChem 13:3914–3919. 10.1002/cctc.202100591. [DOI] [Google Scholar]
  • 36.Dai L, Qin L, Hu Y, Huang J-w, Hu Z, Min J, Sun Y, Guo R-T. 2021. Structural dissection of unnatural ginsenoside-biosynthetic UDP-glycosyltransferase Bs-YjiC from Bacillus subtilis for substrate promiscuity. Biochem Biophys Res Commun 534:73–78. 10.1016/j.bbrc.2020.11.104. [DOI] [PubMed] [Google Scholar]
  • 37.Chan HC, Ko TP, Huang CH, Guo RT. 2015. Minireview: A comeback of Hg‐derivatives in protein crystallography with Cys‐modification. ChemBioEng Rev 2:133–140. 10.1002/cben.201400029. [DOI] [Google Scholar]
  • 38.Kuo C-J, Gao J, Huang J-W, Ko T-P, Zhai C, Ma L, Liu W, Dai L, Chang Y-F, Chen T-H, Hu Y, Yu X, Guo R-T, Chen C-C. 2019. Functional and structural investigations of fibronectin-binding protein Apa from Mycobacterium tuberculosis. Biochim Biophys Acta Gen Subj 1863:1351–1359. 10.1016/j.bbagen.2019.06.003. [DOI] [PubMed] [Google Scholar]
  • 39.McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, Read RJ. 2007. Phaser crystallographic software. J Appl Crystallogr 40:658–674. 10.1107/S0021889807021206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Emsley P, Cowtan K. 2004. Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60:2126–2132. 10.1107/S0907444904019158. [DOI] [PubMed] [Google Scholar]
  • 41.Dai L, Liu C, Li J, Dong C, Yang J, Dai Z, Zhang X, Sun Y. 2018. One-pot synthesis of ginsenoside Rh2 and bioactive unnatural ginsenoside by coupling promiscuous glycosyltransferase from Bacillus subtilis 168 to sucrose synthase. J Agric Food Chem 66:2830–2837. 10.1021/acs.jafc.8b00597. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Tables S1 to S2 and Fig. S1 to S3. Download aem.02497-21-s0001.pdf, PDF file, 1.4 MB (1.4MB, pdf)

Data Availability Statement

The crystallographic data and atomic coordinates demonstrated in this study have been deposited in the PDB database under accessions number 7W5S (AdeV/FeII/Cl), 7W5T (AdeV/FeII/Cl/αKG), and 7W5V (AdeV/FeII/Cl/PO4).

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES