Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
editorial
. 2001 Dec;45(12):3672–3673. doi: 10.1128/AAC.45.12.3672-3673.2001

The Newly Described msrC Gene Is Not Equally Distributed among All Isolates of Enterococcus faecium

Guido Werner 1, Bianca Hildebrandt 1, Wolfgang Witte 1
PMCID: PMC90897  PMID: 11724034

Two recent reports have discussed the role of a newly described enterococcal gene, msrC (3, 5). The msrC gene possesses 53 to 62% identity with a staphylococcal gene, msr(A), encoding an ABC porter for macrolide and streptogramin B antibiotics (3–5). Portillo et al. (3) found identical msrC genes distributed among different macrolide resistance phenotypes of Enterococcus faecium, suggesting a role other than involvement in antibiotic resistance. However, disruption of msrC by insertion mutagenesis was associated with two- to eightfold decreases in MICs of 14-, 15-, and 16-membered macrolides and streptogramins B (5). The msrC gene was detected in all of the investigated 256 isolates of E. faecium in both studies (3, 5). In none of the other seven investigated enterococcal species was the corresponding gene found, suggesting msrC to be an intrinsic property of E. faecium. With the exception of two isolates from animals all other tested E. faecium isolates possessing msrC were from humans.

As reported previously, we have already examined a collection of streptogramin-resistant E. faecium isolates of the vat(E) type for the presence of msrC by PCR and found it in only 45 of 77 isolates (6). However, the primers were based on the gene sequence for msrC reported by Portillo et al. (3), which is only 95% identical to the recently reported sequence of msrC for the two U.S. isolates (5). New primers corresponding to sites of 100% identity between all three identified msrC alleles were constructed (primer msrC3, 5′ AAGGAATCCTTCTCTCTCCG; primer msrC4, 5′ GTAAACAAAATCGTTCCCG; product, 343 bp). With these primers we screened seven isolates of E. hirae, E. durans, and E. faecalis as negative controls and a collection of 139 unrelated E. faecium isolates of sewage, animal, food, and human origins including 10 macrolide-susceptible E. faecium isolates for which erythromycin MICs were ≤4 mg/liter (including E. faecium ATCC19434). A total of 121 E. faecium isolates, including all 10 erythromycin-susceptible isolates, gave a product for msrC. The nucleotide composition of the PCR product from six isolates of different origins was, despite two nucleotide changes, identical to the allele of msrC described by Portillo et al. (3).

Eighteen E. faecium isolates (as well as the seven negative controls) were negative for msrC. The species E. faecium was confirmed for the 18 isolates by a PCR specific for an unknown fragment of the E. faecium chromosome (1) and for the E. faecium specific ligase gene ddl (2). Dot blot hybridizations of genomic DNA from the msrC PCR-negative isolates with a labelled msrC gene probe were negative for all but three E. faecium isolates. The 15 E. faecium isolates negative for msrC in PCR and hybridization experiments consisted of 10 of 32 from poultry, 0 of 16 from pigs, 1 of 21 from sewage, and 4 of 70 from humans.

The results of our study show that the msrC gene is not an intrinsic property of all E. faecium isolates. The data also suggest that antibiotic use in animals has not been a selective force for msrC.

Acknowledgments

The study reported was supported in part by a grant from the Federal Ministry for Health.

REFERENCES

  • 1.Cheng S, McCleskey F K, Gress M J, Retroziello J M, Liu R, Namadari H, Beninga K, Salmen A, DelVecchio V G. A PCR assay for identification of Enterococcus faecium. J Clin Microbiol. 1997;35:1248–1250. doi: 10.1128/jcm.35.5.1248-1250.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Dutka-Malen S, Evers S, Courvalin P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J Clin Microbiol. 1995;33:24–27. doi: 10.1128/jcm.33.1.24-27.1995. . (Erratum 33:1434.) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Portillo A, Ruiz-Larrea F, Zarazaga M, Alonso A, Martinez J L, Torres C. Macrolide resistance genes in Enterococcusspp. Antimicrob Agents Chemother. 2000;44:967–971. doi: 10.1128/aac.44.4.967-971.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ross J I, Eady E A, Cove J H, Cunliffe W J, Baumberg S, Wootton J C. Inducible erythromycin resistance in staphylococci is encoded by a member of the ATP-binding transport super-gene family. Mol Microbiol. 1990;4:1207–1214. doi: 10.1111/j.1365-2958.1990.tb00696.x. [DOI] [PubMed] [Google Scholar]
  • 5.Singh K V, Malathum K, Murray B E. Disruption of an Enterococcus faeciumspecies-specific gene, a homologue of acquired macrolide resistance genes of staphylococci, is associated with an increase in macrolide susceptibility. Antimicrob Agents Chemother. 2001;45:263–266. doi: 10.1128/AAC.45.1.263-266.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Werner G, Hildebrandt B, Klare I, Witte W. Linkage of determinants for streptogramin A, macrolide-lincosamide-streptogramin B, and chloramphenicol resistance on a conjugative plasmid in Enterococcus faeciumand dissemination of this cluster among streptogramin-resistant enterococci. Int J Med Microbiol. 2000;290:543–548. doi: 10.1016/S1438-4221(00)80020-X. [DOI] [PubMed] [Google Scholar]
Antimicrob Agents Chemother. 2001 Dec;45(12):3672–3673. doi: 10.1128/AAC.45.12.3672-3673.2001

AUTHORS' REPLY (REFERENCE 5)

Barbara E Murray 1, Kavindra V Singh 1

The letter from Werner and colleagues reports the interesting finding that a gene, msrC, previously identified in 100% of over 250 isolates of Enterococcus faecium, was not found in 15 (4 of which were from humans) of 139 isolates of E. faecium currently studied. Overall, in the three studies combined, msrC was documented by PCR or hybridization in 98.7% of approximately 320 human isolates. While one could question whether the msrC gene probe covered the entire gene or if it might have missed evidence suggesting a partial deletion of the gene, it nonetheless appears that a small percentage of E. faecium isolates are not able to make MsrC. So, while msrC still appears to be specific for identifying E. faecium, it is not sufficiently sensitive for identifying all isolates of this species, which could well be a limitation with any single-gene species identification method, particularly for a nonessential gene, such as this one.

Whether msrC represents a gene that has been acquired horizontally by E. faecium at some time in the past, or whether it represents an endogenous gene that has been lost by a small percentage of isolates during the evolution of the species, remains to be seen. If the former is true, the presence of the gene in >95% isolates suggests either that it was acquired very early in the species' history or that it offers some substantial advantage. Since the gene is not essential for survival in vitro, as shown in our study (nor did disruption result in a difference in growth curves), it would seem that whatever function msrC normally provides to the cell is ancillary to cell survival and/or can be assumed by another cell component. The presence of multiple potential ABC transporters in the genome of Enterococcus faecalis (1-1), and of at least some in our preliminary sequence of E. faecium (www.hgsc.bcm.tmc.edu/microbial /efaecium), suggests that there may be many other candidates for products that may provide a similar function. Sequencing in the regions surrounding msrC may reveal the presence of elements suggesting horizontal movement of this gene between strains or, alternatively, may find remnants of msrC, suggesting deletion of what once was a gene endogenous to this species. Such studies, and similar ones with other genes, should help shed light on how enterococcal species have evolved.

REFERENCE

  • 1-1.Davis D R, McAlpine J B, Pazoles C J, Talbot M K, Alder E A, White C, Jonas B M, Murray B E, Weinstock G M, Rogers B L. Enterococcus faecalismulti-drug resistance transporters: application for antibiotic discovery. J Mol Microbiol Biotechnol. 2001;3:179–184. [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES