The Newly Described msrC Gene Is Not Equally Distributed among All Isolates of Enterococcus faecium

Two recent reports have discussed the role of a newly described enterococcal gene, msrC (3, 5). The msrC gene possesses 53 to 62% identity with a staphylococcal gene, msr(A), encoding an ABC porter for macrolide and streptogramin B antibiotics (3–5). Portillo et al. (3) found identical msrC genes distributed among different macrolide resistance phenotypes of Enterococcus faecium, suggesting a role other than involvement in antibiotic resistance. However, disruption of msrC by insertion mutagenesis was associated with two- to eightfold decreases in MICs of 14-, 15-, and 16-membered macrolides and streptogramins B (5). The msrC gene was detected in all of the investigated 256 isolates of E. faecium in both studies (3, 5). In none of the other seven investigated enterococcal species was the corresponding gene found, suggesting msrC to be an intrinsic property of E. faecium. With the exception of two isolates from animals all other tested E. faecium isolates possessing msrC were from humans.

As reported previously, we have already examined a collection of streptogramin-resistant E. faecium isolates of the vat(E) type for the presence of msrC by PCR and found it in only 45 of 77 isolates (6). However, the primers were based on the gene sequence for msrC reported by Portillo et al. (3), which is only 95% identical to the recently reported sequence of msrC for the two U.S. isolates (5). New primers corresponding to sites of 100% identity between all three identified msrC alleles were constructed (primer msrC3, 5′ AAGGAATCCTTCTCTCTCCG; primer msrC4, 5′ GTAAACAAAATCGTTCCCG; product, 343 bp). With these primers we screened seven isolates of E. hirae, E. durans, and E. faecalis as negative controls and a collection of 139 unrelated E. faecium isolates of sewage, animal, food, and human origins including 10 macrolide-susceptible E. faecium isolates for which erythromycin MICs were ≤4 mg/liter (including E. faecium ATCC19434). A total of 121 E. faecium isolates, including all 10 erythromycin-susceptible isolates, gave a product for msrC. The nucleotide composition of the PCR product from six isolates of different origins was, despite two nucleotide changes, identical to the allele of msrC described by Portillo et al. (3).

Eighteen E. faecium isolates (as well as the seven negative controls) were negative for msrC. The species E. faecium was confirmed for the 18 isolates by a PCR specific for an unknown fragment of the E. faecium chromosome (1) and for the E. faecium specific ligase gene ddl (2). Dot blot hybridizations of genomic DNA from the msrC PCR-negative isolates with a labelled msrC gene probe were negative for all but three E. faecium isolates. The 15 E. faecium isolates negative for msrC in PCR and hybridization experiments consisted of 10 of 32 from poultry, 0 of 16 from pigs, 1 of 21 from sewage, and 4 of 70 from humans.

The results of our study show that the msrC gene is not an intrinsic property of all E. faecium isolates. The data also suggest that antibiotic use in animals has not been a selective force for msrC.