Skip to main content
. Author manuscript; available in PMC: 2022 Jun 10.
Published in final edited form as: Cell. 2021 May 17;184(12):3109–3124.e22. doi: 10.1016/j.cell.2021.04.023

KEY RESOURCES TABLE

Reagent or resource Source Identifier

Antibodies

anti-RPN1 Bethyl Laboratories Cat# A305–026A; RRID: AB_2621220
anti-GAPDH Bethyl Laboratories Cat# A300–641A; RRID: AB_513619
anti-b-tubulin Abcam Cat# ab15568; RRID: AB_2210952
anti-H3K4me3 Abcam Cat# ab8580; RRID: AB_306649
anti-Sec63 Bethyl Laboratories Cat# A305–084A; RRID: AB_2631479
IRDye 800CW Goat anti-Mouse IgG Secondary Antibody Li-Cor Biosciences Cat# 926–32210; RRID: AB_621842
IRDye 800CW Goat anti-Rabbit IgG Secondary Antibody Li-Cor Biosciences Cat# 926–32211; RRID: AB_621843

Chemicals, peptides, and recombinant proteins

RPMI 1640 Medium Thermo Fisher Scientific Cat# 11875085
mTeSR 1 Media STEMCELL Technologies Cat# 85850
Ham’s F-12 Nutrient Mix Media Thermo Fisher Scientific Cat# 11765062
DMEM media, high glucose Thermo Fisher Scientific Cat# 11965092
Penicillin/streptomycin Sigma Cat# 15140122
Matrigel matrix Corning Cat# 354234
Fetal Bovine Serum Thermo Fisher Scientific Cat# 16000036
N-Acetyl-9-azido-9-deoxy-neuraminic acid; 9Az sialic acid Carbosynth Cat# MA30919
N-azidoacetylmannosamine-tetraacylated; Ac4ManNAz Click Chemistry Tools Cat# 1084
Dimethyl sulfoxide, anhydrous Sigma Cat# 276855
N-Acetyl-D-galactosamine; GalNAc Sigma Cat# A2795
D-(+)-Galactose; Gal Sigma Cat# G0750
NGI-1 Sigma Cat# SML1620
Kifunensine Sigma Cat# K1140
Swainsonine Sigma Cat# S9263
P-3FAX-Neu5Ac Torcis Cat# 5760
TRIzol Thermo Fisher Scientific Cat# 15596026
Chloroform Sigma Cat# C2432
Proteinase K Thermo Fisher Scientific Cat# AM2546
TURBO DNase Thermo Fisher Scientific Cat# AM2238
RNase cocktail Thermo Fisher Scientific Cat# AM2286
a2–3,6,8,9 Neuraminidase A New England Biolabs Cat# P0722
Endo Hf New England Biolabs Cat# P0703
PNGaseF New England Biolabs Cat# P0704
Endo F2 New England Biolabs Cat# P0772
Endo F3 New England Biolabs Cat# P0771
O-Glycosidase New England Biolabs Cat# P0733
StcE Malaker et al., 2019 N/A
Vibrio cholerae Sialidase; VC-Sia Gray et al., 2020 N/A
dibenzocyclooctyne-PEG4-biotin; DBCO-biotin Sigma Cat# 760749
UltraPure Formamide Thermo Fisher Scientific Cat# 15515026
UltraPure EDTA Thermo Fisher Scientific Cat# 15575020
UltraPure SDS Thermo Fisher Scientific Cat# 15553027
SYBR Gold Nucleic Acid Gel Stain Thermo Fisher Scientific Cat# S11494
0.45 um nitrocellulose membrane Cytiva Life Sciences Cat# 10600002
Odyssey Blocking Buffer Li-Cor Biosciences Cat# 927–40000
IRDye 800CW Streptavidin Li-Cor Biosciences Cat# 926–32230
Tween-20 Sigma Cat# P7949
4,5-methylenedioxy-1,2-phenylenediamine dihydrochloride; DMB Sigma Cat# 66807
Acetic Acid Sigma Cat# 695092
2-Mercaptoethanol Sigma Cat# M6250
Sodium Sulfate Sigma Cat# 239313
N-acetylneuraminic acid; Neu5Ac Carbosynth Cat# MA00746
N-glycolylneuraminic acid; Neu5Gc Carbosynth Cat# MG05324
3-deoxy-D-glycero-D-galacto-2-nonulosonic acid; KDN Carbosynth Cat# MD04703
Glyko Sialic Acid Reference Panel Agilent Cat# GKRP-2503
biotin-wheat germ agglutinin; WGA Vector Laboratories Cat# B-1025
biotin-concanavalin A; ConA Vector Laboratories Cat# B-1005
biotin-Maackia Amurensis Lectin II; MAAII Vector Laboratories Cat# B-1265
Pierce High Sensitivity Streptavidin-HRP; Strep-HRP Thermo Fisher Scientific Cat# 21130
Sucrose Sigma Cat# S0389
Dithiothreitol; DTT Thermo Fisher Scientific Cat# R0861
MyOne C1 Streptavidin beads Thermo Fisher Scientific Cat# 65001
Glycogen Thermo Fisher Scientific Cat# AM9510
T4 PNK New England Biolabs Cat# M0201
FastAP Thermo Fisher Scientific Cat# EF0651
RNA Ligase I New England Biolabs Cat# M0204
5′ Deadenylase New England Biolabs Cat# M0331
RecJf New England Biolabs Cat# M0264
gamma-32p-ATP Perkin Elmer Cat# NEG502Z250UC
UltraPure TBE Buffer Thermo Fisher Scientific Cat# 15581044
Hybond-N+ Membrane VWR Ca# 95038–376
PerfectHyb Plus Sigma Cat# H7033
UltraPure SSC Thermo Fisher Scientific Cat# 15557044
Acetonitrile, Optima LC/MS Grade Fisher Scientific Cat# A955–500
Trifluoroacetic acid for HPLC, ≥ 99.0% Sigma Cat# 302031
Formic Acid, 99.0+%, Optima LC/MS Grade Fisher Scientific Cat# A117–50
Ammonium bicarbonate Sigma Cat# A6141
Ammonium formate Sigma Cat# 70221
Water, Optima LC/MS Grade Fisher Scientific Cat# W6500
Isopropanol, Optima LC/MS Grade Fisher Scientific Cat# A461–500
Sodium ascorbate Sigma Cat# A7631
Trolox Sigma Cat# 238813
Sodium Azide Sigma Cat# S2002
Manganese(II) chloride Sigma Cat# 244589
Calcium chloride Sigma Cat# 499609
Magnesium chloride Sigma Cat# 63069
Biotin-aniline Iris Biotech GMBH Cat# LS-3970
TRIzol LS Thermo Fisher Scientific Cat# 10296028
rec-hSiglec-2 R&D Systems Cat# 1968-SL-050
rec-hSiglec-3 R&D Systems Cat# 1137-SL-050
rec-hSiglec-Mag R&D Systems Cat# 8940-MG-050
rec-hSiglec-5 R&D Systems Cat# 1072-SL-050
rec-hSiglec-6 R&D Systems Cat# 2859-SL-050
rec-hSiglec-7 R&D Systems Cat# 1138-SL-050
rec-hSiglec-8 R&D Systems Cat# 9045-SL-050
rec-hSiglec-9 R&D Systems Cat# 1139-SL-050
rec-hSiglec-10 R&D Systems Cat# 2130-SL-050
rec-hSiglec-11 R&D Systems Cat# 3258-SL-050
rec-hSiglec-14 R&D Systems Cat# 4905-SL-050
rec-hSiglec-15 R&D Systems Cat# 9227-SL-050
rec-hIgG1 R&D Systems Cat# 110-HG-100
Bovine Serum Albumin Sigma Cat# A9418
IRDye 680 RD Goat anti-Mouse IgG Li-Cor Biosciences Cat# 926–68070
AffiniPure Mouse Anti-Human IgG, Fcγ fragment specific Jackson ImmunoResearch Cat# 209–605-098
J2 antibody Scicons Cat# J2
FluoroFix Buffer BioLegend Cat# 422101
TrypLE Thermo Fisher Scientific Cat# 12604021
Trypsin LC-MS grade Promega Cat# V5117
Trypsin HyClone Cat# SH3004201
Trypsin Thermo Fisher Scientific Cat# 25300054
Trypsin Sigma Cat# T4174
Trypsin Sigma Cat# T4549
Trypsin Stem Cell Technologies Cat# 07901
Trypsin ATCC Cat# 30–2101

Critical commercial assays

ProteoExtract Native Membrane Protein
Extraction Kit
EMD Millipore Cat# 444810
Plasma Membrane Protein Extraction Kit Abcam Cat# ab65400
RNA Clean and Concentrator 5 Zymo Research Cat# R1013
Poly(A)Purist MAG Kit Thermo Fisher Scientific Cat# AM1922

Deposited data

Input- and ManNAz-seq from HeLa cells This Study Gene Expression Omnibus: GSE136967
Input- and ManNAz-seq from H9 ES cells This Study Gene Expression Omnibus: GSE136967

Experimental models: cell lines

HeLa ATCC Cat# ATCC-CCL-2
HEK293T ATCC Cat# ATCC-CRL-3216
K562 ATCC Cat# ATCC-CCL-243
T-ALL 4188 Lab of Dean Felsher (Stanford); Felsher and Bishop, 1999 N/A
H9 ES cells WiCell Cat# WA09
GM12878 Lab of Howard Chang (Stanford) N/A
K562GALE−/− Lab of Carolyn Bertozzi (Stanford); Schumann et al., 2020 N/A
CHO-K1 ATCC Cat# ATCC-CCL-61
ldlD-CHO Lab of Monty Krieger (MIT); Kingsley et al., 1986 N/A

Experimental models: organisms/strains

Mouse: C57BL/6 Jackson Laboratories N/A

Oligonucleotides

RNY5_gDNA_PCR_F:
GTTGATTAACATAATTCTTAC
This paper N/A
RNY5_gDNA_PCR_R:
CATTTTGAAGGTTAATACTTC
This paper N/A
sgRNA_RNY5–1_px458_F:
CACCGCACAGTTGGTCCGAGTGTTG
This paper N/A
HS_Y5_LNA:
aa+cag+caa+gct+agt+caa+gcg
This paper N/A
HS_5S_LNA:
cga+ccc+tgc+tta+gct+tcc+ga
This paper N/A
sgRNA_RNY5–1_px458_R:
AAACCAACACTCGGACCAACTGTGC
This paper N/A
sgRNA_RNY5–2_px458_F:
CACCGAAGCTAGTCAAGCGCGGTTG
This paper N/A
sgRNA_RNY5–2_px458_R:
AAACCAACCGCGCTTGACTAGCTTC
This paper N/A

Software and algorithms

R R Project https://www.r-project.org/
ggplot2 https://www.tidyverse.org/ https://ggplot2.tidyverse.org
DESeq2 Love et al., 2014 https://bioconductor.org/packages/release/bioc/html/DESeq2.html
FAST-iCLIP Flynn et al., 2015 https://github.com/ChangLab/FAST-iCLIP/tree/lite
CHOPCHOP Labun et al., 2019 https://chopchop.cbu.uib.no/
Adobe Illustrator CC Adobe https://www.adobe.com
GlycoNote Dr. Ming Qi Liu https://github.com/MingqiLiu/GlycoNote