Rapid Detection of Ophiostoma piceae and O. quercus in Stained Wood by PCR

Abstract

A rapid, sensitive, and simple method was developed to detect the sapstain fungi Ophiostoma piceae and O. quercus in stained wood. By using microwave heating for DNA extraction and PCR with internal transcribed spacer-derived-specific primers, detection was feasible within 4 h, even with DNA obtained from a single synnema. This method can easily be extended for the detection of other wood-inhabiting fungi.

Green softwood lumber exports to offshore markets are currently worth several billion dollars annually (2). These softwood shipments may contain a variety of microorganisms, including wood-inhabiting fungi, which could be unacceptable to receiving countries. In addition, countries developing their own softwood forests could impose restrictions on the importation of infected wood (3). Freshly-cut wood surfaces are rich in nutrients and provide niches for a variety of interacting microorganisms, such as fungi, mites, and insects. For example, sapstaining fungi that cause wood discoloration are responsible for considerable losses in revenue for the forest products industry. Organisms belonging to the Ophiostoma genus (Ascomycota) are the fungi that are most frequently isolated from stained wood (9). Developing and applying new fungal control processes and responding to international regulations for pathogens will require an understanding not only of the ecology and pathology of fungi that discolor wood but also of the ability to rapidly identify these organisms.

Presently, fungal identification is carried out by traditional methods. The infected wood is first incubated and sampled for fungi with selective media amended with antibiotics. The obtained isolates are then purified and transferred to a nutrient agar medium, where the morphological and biological characteristics of the isolates are recorded. When possible, the isolated organism is mated with sexually-compatible strains. The whole procedure is tedious and time-consuming (it can take up to 2 months) and requires mycological and taxonomical expertise. The quarantine of wood shipments can be very costly for the forest industry. A simple, quick, and reliable detection method would speed up the quarantine process and indicate whether additional treatment is required to protect the wood from pests. PCR techniques with fungal species-specific primers may provide such a solution (4, 6, 10).

Our aim in this work was to demonstrate the feasibility of PCR methods for the detection of sapstain fungi in wood samples. We selected O. piceae as our model organism, since this fungus is the most common sapstain species isolated from stained lumber and logs worldwide (9) and has been implicated as a biological control organism in the oak wilt disease cycle (7). Recently, this fungal species has been divided into two taxa, O. piceae, isolated mainly from softwood species, and O. quercus, isolated mainly from hardwood species (1, 5). In the first part of this study, we described how specific PCR primer pairs were generated for the two groups of organisms. Then we described the development of a quick genomic DNA preparation used in conjunction with the PCR procedure to directly detect O. piceae and O. quercus fungi in wood infected with known or unknown species.

DNA isolation, PCRs, cloning, and sequencing.

A list of the isolates used in this work is given in Table 1. The fungi were pregrown on 2% malt extract agar (MEA) for 7 to 10 days at 20°C. Spore suspensions prepared from MEA cultures were spread onto sterile sheets of cellophane that were overlayered onto the MEA plates. After 2 days of incubation at 20°C, about 0.3 g of mycelium was harvested from the cellophane sheet by scraping the surface with a scalpel. The harvested mycelium was stored in a 2-ml sterile cryogenic vial (Sarstedt, Nümbrecht, Germany). Total genomic DNA from the mycelium was extracted by drilling twice (2 min each time) on ice with a stainless steel bit that fit the vial exactly. Prior to drilling, the mycelium was suspended into 200 μl of buffer (50 mM Tris-HCl [pH 8.5], 50 mM EDTA, and 3% sodium dodecyl sulfate). Then, 150 μl of 3 M sodium acetate (pH 5.2) was added to the ground mycelium. The mixture was kept at −20°C for 10 min and centrifuged for 10 min at 13,800 × g. The supernatant was removed, mixed with an equal volume of isopropanol, incubated for 5 min at room temperature, and centrifuged again. The DNA pellet was washed with 70% ethanol, dissolved in TE buffer (10 mM Tris [pH 8.0], 1 mM EDTA), and used for PCR amplification.

TABLE 1.

Sapstain fungal species and isolates used in this study and results of PCR assay with respective O. piceae and O. quercus ITS-derived primer pairs, OPC1-OPC2 and OPH1-OPH2

Speciesa	Isolate	Host	Origin and sourceb	PCR amplificationc
O. piceae	HMIPC 14467	Spruce	Poland, reference 5	P
	HA378	Spruce	Sweden, reference 5	P
	H2009	Scotch pine	Austria, reference 1	P
	H2154	Pine	United Kingdom, reference 1	P
	JCM9364	Yezo spruce	Japan, Y.Y.	P
	JCM9365	Yezo spruce	Japan, Y.Y.	P
	AU56-5-2	Lodgepole pine	Canada, this study	P
	AU100-1	Black spruce	Canada, this study	P
	AU160-1	Hemlock	Canada, this study	P
	AU184-6	White spruce	Canada, this study	P
O. quercus	HMIPC 15807	Oak	Poland, reference 5	Q
	HA366	Oak	Austria, reference 5	Q
	H920	Oak	United Kingdom, reference 1	Q
	H1042	Oak	United Kingdom, reference 1	Q
	M52	Oak	United States, reference 7	Q
	M128	Oak	United States, reference 7	Q
	M176	Oak	United States, reference 7	Q
	AU13	Hemlock	Canada, this study	Q
	AU160-9	Hemlock	Canada, this study	Q
O. canum	NFRI 1652/2	Scotch pine	Norway, NFRI	—
	NFRI 60-165	Unknown	Norway, NFRI	—
O. minus	AU123-151	Jack pine	Canada, this study	—
	AU123-43-13	Jack pine	Canada, this study	—
	Forintek C248	Unknown	Canada, Forintek	—
O. ips	AU123-146	Jack pine	Canada, this study	—
	Forintek C852	Unknown	Canada, Forintek	—
O. piceaperdum	Op4/1B2	Unknown	Canada, this study	—
	DS1-5B-3	Unknown	Canada, this study	—
O. flexuosum	DS1/3B-2	Unknown	Canada, this study	—
	OS-4/1-A-1	Unknown	Canada, this study	—
O. piliferum	AU55-2	Lodgepole pine	Canada, this study	—
	AU80-3	Jack pine	Canada, this study	—
	AU156-112	Jack pine	Canada, this study	—
	AU199-4	Lodgepole pine	Canada, this study	—
Ceratocystis coerulescens	AU157-152	White spruce	Canada, this study	—
	AU125-214	White spruce	Canada, this study	—
Leptographium spp.	AU55-5	Lodgepole pine	Canada, this study	—
	AU71-15	Lodgepole pine	Canada, this study	—
	AU124-518	Black spruce	Canada, this study	—
Species C	AU82-1-1	Jack pine	Canada, this study	—
	AU156-211	Lodgepole pine	Canada, this study	—
	AU197-3	White spruce	Canada, this study	—
Species D	AU55-6-1	Lodgepole pine	Canada, this study	—
	AU160-21	Hemlock	Canada, this study	—
	AU160-28	White spruce	Canada, this study	—
Species E	AU57-2	Lodgepole pine	Canada, this study	—
	AU125-238	White spruce	Canada, this study	—
	AU197-8	Lodgepole pine	Canada, this study	—
Aureobasidium pullulans	AU72	Lodgepole pine	Canada, this study	—
	AU123-436	Jack pine	Canada, this study	—
	AU195-7	Lodgepole pine	Canada, this study	—
Penicillium sp.	AUPA	White spruce	Canada, this study	—
	AUPB	Jack pine	Canada, this study	—
	AUPC	Lodgepole pine	Canada, this study	—
Trichoderma sp.	AUTA	White spruce	Canada, this study	—
	AUTB	Jack pine	Canada, this study	—
	AUTC	Lodgepole pine	Canada, this study	—

^aSpecies C, D, and E are O. piceae-related species and can be clearly divided into different individual taxa based on their unique mating patterns (11). 

^bY.Y., Y. Yamaoka, Institute of Agriculture and Forestry, University of Tsukuba, Tsukuba, Ibaraki, Japan; NFRI, Norwegian Forest Research Institute culture collection, Høgskoleveien 12, N-1432 Ås, Norway; Forintek, Forintek Canada Corporation culture collection. 

^cP, amplification only with primer pair OPC1-OPC2; Q, amplification only with primer pair OPH1-OPH2; —, no amplification with primer pair OPC1-OPC2 or OPH1-OPH2. 

PCRs were performed in 0.6-ml Omnitubes with a Hybaid Touch Down thermal cycler. PCR mixtures (25 μl each) contained 5 to 30 ng of fungal genomic DNA, 20 pmol of each primer, 1× PCR buffer (10 mM Tris-Cl [pH 8.0], 1.5 mM MgCl₂, 50 mM KCl), 25 μM (each) of the four deoxynucleoside triphosphates, and 0.5 U of Taq polymerase (Appligene, Watford, United Kingdom). Thermal cycling conditions were as follows: initial denaturation (94°C, 4 min), 30 cycles of denaturation (94°C, 50 s), annealing (55°C, 50 s), and primer extension (72°C, 50 s), followed by one final cycle of primer extension (72°C, 5 min). Five microliters of the reaction product was analyzed by electrophoresis on a 1.4% agarose gel in Tris-acetate-EDTA buffer (TAE) with ethidium bromide and visualized under UV light.

The PCR-amplified DNA products were subcloned into pCR 2.1-TOPO vector (Invitrogen Co., Carlsbad, Calif.) according to the manufacturer’s instructions and sequenced. The sequencing reactions were carried out in a DNA thermal cycler (Perkin-Elmer Cetus) by using ABI AmpliTaq dye termination cycle sequencing chemistry. Nucleotide sequences were analyzed with the ABI 373 DNA sequencer (Applied Biosystems, Foster City, Calif.) and determined on both strands. Sequence alignments and comparisons were performed by using PC/Gene software (IntelliGenetics Inc.). Database searches were done by using the services provided by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov).

Developing PCR primer pairs specific for O. piceae and O. quercus.

To generate specific primer pairs, it was necessary to sequence the internal transcribed spacer (ITS) region of several strains. First, we used the universal primer pair ITS1 and ITS4 (12) to amplify the ITS and the 5.8S ribosomal DNA regions of O. piceae (isolates H2154, H2009, and AU100-1) and O. quercus (isolates AU13, AU160-9, and H920). The 650-bp DNA fragments were amplified (Fig. 1), subcloned, and sequenced. The identity of the DNA fragments sequenced as ITS1-5.8S-ITS2 regions of rDNA was confirmed by high sequence homology (95%) with other ITS regions of different Ophiostoma species. After comparison of these sequences with ITS region sequences of other Ophiostoma-related species, we designed an O. piceae-specific primer pair, OPC1 (5′ AGGGATCATTAGCGAGTTTTCAAC 3′) and OPC2 (5′ CCTCGAGAGGGTCGCCTGCG 3′), and an O. quercus-specific primer pair, OPH1 (5′ AGGGATCATTACAGAGTTTTTAAC 3′) and OPH2 (5′ TCTGCAAGCAGAGCCTCCTG 3′). The primers OPC1 and OPH1 were located on the regions between the 3′ end of the 18S and the 5′ end of ITS1, while the primers OPC2 and OPH2 were located close to the 3′ end of the ITS2 region. The two ITS-derived primer pairs targeted O. piceae and O. quercus DNA (Fig. 1). The amplified bands corresponded to the expected size of 560 bp, calculated from the DNA sequence information. The identity of the amplified DNA bands as ITS fragments was confirmed by Southern hybridization with the [γ-³²P]ATP-labeled ITS1-5.8S-ITS2 insert DNA (650 bp) subcloned in pCR 2.1-TOPO vector used as a probe (data not shown). The presence and absence of bands matched with the intended specificity of the primer pairs.

FIG. 1.

Gel electrophoresis of PCR products from O. piceae (lanes 1, 3, and 5) and O. quercus (lanes 2, 4, and 6) with primer pairs ITS1-ITS4, OPC1-OPC2, and OPH1-OPH2. Lane M, 1-kb ladder (Gibco BRL).

The specificity of the designed primers was further tested by using PCR on the genomic DNA of a broad selection of isolates which were concomitantly isolated with O. piceae during a survey study of sapstaining fungi (11). The results, shown in Table 1, confirmed that the OPC1-OPC2 and the OPH1-OPH2 primer pairs amplified only the targeted DNA fragments of the O. piceae and O. quercus isolates, respectively. To confirm that the lack of amplification in the other species was due not to the quality of the DNA extracted but to the absence of specificity of the primers used, we also tried to PCR amplify a region of the 18S rDNA, using the universal rDNA primer pair NS1 and NS8 (12). For all the isolates listed in Table 1, we successfully amplified 1.7-kb bands corresponding to the 18S rDNA region (data not shown), confirming that the quality of the DNA was appropriate for PCR amplification and that the lack of amplification in other species could be related to the primers’ specificity for O. piceae or O. quercus.

Detecting O. piceae and O. quercus directly in wood samples.

To develop an efficient and rapid detection system, it is desirable to directly extract fungal DNA from infected samples and to minimize the time required for DNA extraction. Consequently, we assessed the feasibility of using a microwave to extract DNA directly from spores or mycelium produced on artificial media and wood. In this preliminary experiment, only O. quercus (AU13) was used. The organism was grown on MEA for 10 days. About 0.2 μl of the spore mass was taken from the top of synnemata with the tip of a pipetman and transferred into 0.5-ml microcentrifuge tubes. The tubes were capped and heated in a microwave for 5 min at 700 W. To each tube, 30 μl of ice-cold TE buffer was added. The tubes were then vortexed for 1 min and centrifuged at 13,800 × g for 1 min at 4°C. Without additional extraction steps, the supernatant (5 or 10 μl) was used directly for PCRs with the OPH1-OPH2 primer pair. The PCR produced the ITS rDNA fragment as shown in lane 6 of Fig. 1. We found that culture age affected the band intensity of the PCR products and that DNA prepared from a younger culture produced a stronger band (Fig. 2A). In this set of preliminary experiments, we also assessed the effects of various microwave heating times (30, 60, 180, 240, and 300 s). Usually, heating the sample in the microwave for 60 s was enough to extract and amplify the DNA. However, a heating time of 300 s gave more consistent results and thus was used in all of our experiments. Using this DNA extracting method, we were able to repeatedly amplify the O. quercus ITS rDNA from a spore mass at the tip of a single synnema. The minimum number of spores needed for PCR amplification by this method was 10².

FIG. 2.

Gel electrophoresis of PCR products obtained with template DNAs prepared by a microwave heating method. (A) PCRs with primers OPH1-OPH2 and template DNAs from O. quercus at different culture ages (in days): lane 1, 6; lane 2, 12; and lane 3, 18. (B) PCRs with primers NL1-NL2 and template DNAs from different species. Lanes: 1, O. canum; 2, O. flexuosum; 3, O. ips; 4, O. minus; 5, O. piceaperdum; 6, O. piliferum; 7, species C; 8, species D; 9, species E; M, 1-kb ladder (Gibco BRL).

To test the relevance of this rapid DNA extraction method on a variety of sapstaining fungi, we used the universal NL1-NL2 primer pair that targets a region of 350 bp in the 26S rDNA gene (8). We did not have specific primer pairs for all of the Ophiotoma species used in this work. This region was amplified in all the fungal strains listed in Table 1. Examples of the PCR-amplified products are shown in Fig. 2B. The results suggested that PCR detection of sapstaining fungi is feasible with DNA extracted by a microwave. However, specific primers or DNA probes need to be generated for the different Ophiostoma species.

We also tested our methodology with fungal species grown on and sampled directly from wood. Spore suspensions of O. piceae, O. quercus, and four other Ophiostoma species (species C, D, and E and a Leptographium sp.) were artificially inoculated, individually or as a mixture, onto noninfected surface-sterilized lodgepole pine slabs and logs. After a 2-week incubation period, synnemata were sampled from each inoculated-wood sample. We were able to rapidly detect O. quercus or O. piceae from both the individual and the mix-inoculated wood by PCR with the OPH1-OPH2 or the OPC1-OPC2 primer pair, respectively. The method was also tested with samples collected from naturally-infected lodgepole pine lumber or logs. Sixty-five unidentified spore samples were collected in microcentrifuge tubes by using sterile forceps. A single synnema head was collected, and DNA extraction was performed as described above. During the sampling, one part of each spore head was deposited into the tube, and the other part was streaked onto MEA medium to grow the fungal isolate and carry out identification by the classical method, based on morphology. A PCR product of the expected size (560 bp) was produced by a total of 23 samples with the OPC1 and OPC2 primer pair. All PCR detection was completed in a period of less than 4 h. Figure 3 shows examples of PCR results for randomly-selected unidentified samples. The samples in lanes 1, 3, and 7 produced the expected 560-bp band, suggesting that they are likely O. piceae. A month later these results were compared with those from the morphology-based identification. Five different fungal species, including O. piceae, were morphologically identified from the 65 samples. All 23 samples, including the 3 samples shown in lanes 1, 3, and 7 in Fig. 3, were identified as O. piceae. These results demonstrated that simple DNA extraction of a single synnema, followed by PCR amplification, was feasible not only with fungal culture grown in artificial media but also with stained wood from a sawmill.

FIG. 3.

Examples of direct detection of O. piceae by PCR amplification of ITS rDNA with primers OPC1-OPC2 in stained wood. Lanes 1 to 8, randomly selected, unidentified spore samples collected from a sawmill; lane M, 1-kb ladder (Gibco BRL).

Conclusions.

We have developed two ITS-derived primer pairs, OPC1-OPC2 and OPH1-OPH2, that were specific for and detected fungal species O. piceae and O. quercus, respectively, not only in artificial media but also on stained wood. The method described in this study has a number of advantages. First, this method does not necessitate the growth of organisms in artificial media, thus saving considerable time and money. Second, the simple and rapid DNA extraction method eliminates the tedious steps of freezing and grinding the mycelium, treating extracts with RNase and phenol, and precipitating the DNA with ethanol. Third, the possible cross-contamination of isolates during the sampling procedure is less likely when species-specific primers are used. Our only limitation at present is the lack of specific primers for the remaining species. We look forward to the widespread use of our on-site detection approach in the forest industry when more specific primers become available.

Nucleotide sequence accession numbers.

The sequences of the ITS regions obtained in this study have been submitted to the GenBank database under accession no. AF081129, AF081130, and AF081131 for O. piceae AU100-1, H2009, and H2154, respectively, and AF081132, AF081133, and AF081134 for O. quercus AU160-9, AU13, and H920, respectively.