Reagent or resource | Source | Identifier |
---|---|---|
| ||
Antibodies | ||
| ||
anti-RPN1 | Bethyl Laboratories | Cat# A305–026A; RRID: AB_2621220 |
anti-GAPDH | Bethyl Laboratories | Cat# A300–641A; RRID: AB_513619 |
anti-b-tubulin | Abcam | Cat# ab15568; RRID: AB_2210952 |
anti-H3K4me3 | Abcam | Cat# ab8580; RRID: AB_306649 |
anti-Sec63 | Bethyl Laboratories | Cat# A305–084A; RRID: AB_2631479 |
IRDye 800CW Goat anti-Mouse IgG Secondary Antibody | Li-Cor Biosciences | Cat# 926–32210; RRID: AB_621842 |
IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody | Li-Cor Biosciences | Cat# 926–32211; RRID: AB_621843 |
| ||
Chemicals, peptides, and recombinant proteins | ||
| ||
RPMI 1640 Medium | Thermo Fisher Scientific | Cat# 11875085 |
mTeSR 1 Media | STEMCELL Technologies | Cat# 85850 |
Ham’s F-12 Nutrient Mix Media | Thermo Fisher Scientific | Cat# 11765062 |
DMEM media, high glucose | Thermo Fisher Scientific | Cat# 11965092 |
Penicillin/streptomycin | Sigma | Cat# 15140122 |
Matrigel matrix | Corning | Cat# 354234 |
Fetal Bovine Serum | Thermo Fisher Scientific | Cat# 16000036 |
N-Acetyl-9-azido-9-deoxy-neuraminic acid; 9Az sialic acid | Carbosynth | Cat# MA30919 |
N-azidoacetylmannosamine-tetraacylated; Ac4ManNAz | Click Chemistry Tools | Cat# 1084 |
Dimethyl sulfoxide, anhydrous | Sigma | Cat# 276855 |
N-Acetyl-D-galactosamine; GalNAc | Sigma | Cat# A2795 |
D-(+)-Galactose; Gal | Sigma | Cat# G0750 |
NGI-1 | Sigma | Cat# SML1620 |
Kifunensine | Sigma | Cat# K1140 |
Swainsonine | Sigma | Cat# S9263 |
P-3FAX-Neu5Ac | Torcis | Cat# 5760 |
TRIzol | Thermo Fisher Scientific | Cat# 15596026 |
Chloroform | Sigma | Cat# C2432 |
Proteinase K | Thermo Fisher Scientific | Cat# AM2546 |
TURBO DNase | Thermo Fisher Scientific | Cat# AM2238 |
RNase cocktail | Thermo Fisher Scientific | Cat# AM2286 |
a2–3,6,8,9 Neuraminidase A | New England Biolabs | Cat# P0722 |
Endo Hf | New England Biolabs | Cat# P0703 |
PNGaseF | New England Biolabs | Cat# P0704 |
Endo F2 | New England Biolabs | Cat# P0772 |
Endo F3 | New England Biolabs | Cat# P0771 |
O-Glycosidase | New England Biolabs | Cat# P0733 |
StcE | Malaker et al., 2019 | N/A |
Vibrio cholerae Sialidase; VC-Sia | Gray et al., 2020 | N/A |
dibenzocyclooctyne-PEG4-biotin; DBCO-biotin | Sigma | Cat# 760749 |
UltraPure Formamide | Thermo Fisher Scientific | Cat# 15515026 |
UltraPure EDTA | Thermo Fisher Scientific | Cat# 15575020 |
UltraPure SDS | Thermo Fisher Scientific | Cat# 15553027 |
SYBR Gold Nucleic Acid Gel Stain | Thermo Fisher Scientific | Cat# S11494 |
0.45 um nitrocellulose membrane | Cytiva Life Sciences | Cat# 10600002 |
Odyssey Blocking Buffer | Li-Cor Biosciences | Cat# 927–40000 |
IRDye 800CW Streptavidin | Li-Cor Biosciences | Cat# 926–32230 |
Tween-20 | Sigma | Cat# P7949 |
4,5-methylenedioxy-1,2-phenylenediamine dihydrochloride; DMB | Sigma | Cat# 66807 |
Acetic Acid | Sigma | Cat# 695092 |
2-Mercaptoethanol | Sigma | Cat# M6250 |
Sodium Sulfate | Sigma | Cat# 239313 |
N-acetylneuraminic acid; Neu5Ac | Carbosynth | Cat# MA00746 |
N-glycolylneuraminic acid; Neu5Gc | Carbosynth | Cat# MG05324 |
3-deoxy-D-glycero-D-galacto-2-nonulosonic acid; KDN | Carbosynth | Cat# MD04703 |
Glyko Sialic Acid Reference Panel | Agilent | Cat# GKRP-2503 |
biotin-wheat germ agglutinin; WGA | Vector Laboratories | Cat# B-1025 |
biotin-concanavalin A; ConA | Vector Laboratories | Cat# B-1005 |
biotin-Maackia Amurensis Lectin II; MAAII | Vector Laboratories | Cat# B-1265 |
Pierce High Sensitivity Streptavidin-HRP; Strep-HRP | Thermo Fisher Scientific | Cat# 21130 |
Sucrose | Sigma | Cat# S0389 |
Dithiothreitol; DTT | Thermo Fisher Scientific | Cat# R0861 |
MyOne C1 Streptavidin beads | Thermo Fisher Scientific | Cat# 65001 |
Glycogen | Thermo Fisher Scientific | Cat# AM9510 |
T4 PNK | New England Biolabs | Cat# M0201 |
FastAP | Thermo Fisher Scientific | Cat# EF0651 |
RNA Ligase I | New England Biolabs | Cat# M0204 |
5′ Deadenylase | New England Biolabs | Cat# M0331 |
RecJf | New England Biolabs | Cat# M0264 |
gamma-32p-ATP | Perkin Elmer | Cat# NEG502Z250UC |
UltraPure TBE Buffer | Thermo Fisher Scientific | Cat# 15581044 |
Hybond-N+ Membrane | VWR | Ca# 95038–376 |
PerfectHyb Plus | Sigma | Cat# H7033 |
UltraPure SSC | Thermo Fisher Scientific | Cat# 15557044 |
Acetonitrile, Optima LC/MS Grade | Fisher Scientific | Cat# A955–500 |
Trifluoroacetic acid for HPLC, ≥ 99.0% | Sigma | Cat# 302031 |
Formic Acid, 99.0+%, Optima LC/MS Grade | Fisher Scientific | Cat# A117–50 |
Ammonium bicarbonate | Sigma | Cat# A6141 |
Ammonium formate | Sigma | Cat# 70221 |
Water, Optima LC/MS Grade | Fisher Scientific | Cat# W6500 |
Isopropanol, Optima LC/MS Grade | Fisher Scientific | Cat# A461–500 |
Sodium ascorbate | Sigma | Cat# A7631 |
Trolox | Sigma | Cat# 238813 |
Sodium Azide | Sigma | Cat# S2002 |
Manganese(II) chloride | Sigma | Cat# 244589 |
Calcium chloride | Sigma | Cat# 499609 |
Magnesium chloride | Sigma | Cat# 63069 |
Biotin-aniline | Iris Biotech GMBH | Cat# LS-3970 |
TRIzol LS | Thermo Fisher Scientific | Cat# 10296028 |
rec-hSiglec-2 | R&D Systems | Cat# 1968-SL-050 |
rec-hSiglec-3 | R&D Systems | Cat# 1137-SL-050 |
rec-hSiglec-Mag | R&D Systems | Cat# 8940-MG-050 |
rec-hSiglec-5 | R&D Systems | Cat# 1072-SL-050 |
rec-hSiglec-6 | R&D Systems | Cat# 2859-SL-050 |
rec-hSiglec-7 | R&D Systems | Cat# 1138-SL-050 |
rec-hSiglec-8 | R&D Systems | Cat# 9045-SL-050 |
rec-hSiglec-9 | R&D Systems | Cat# 1139-SL-050 |
rec-hSiglec-10 | R&D Systems | Cat# 2130-SL-050 |
rec-hSiglec-11 | R&D Systems | Cat# 3258-SL-050 |
rec-hSiglec-14 | R&D Systems | Cat# 4905-SL-050 |
rec-hSiglec-15 | R&D Systems | Cat# 9227-SL-050 |
rec-hIgG1 | R&D Systems | Cat# 110-HG-100 |
Bovine Serum Albumin | Sigma | Cat# A9418 |
IRDye 680 RD Goat anti-Mouse IgG | Li-Cor Biosciences | Cat# 926–68070 |
AffiniPure Mouse Anti-Human IgG, Fcγ fragment specific | Jackson ImmunoResearch | Cat# 209–605-098 |
J2 antibody | Scicons | Cat# J2 |
FluoroFix Buffer | BioLegend | Cat# 422101 |
TrypLE | Thermo Fisher Scientific | Cat# 12604021 |
Trypsin LC-MS grade | Promega | Cat# V5117 |
Trypsin | HyClone | Cat# SH3004201 |
Trypsin | Thermo Fisher Scientific | Cat# 25300054 |
Trypsin | Sigma | Cat# T4174 |
Trypsin | Sigma | Cat# T4549 |
Trypsin | Stem Cell Technologies | Cat# 07901 |
Trypsin | ATCC | Cat# 30–2101 |
| ||
Critical commercial assays | ||
| ||
ProteoExtract Native Membrane Protein Extraction Kit |
EMD Millipore | Cat# 444810 |
Plasma Membrane Protein Extraction Kit | Abcam | Cat# ab65400 |
RNA Clean and Concentrator 5 | Zymo Research | Cat# R1013 |
Poly(A)Purist MAG Kit | Thermo Fisher Scientific | Cat# AM1922 |
| ||
Deposited data | ||
| ||
Input- and ManNAz-seq from HeLa cells | This Study | Gene Expression Omnibus: GSE136967 |
Input- and ManNAz-seq from H9 ES cells | This Study | Gene Expression Omnibus: GSE136967 |
| ||
Experimental models: cell lines | ||
| ||
HeLa | ATCC | Cat# ATCC-CCL-2 |
HEK293T | ATCC | Cat# ATCC-CRL-3216 |
K562 | ATCC | Cat# ATCC-CCL-243 |
T-ALL 4188 | Lab of Dean Felsher (Stanford); Felsher and Bishop, 1999 | N/A |
H9 ES cells | WiCell | Cat# WA09 |
GM12878 | Lab of Howard Chang (Stanford) | N/A |
K562GALE−/− | Lab of Carolyn Bertozzi (Stanford); Schumann et al., 2020 | N/A |
CHO-K1 | ATCC | Cat# ATCC-CCL-61 |
ldlD-CHO | Lab of Monty Krieger (MIT); Kingsley et al., 1986 | N/A |
| ||
Experimental models: organisms/strains | ||
| ||
Mouse: C57BL/6 | Jackson Laboratories | N/A |
| ||
Oligonucleotides | ||
| ||
RNY5_gDNA_PCR_F: GTTGATTAACATAATTCTTAC |
This paper | N/A |
RNY5_gDNA_PCR_R: CATTTTGAAGGTTAATACTTC |
This paper | N/A |
sgRNA_RNY5–1_px458_F: CACCGCACAGTTGGTCCGAGTGTTG |
This paper | N/A |
HS_Y5_LNA: aa+cag+caa+gct+agt+caa+gcg |
This paper | N/A |
HS_5S_LNA: cga+ccc+tgc+tta+gct+tcc+ga |
This paper | N/A |
sgRNA_RNY5–1_px458_R: AAACCAACACTCGGACCAACTGTGC |
This paper | N/A |
sgRNA_RNY5–2_px458_F: CACCGAAGCTAGTCAAGCGCGGTTG |
This paper | N/A |
sgRNA_RNY5–2_px458_R: AAACCAACCGCGCTTGACTAGCTTC |
This paper | N/A |
| ||
Software and algorithms | ||
| ||
R | R Project | https://www.r-project.org/ |
ggplot2 | https://www.tidyverse.org/ | https://ggplot2.tidyverse.org |
DESeq2 | Love et al., 2014 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
FAST-iCLIP | Flynn et al., 2015 | https://github.com/ChangLab/FAST-iCLIP/tree/lite |
CHOPCHOP | Labun et al., 2019 | https://chopchop.cbu.uib.no/ |
Adobe Illustrator CC | Adobe | https://www.adobe.com |
GlycoNote | Dr. Ming Qi Liu | https://github.com/MingqiLiu/GlycoNote |