Abstract
Background
Long noncoding RNA GAS5 (lnc‐GAS5) is able to regulate macrophage M1 polarization and Th17 cell differentiation, also engaged in sepsis‐induced inflammation and organ injury. This study aimed to further evaluate its linkage with Th1 cells and Th17 cells, as well as its clinical value in sepsis management.
Methods
About 101 sepsis patients were enrolled followed by peripheral blood mononuclear cell (PBMC) and serum samples collection. PBMC lnc‐GAS5 was detected by RT‐qPCR; Th1 cells and Th17 cells in PBMC CD4+ T cells were detected by flow cytometry; serum IFN‐γ and IL‐17A were detected by ELISA. Besides, PBMC lnc‐GAS5 was also detected in 50 health controls (HCs).
Results
Lnc‐GAS5 was reduced in sepsis patients than in HCs (p < 0.001), which also well‐distinguished sepsis patients from HCs with AUC 0.860. Lnc‐GAS5 did not relate to Th1 cells (p = 0.059) or IFN‐γ (p = 0.192); while negatively linked with Th17 cells (p = 0.002) and IL‐17A (p = 0.019) in sepsis patients. Interestingly, lnc‐GAS5 negatively correlated with SOFA score (p = 0.001), SOFA‐Respiratory system score (p = 0.001), SOFA‐Coagulation score (p = 0.015), and SOFA‐Renal system score (p = 0.026), but not SOFA‐Liver score (p = 0.080), SOFA‐Cardiovascular system score (p = 0.207) or SOFA‐Nervous system score (p = 0.182) in sepsis patients. Furthermore, lnc‐GAS5 was negatively related to CRP (p = 0.002) and APACHE II score (p = 0.004) in sepsis patients. Finally, lnc‐GAS5 was decreased in dead sepsis patients compared to survivors (p = 0.007), which also distinguished sepsis deaths from survivors with AUC 0.713.
Conclusion
Lnc‐GAS5 relates to Th17 cells and serves as a potential biomarker for sepsis severity and mortality risk.
Keywords: APACHE II, LncRNA GAS5, mortality risk, SOFA and its subscales, Th1 and Th17 cells
One hundred‐one sepsis patients were enrolled for detecting lnc‐GAS5, Th1 cells, Th17 cells, IFN‐γ and IL‐17A. Besides, 50 health controls (HCs) were also enrolled for detecting lnc‐GAS5. Lnc‐GAS5 was reduced in sepsis patients than in HCs. Lnc‐GAS5 negatively linked with Th17 cells and IL‐17A; negatively correlated with SOFA score, SOFA‐Respiratory system score, SOFA‐Coagulation score and SOFA‐Renal system score; negatively related to CRP and APACHE II score in sepsis patients. Lnc‐GAS5 decreased in died sepsis patients compared to survivors.
1. INTRODUCTION
Sepsis is featured by life‐threatening organ dysfunction with an extremely dysregulated host response to infection. 1 The mortality of sepsis is unacceptably high with 28 days mortality ranging from 8.5% to 31.6%, whose prevention and treatment have been regarded as a global health priority by the World Health Organization (WHO), recently.2, 3, 4, 5, 6, 7, 8, 9 With a deepened understanding of the pathogenesis of sepsis, the differentiation of T cells, polarization of macrophage, and the inflammation response are thought to be closely involved in the development and progression of sepsis,10, 11, 12 therefore, finding a biomarker that might regulate these aforementioned biological processes during sepsis is helpful for the management of sepsis to further improve its prognosis.
Long noncoding RNA GAS5 (lnc‐GAS5) is firstly reported to act as a regulator of the malignant phenotype of cancer cells.13, 14 However, with more comprehensive studies being performed, its anti‐inflammation role has been proposed. Recent studies disclose that lnc‐GAS5 inhibits the differentiation of T cells into Th17 cells, macrophage M1 polarization while promotes macrophage M2 polarization, and restrains the inflammation as well as sepsis‐induced organ injury in multi‐complex diseases, which implies that it might be engaged in the pathogenesis of sepsis.15, 16, 17, 18, 19, 20, 21 Nevertheless, the clinical involvement of lnc‐GAS5 in sepsis remains unclear. Hence, this study aimed to further evaluate its linkage with Th1 cells and Th17 cells, as well as its clinical value in sepsis management.
2. METHODS
2.1. Subjects
This study was a prospective cohort study. This study serially enrolled 101 sepsis patients who were treated in our hospital from July 2018 to January 2021. The patients with the following criteria were eligible for the study: (A) confirmed as sepsis according to the sepsis‐3 criteria published in 2016, 22 (B) more than 18 years old, (C) were hospitalized within 24 h of symptom onset. The exclusion criteria included: (A) had cancer or hematological disease, (B) had a prior history of radiotherapy, chemotherapy or immunotherapy, (C) concomitant with autoimmune disease (these patients might have a dysregulated lnc‐GAS5 expression), (D) women with pregnant or lactating. For comparison, the study also enrolled 50 healthy subjects without clinical evidence of infection as healthy controls during the same period. The enrollment criteria for healthy controls were (A) matched age and gender to sepsis subjects, (B) no history of sepsis, (C) normal biochemical indexes level. Besides, the healthy controls were also ineligible for the study if they met the above exclusion criteria for sepsis patients. The study was approved by the Ethics Committee of Longhua Hospital Affiliated with Shanghai University of Traditional Chinese Medicine. The written informed consents were collected from all subjects or their legal guardians.
2.2. Data collection
After enrollment, clinical features were collected, including demographics, comorbidities, disease characteristics, biochemistry indexes, Acute Physiology and Chronic Health Evaluation II (APACHEII) score and Sepsis‐related Organ Failure Assessment (SOFA) score. Besides, all sepsis patients were followed up for 28 days, and the deaths of patients within 28 days were recorded.
2.3. Sample collection
For sepsis patients, peripheral blood (PB) samples were collected immediately after admission, then peripheral blood mononuclear cells (PBMCs) and serum were isolated, respectively. In detail, PBMCs were isolated from peripheral blood with a density gradient technique; serum was isolated by centrifugal separation at 1000 g for 20 min. For healthy controls, PB samples were collected immediately after enrollment, then PBMCs were also separated from peripheral blood with a density gradient technique.
2.4. Flow cytometry
Within 12h after PBMCs separation in sepsis patients, The CD4 positive (CD4+) T cells, Th1 cells and Th17 cells in PBMCs were labeled with specific fluorescent antibody in HumanTh1/Th17 Phenotyping Kit (BD Pharmingen™, BD,), and the labeled cells were counted by flow cytometry analysis. Then, the proportion of Th1 and Th17 cells in CD4+ T cells was calculated. The detailed experimentation was strictly in accordance with the manufacturer's instructions.
2.5. Enzyme‐linked immunosorbent assay (ELISA)
After serum isolation in sepsis subjects, the level of interferon‐gamma (IFN‐γ) and Interleukin 17A (IL‐17A) were measured by ELISA using Human IFN‐γ Quantikine ELISA Kit and Human IL‐17A Quantikine ELISA Kit (R&D Systems Europe, Ltd.,), respectively. All experiments were carried out based on the direction of instructions.
2.6. Reverse transcription quantitative polymerase chain reaction (RT‐qPCR) assay
After PBMC separation in all subjects, lnc‐GAS5 expression was assessed by RT‐qPCR assay. The total RNA isolation and subsequent reverse transcription were conducted by PureZOL RNA isolation reagent (Bio‐Rad, Hercules) and PrimeScript™ RT reagent Kit (Takara, Dalian), respectively. Then, a qPCR assay was carried out by SYBR® Green Realtime PCR Master Mix (Toyobo,). The β‐actin was used as the internal reference with a 2−ΔΔCt method for the calculation of the lnc‐GAS5 expression. The primers were designed according to the previous study. 23 In detail, the sequence of primers was as follows: lnc‐GAS5, forward primer (5'‐>3’): TGAAGTCCTAAAGAGCAAGCC, reverse primer (5'‐>3’): ACCAGGAGCAGAACCATTAAG; β‐actin, forward primer (5'‐>3’): TCGTGCGTGACATTAAGGAG, reverse primer (5'‐>3’): GTCAGGCAGCTCGTAGCTCT.
2.7. Statistics
SPSS (24.0 version, IBM Corp.,) was employed for statistical analysis, and GraphPad Prism (6.01 version, GraphPad Software Inc.,) was applied for graph construction. Differences of variates between groups were compared using Mann–Whitney U test. Associations between variates were analyzed using Spearman's rank correlation test, Mann–Whitney U test or Kruskal–Wallis H rank sum test. The ability of variables in distinguishing different subjects was estimated using receiver operating characteristic (ROC) curve analysis. Logistic regression analysis was performed to explore the independent factor predicting the sepsis risk. p value less than 0.05 was considered statistical significance.
3. RESULTS
3.1. Clinical features
Among the 101 enrolled sepsis patients, their age was 57.1 ± 11.7 years with 71 (70.3%) males and 30 (29.7%) females (Table 1). In terms of their primary infection site, 33 (32.7%), 31 (30.7%), 18 (17.8%), and 19 (18.8%) patients were diagnosed with abdominal infection, respiratory infection, skin and soft tissue infection, as well as other infections. Regarding the primary organism, 53 (52.5%), 23 (22.8%), 7 (6.9%), and 16 (15.8%) patients were diagnosed as G−, G+, fungus, and other organism‐caused infection, while the rest 17 (16.8%) patients were total culture negative. The APACHE II score was 11.5 ± 5.5, meanwhile, the SOFA score was 4.7 ± 1.9. Other detailed information was listed in Table 1.
TABLE 1.
Clinical features
| Items | Sepsis patients (N = 101) |
|---|---|
| Demographics | |
| Age (years), mean ± SD | 57.1 ± 11.7 |
| Gender, No. (%) | |
| Female | 30 (29.7) |
| Male | 71 (70.3) |
| BMI (kg/m2), mean ± SD | 22.8 ± 3.7 |
| Smoke status, No. (%) | |
| Never | 65 (64.3) |
| Former | 23 (22.8) |
| Current | 13 (12.9) |
| Comorbidities | |
| History of hypertension, No. (%) | 42 (41.6) |
| History of hyperlipidemia, No. (%) | 15 (14.9) |
| History of diabetes, No. (%) | 9 (8.9) |
| History of CKD, No. (%) | 7 (6.9) |
| History of cardiovascular and cerebrovascular diseases, No. (%) | 15 (14.9) |
| Disease characteristics | |
| Primary infection site, No. (%) | |
| Abdominal infection | 33 (32.7) |
| Respiratory infection | 31 (30.7) |
| Skin and soft tissue infection | 18 (17.8) |
| Other infections | 19 (18.8) |
| Primary organism, No. (%) | |
| G− | 53 (52.5) |
| G+ | 23 (22.8) |
| Fungus | 7 (6.9) |
| Others | 16 (15.8) |
| Total culture negative | 17 (16.8) |
| Biochemistry indexes | |
| Scr (mg/dL), median (IQR) | 1.5 (1.1–2.5) |
| Albumin (g/L), median (IQR) | 26.1 (20.8–35.3) |
| WBC (109/L), median (IQR) | 21.3 (14.5–31.3) |
| CRP (mg/L), median (IQR) | 68.7 (35.4–106.8) |
| Health status scores | |
| APACHE II score, mean ± SD | 11.5 ± 5.5 |
| SOFA score, mean ± SD | 4.7 ± 1.9 |
Abbreviations: APACHE II, Acute Physiology and Chronic Health Evaluation II; BMI, body mass index; CKD, chronic kidney disease; CRP, C‐reactive protein; G‐, gram‐negative bacillus; G+, gram‐positive bacillus; IQR, interquartile range; Scr, serum creatinine; SD, standard deviation; SOFA, Sequential Organ Failure Assessment; WBC, white blood cell.
3.2. lnc‐GAS5 expression
lnc‐GAS5 expression was decreased in sepsis patients compared with healthy controls (0.410 (interquartile range (IQR): 0.249–0.711) vs. 1.007 (IQR: 0.732–1.497), p < 0.001, Figure 1A). The further ROC curve analysis disclosed that lnc‐GAS5 exhibited a good diagnosis value of sepsis with an area under the curve (AUC): 0.860 (95% confidential interval (CI): 0.801–0.920, Figure 1B). Besides, a logistic regression analysis was also performed, which showed that lnc‐GAS5 was an independent factor in predicting the sepsis risk (Table S1).
FIGURE 1.
lnc‐GAS5 in distinguishing sepsis patients from healthy controls. Comparison of lnc‐GAS5 expression between sepsis patients and healthy controls (A). The ability of lnc‐GAS5 in differentiating sepsis patients from healthy controls (B)
3.3. Correlation of lnc‐GAS5 with the Th cells, organ injuries, and inflammatory status
lnc‐GAS5 was not associated with Th1 cells or IFN‐γ (both p > 0.05), while negatively correlated with Th17 cells (rs = −0.299, p = 0.002) and IL‐17A (rs = −0.233, p = 0.019, Figure 2A–D). Apart from that, it was observed that lnc‐GAS5 negatively related to SOFA score (rs = −0.313, p = 0.001), and some of its subitems including SOFA‐Respiratory system score (rs = −0.316, p = 0.001), SOFA‐Coagulation score (rs = −0.242, p = 0.015), and SOFA‐Renal system score (rs = −0.222, p = 0.026); but not correlated with SOFA‐Liver score, SOFA‐Cardiovascular system score, or SOFA‐Nervous system score (all p > 0.05, Figure 3A–G). Besides, it was also disclosed that lnc‐GAS5 was negatively associated with C‐reactive protein (CRP) (rs = −0.299, p = 0.002) and APACHE II score (rs = −0.286, p = 0.004, Figure 4A–B).
FIGURE 2.
lnc‐GAS5 correlates with Th17 cells and IL‐17A in sepsis patients. Correlation of lnc‐GAS5 expression with Th1 (A), IFN‐γ (B), Th17 cells (C), IL‐17A (D) in sepsis patients
FIGURE 3.
lnc‐GAS5 correlates with SOFA score and some of its subitems. Correlation of lnc‐GAS5 expression with SOFA score (A), SOFA‐Respiratory system score (B), SOFA‐Coagulation score (C), SOFA‐Liver score (D), SOFA‐Cardiovascular system score (E), or SOFA‐Nervous system score (F), and SOFA‐Renal system score (G) in sepsis patients
FIGURE 4.
lnc‐GAS5 correlates with CRP and APACHE II score. Correlation of lnc‐GAS5 expression with CRP (A) and APACHE II score (B) in sepsis patients
The correlation of lnc‐GAS5 expression with other clinical features was also of great interest in this study, which indicated that elevated lnc‐GAS5 expression was associated with the fungus negative (p = 0.031), while lnc‐GAS5 expression was not correlated with other clinical features (all p > 0.05, Table S2).
3.4. lnc‐GAS5 in predicting the 28‐day mortality
lnc‐GAS5 was decreased in sepsis deaths compared with sepsis survivors (p = 0.007), while the Th1 cells (p = 0.017), Th17 cells (p = 0.004), and IL‐17A (p = 0.003) were elevated in sepsis deaths compared with sepsis survivors; the IFN‐γ was of no difference between sepsis deaths and sepsis survivors (p = 0.128, Figure 5A–E). Further ROC curve analysis exhibited that lnc‐GAS5 (AUC: 0.713), Th1 cells (AUC: 0.688), Th17 cells (AUC: 0.725), IFN‐γ (AUC: 0.620), IL‐17A (AUC: 0.735), CRP (AUC: 0.753), APACHE II score (AUC: 0.849) and SOFA score (AUC: 0.785) could predict the 28 days mortality risk (Figure 6A–C).
FIGURE 5.
lnc‐GAS5, Th1 cells, IFN‐γ, Th17 cells, and IL‐17A in sepsis deaths and survivors. Comparison of lnc‐GAS5 (A), Th1 cells (B), IFN‐γ (C), Th17 cells (D), and IL‐17A (E) between sepsis deaths and sepsis survivors
FIGURE 6.
lnc‐GAS5 and other indexes in estimating the 28‐day mortality in sepsis patients. The ability of lnc‐GAS5 (A); Th1 cells, Th17 cells, IFN‐γ, and IL‐17A (B); CRP, APACHE II score, and SOFA score (C) in predicting the sepsis patients with 28‐day mortality
4. DISCUSSION
Sepsis is featured by the extremely high mortality which is regarded as a global health priority by the WHO, therefore, it is urgent to find the biomarker involving the development and progression of sepsis to stratify the patients and individualize their treatment, which might help to improve the prognosis of sepsis patients.1, 2, 3, 4, 5, 6 Previous studies have reported the regulation role of lnc‐GAS5 in sepsis.18, 24 For instance, one study shows lnc‐GAS5‑mediated miR‑23a‑3p promotes inflammation and cell apoptosis by targeting TLR4 in a cell model of sepsis. Another study indicates that lnc‐GAS5 aggravates myocardial depression in mice with sepsis via the microRNA‐449b/HMGB1 axis and the NF‐κB signaling pathway. However, these studies are performed in vivo or in vitro, no study detects the clinical role of lnc‐GAS5 in sepsis patients. Therefore, this study is conducted.
The lnc‐GAS5 has been reported to be involved in regulating macrophage polarization, Treg cell differentiation, and inflammation in various inflammation‐related diseases. For instance, in childhood pneumonia, lnc‐GAS5 might regulate the Treg/Th17 imbalance by targeting the miR‐217/STAT5 axis. 15 Another study exhibits that in monocytes, knockdown of lnc‐GAS5 might downregulate the macrophage M2 surface markers and concomitant increase in M1 markers, which implies that lnc‐GAS5 could promote the polarization of macrophage to M2 type but inhibit its polarization to M1 type. 21 T cell differentiation into Th1 cell and Th17 cell plays an important role in the pathogenesis role in sepsis.25, 26 For instance, one study shows that Th17 cells induced immunosuppression plays a vital role in sepsis. 25 In our study, we found that lnc‐GAS5 negatively correlated with Th17 cell and its secreted inflammatory cytokine (IL‐17A), also it negatively associated with CRP which might be explained that (1) lnc‐GAS5 inhibited the T cell differentiation into Th17 cells, therefore it negatively associated with Th17 cells and IL‐17A in sepsis, and (2) lnc‐GAS5 restrained the inflammatory response, hence, it negatively correlated with CRP level in sepsis patients.
lnc‐GAS5 serves as a biomarker in indicating the tissue injury in various complex disease, such as the Parkinson's disease, spinal cord injury, sepsis, and ischemic stroke.17, 27, 28, 29 While the relationship of lnc‐GAS5 with sepsis‐induced organ injury has not been reported. In this study, we found that lnc‐GAS5 negatively related to SOFA score, SOFA‐Respiratory system score, SOFA‐Coagulation score, SOFA‐Renal system score. The possible reason might be that: (1) lnc‐GAS5 inhibited the hypoxia‐induced pulmonary arterial smooth muscle cell proliferation by regulating KCNK3 expression, therefore lnc‐GAS5 played a protective role in the lung injury model. Hence, lnc‐GAS5 is negatively related to SOFA‐Respiratory system score, 30 (2) lnc‐GAS5 might inhibit the renal cell pyroptosis in sepsis‐induced renal injury though inhibiting miR‐579‐3p to activate SIRT1/PGC‐1 alpha/Nrf2 signaling pathway, therefore, lnc‐GAS5 negatively associated with SOFA‐Renal system score, 17 (3) lnc‐GAS5 could inhibit the inflammatory process, which might regulate the coagulation process, therefore, the lnc‐GAS5 was related to the SOFA‐Coagulation score. However, this hypothesis needed further exploration.
The correlation of lnc‐GAS5 with mortality in sepsis patients is also of great concern. However, up to now, there is still no study reports this issue. In the present study, we showed that lnc‐GAS5 was decreased in sepsis deaths compared with sepsis survivors, also, it had an ability in estimating the 28 days mortality in sepsis. These findings might be explained as follows: lnc‐GAS5 was related to the outbreak of inflammation and multi‐organ injury such as lung injury and renal injury, whose injury was associated with higher mortality risk in sepsis patients, therefore, lnc‐GAS5 could predict the 28 days mortality of sepsis patients.17, 30
Several limitations were nonnegligible in this study. Firstly, the lnc‐GAS5 was only detected after the enrollment of all subjects, while its multi‐time point detection to monitor the progression of sepsis patients was needed and should be conducted in further study. Secondly, a detailed mechanism of lnc‐GAS5 in sepsis was not investigated. Thirdly, even though 101 sepsis were enrolled, the sample size was still small, which may cause insufficient statistical power. Fourthly, the correlation of lnc‐GAS5 with macrophage polarization should be determined in further study. Fifthly, the quantification of lnc‐GAS5 was relative but not absolute value, which was a little far from the clinical utility; therefore, further study with the absolute‐quantification method was needed. Sixthly, the number of sepsis deaths was low, thus the statistical power of data about the comparison of lnc‐GAS5 between septic survivors and septic deaths might be insufficient, which should be validated in a larger‐sample‐size study.
In conclusion, lnc‐GAS5 relates to Th17 cells, and serves as a potential biomarker for sepsis‐induced multi‐organ injury and mortality risk; therefore, helps the clinicians to stratify the sepsis patients and individualize their treatment.
CONFLICTS OF INTEREST
The authors declare that they have no competing interests.
Supporting information
Table S1
Table S2
ACKNOWLEDGMENTS
This study was supported by three‐year action plan for further accelerating the development of traditional Chinese medicine in Shanghai: Construction of collaborative response and intervention platform for Chinese and Western medicine in major critical medical events in Shanghai [ZY(2018‐2020)‐FWTX‐7004].
Zhang W, Chen B, Chen W. LncRNA GAS5 relates to Th17 cells and serves as a potential biomarker for sepsis inflammation, organ dysfunctions and mortality risk. J Clin Lab Anal. 2022;36:e24309. doi: 10.1002/jcla.24309
Weizhen Zhang and Bingqing Chen contributed equally to this work.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available from the corresponding author upon reasonable request.
REFERENCES
- 1. Hotchkiss RS, Moldawer LL, Opal SM, Reinhart K, Turnbull IR, Vincent JL. Sepsis and septic shock. Nat Rev Dis Primers. 2016;2:16045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Gong Y, Yan X, Sun X, Chen T, Liu Y, Cao J. Oncostatin M Is a prognostic biomarker and inflammatory mediator for sepsis. J Infect Dis. 2020;221(12):1989‐1998. [DOI] [PubMed] [Google Scholar]
- 3. Fleischmann C, Scherag A, Adhikari NK, et al. Assessment of Global Incidence and Mortality of Hospital‐treated sepsis. current estimates and limitations. Am J Respir Crit Care Med. 2016;193(3):259‐272. [DOI] [PubMed] [Google Scholar]
- 4. Wardhana A, Djan R, Halim Z. Bacterial and antimicrobial susceptibility profile and the prevalence of sepsis among burn patients at the burn unit of cipto mangunkusumo hospital. Ann Burns Fire Disasters. 2017;30(2):107‐115. [PMC free article] [PubMed] [Google Scholar]
- 5. Machado FR, Cavalcanti AB, Bozza FA, et al. The epidemiology of sepsis in Brazilian intensive care units (the sepsis PREvalence assessment database, SPREAD): an observational study. Lancet Infect Dis. 2017;17(11):1180‐1189. [DOI] [PubMed] [Google Scholar]
- 6. Reinhart K, Daniels R, Kissoon N, Machado FR, Schachter RD, Finfer S. Recognizing Sepsis as a global health priority ‐ a WHO resolution. N Engl J Med. 2017;377(5):414‐417. [DOI] [PubMed] [Google Scholar]
- 7. Zeng Q, He L, Zhang N, Lin Q, Zhong L, Song J. Prediction of 90‐day mortality among sepsis patients based on a nomogram integrating diverse clinical indices. Biomed Res Int. 2021;2021:1023513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Mewes C, Alexander T, Buttner B, et al. Effect of the lymphocyte activation gene 3 polymorphism rs951818 on mortality and disease progression in patients with sepsis‐a prospective genetic association study. J Clin Med. 2021;10(22):5302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Akatsuka M, Masuda Y, Tatsumi H, Sonoda T. Efficacy of intravenous immunoglobulin therapy for patients with sepsis and low immunoglobulin G levels: a single‐center retrospective study. Clin Ther. 2022;S0149‐2918(21):00501‐00504. [DOI] [PubMed] [Google Scholar]
- 10. Zhang Y, Cheng J, Su Y, Li M, Wen J, Li S. Cordycepin induces M1/M2 macrophage polarization to attenuate the liver and lung damage and immunodeficiency in immature mice with sepsis via NF‐kappaB/p65 inhibition. J Pharm Pharmacol. 2021;74(2):227‐235. [DOI] [PubMed] [Google Scholar]
- 11. Liu P, Xiao Z, Yan H, et al. Baicalin suppresses Th1 and Th17 responses and promotes Treg response to ameliorate sepsis‐associated pancreatic injury via the RhoA‐ROCK pathway. Int Immunopharmacol. 2020;86:106685. [DOI] [PubMed] [Google Scholar]
- 12. Chen X, Liu Y, Gao Y, Shou S, Chai Y. The roles of macrophage polarization in the host immune response to sepsis. Int Immunopharmacol. 2021;96:107791. [DOI] [PubMed] [Google Scholar]
- 13. Wang X, Guo P, Tian J, et al. LncRNA GAS5 participates in childhood pneumonia by inhibiting cell apoptosis and promoting SHIP‐1 expression via downregulating miR‐155. BMC Pulm Med. 2021;21(1):362. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Miao Y, Chen X, Qin M, Zhou W, Wang Y, Ji Y. lncRNA GAS5, as a ceRNA, inhibits the proliferation of diffuse large Bcell lymphoma cells by regulating the miR18a5p/RUNX1 axis. Int J Oncol. 2021;59(5):94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Chi X, Guo Y, Zhang L, et al. Long non‐coding RNA GAS5 regulates Th17/Treg imbalance in childhood pneumonia by targeting miR‐217/STAT5. Cell Immunol. 2021;364:104357. [DOI] [PubMed] [Google Scholar]
- 16. Li J, Tian J, Lu J, et al. LncRNA GAS5 inhibits Th17 differentiation and alleviates immune thrombocytopenia via promoting the ubiquitination of STAT3. Int Immunopharmacol. 2020;80:106127. [DOI] [PubMed] [Google Scholar]
- 17. Ling H, Li Q, Duan ZP, Wang YJ, Hu BQ, Dai XG. LncRNA GAS5 inhibits miR‐579‐3p to activate SIRT1/PGC‐1alpha/Nrf2 signaling pathway to reduce cell pyroptosis in sepsis‐associated renal injury. Am J Physiol Cell Physiol. 2021;321(1):C117‐C133. [DOI] [PubMed] [Google Scholar]
- 18. Gao Z, Huang D. lncRNA GAS5mediated miR23a3p promotes inflammation and cell apoptosis by targeting TLR4 in a cell model of sepsis. Mol Med Rep. 2021;24(1):510. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Li M, Zhang Z, Liu B, Chen L, Wang M. LncRNA GAS5 upregulates miR‐214 through methylation to participate in cell apoptosis of sepsis. Arch Physiol Biochem. 2020;1‐6. [DOI] [PubMed] [Google Scholar]
- 20. Zhang Y, Lu X, Yang M, Shangguan J, Yin Y. GAS5 knockdown suppresses inflammation and oxidative stress induced by oxidized low‐density lipoprotein in macrophages by sponging miR‐135a. Mol Cell Biochem. 2021;476(2):949‐957. [DOI] [PubMed] [Google Scholar]
- 21. Ahmad I, Valverde A, Naqvi RA, Naqvi AR. Long Non‐coding RNAs RN7SK and GAS5 Regulate Macrophage Polarization and Innate Immune Responses. Front Immunol. 2020;11:604981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Singer M, Deutschman CS, Seymour CW, et al. The third international consensus definitions for sepsis and septic shock (sepsis‐3). JAMA. 2016;315(8):801‐810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Fang X, Zhong G, Wang Y, Lin Z, Lin R, Yao T. Low GAS5 expression may predict poor survival and cisplatin resistance in cervical cancer. Cell Death Dis. 2020;11(7):531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Gao H, Ma H, Gao M, Chen A, Zha S, Yan J. Long non‐coding RNA GAS5 aggravates myocardial depression in mice with sepsis via the microRNA‐449b/HMGB1 axis and the NF‐kappaB signaling pathway. Biosci Rep. 2021;41(4):BSR20201738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Cheng X, Shen X, Wang M, Li J, Li G. TNFAIP8 modulates the survival and immune activity of Th17 cells via p53/ p21/ MDM2 pathway after acute insult. Cytokine X. 2022;4(1):100062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Zou Q, Liu C, Hu N, Wang W, Wang H. miR‐126 ameliorates multiple organ dysfunction in septic rats by regulating the differentiation of Th17/Treg. Mol Biol Rep. 2022;1‐14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Ma J, Sun W, Chen S, et al. The long noncoding RNA GAS5 potentiates neuronal injury in Parkinson's disease by binding to microRNA‐150 to regulate Fosl1 expression. Exp Neurol. 2022;347:113904. [DOI] [PubMed] [Google Scholar]
- 28. Wang D, Xu X, Pan J, et al. GAS5 knockdown alleviates spinal cord injury by reducing VAV1 expression via RNA binding protein CELF2. Sci Rep. 2021;11(1):3628. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 29. Deng Y, Chen D, Gao F, et al. Silencing of long non‐coding RNA GAS5 suppresses neuron cell apoptosis and nerve injury in ischemic stroke through inhibiting DNMT3B‐dependent MAP4K4 methylation. Transl Stroke Res. 2020;11(5):950‐966. [DOI] [PubMed] [Google Scholar]
- 30. Hao X, Li H, Zhang P, Yu X, Jiang J, Chen S. Down‐regulation of lncRNA Gas5 promotes hypoxia‐induced pulmonary arterial smooth muscle cell proliferation by regulating KCNK3 expression. Eur J Pharmacol. 2020;889:173618. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1
Table S2
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.