Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Jul 1.
Published in final edited form as: J Biomed Mater Res B Appl Biomater. 2022 Jan 28;110(7):1535–1544. doi: 10.1002/jbm.b.35015

Macrophage Activation In Response to Shape Memory Polymer Foam-Coated Aneurysm Occlusion Devices

Sarah M Chau 1,2,*, Scott M Herting 1,*, Dillon Noltensmeyer 1, Hamzah Ahmed 1, Duncan J Maitland 1, Shreya Raghavan 1,3
PMCID: PMC9106830  NIHMSID: NIHMS1773931  PMID: 35090200

Abstract

Brain aneurysms can be treated with embolic coils using minimally invasive approaches. It is advantageous to modulate the biologic response of platinum embolic coils. Our previous studies demonstrated that shape memory polymer (SMP) foam coated embolization coils (FCC) devices demonstrate enhanced healing responses in animal models compared to standard bare platinum coil (BPC) devices. Macrophages are the most prevalent immune cell type that coordinate the greater immune response to implanted materials. Hence, we hypothesized that the highly porous SMP foam coatings on embolic coils activate a pro-regenerative healing phenotype. To test this hypothesis, we analyzed the number and type of infiltrating macrophages in FCC or BPC devices implanted in a rabbit elastase aneurysm model. FCC devices elicited a great number of infiltration macrophages, skewed significantly to a pro-regenerative M2-like phenotype 90 days following implantation. We devised an in vitro assay, where monocyte-derived macrophages were placed in close association with FCC or BPC devices for 6–72 hours. Macrophages encountering SMP FCC-devices demonstrated highly mixed activation phenotypes at 6 hours, heavily skewing towards an M2-like phenotype by 72 hours, compared to macrophages encountering BPC devices. Macrophage activation was evaluated using gene expression analysis, and secreted cytokine evaluation. Together, our results demonstrate that FCC devices promoted a pro-regenerative macrophage activation phenotype, compared to BPC devices. Our in vitro findings corroborate with in vivo observations that SMP-based modification of embolic coils can promote better healing of the aneurysm site, by sustaining a pro-healing macrophage phenotype.

Keywords: biomaterials, implantable materials, macrophages, immune response, shape memory polymers

Introduction

Endovascular coil embolization is an approach used to treat brain aneurysms, to prevent rupture and subsequent hemorrhage, without an invasive craniotomy. Helical platinum coils (or bare platinum coils; BPC) are used to fill the aneurysm via a microcatheter. However, high rates of complications persist with this approach, including aneurysm perforation, coil-associated clotting, malpositioning, and migration. A significant complication with the treatment of aneurysms with BPC devices is the 2.4% re-bleeding rate after 1 year, recanalization and aneurysm recurrence or rupture1–4. Therefore, there is a strong motivation to develop approaches that elicit an active biological response upon embolic coil/device implantation, to reduce recanalization risk and prevent coil compaction5–8. The suggested response includes robust collagen deposition between the coils in the aneurysm dome and a complete reendothelialization at the aneurysm neck9. The robust collagen deposition is expected to provide mechanical support that resists coil compaction, and complete reendothelialization is expected to provide a barrier to decrease hemodynamic pressure on the coil mass.

A variety of modifications have been tested to enhance the biological response to platinum coils deployed in aneurysms. These modifications have included the addition of cells10, proteins7, 8, 11, 12, and polymers13. Some coils, such as those coated with poly(lactic-co-glycolic acid) (PLGA) and/or monocyte chemoattractant protein-1, were observed to induce inflammation that stimulated a fibrotic response and led to more tissue deposition than control coils7, 13. Modulating macrophage phenotype to promote healing of aneurysm sites is an emerging therapeutic approach to mitigate the risks associated with recurrent intracranial aneurysms14.

Macrophage recruitment and high infiltrating numbers to aneurysm walls are observed in animal models and human resected aneurysms 15, 16. Interestingly, immunohistochemical analysis of dome resections of ruptured aneurysms demonstrate a strong association with pro-inflammatory M1 macrophage activation17–19. In fact, in a rabbit elastase aneurysm model treated with embolized platinum coils, an M2-like pro-healing macrophage activation was correlated with better histological scores and collagen deposition20. Together, these studies suggest that M2-like pro-regenerative macrophage activation may promote better healing and prevent aneurysm rupture.

Biomaterial properties like modulus, surface roughness, and porosity can drive macrophage activation21. To elicit better biological responses upon implantation, the Biomedical Device Laboratory at Texas A&M University developed shape memory foam coated coils (SMP-FCC; FCC) that enhanced both the connective tissue deposition in aneurysm domes and the endothelialization of the necks after implantation in two different animal models22–26. A recent study by Herting et al. (2019)25 reported that FCC devices increased neointimal thickening in a rabbit elastase aneurysm model, implying that FCC devices may promote better healing. A follow up study by Jessen et al. (2020)26 used micro-CT and histopathology to demonstrate significantly improved host immune response scores in FCC devices compared to control BPC devices. Coupled with this, aneurysms treated with FCC devices also demonstrated more connective tissue and less debris in long-term healing time points. An immunohistological study on the rabbit elastase aneurysm treatment samples from the previous studies demonstrating increased infiltration and M2-like polarization in long-term time points motivated our current study.

Since macrophages are intimately involved in aneurysm healing, and biomaterial mechanical properties can drive macrophage activation, we hypothesized that macrophages in general would activate differently to FCC devices, compared to BPC devices. We introduce an in vitro macrophage immunomodulation assay, to isolate the macrophage variable, since they are big players in immune responses to implanted materials, and dissect the differences in activation of macrophages by BPC and FCC devices. Our understanding of how isolated immune cells, like macrophages, respond to devices will significantly expand our ability to draw immune maps, paving the way to create better immunomodulatory materials that could drive aneurysm healing.

2. Methods

2.1. Materials

The devices tested in this study include SMP FCCs consisting of platinum-tungsten coils with SMP foam cylinders adhered to the outside of the coils (Shape Memory Medical, Santa Clara, CA). The manufacturing process and device sizes used in the animal study are described in more detail by Boyle, et al. and Herting, et al.25, 27. Control devices used were BPCs from the Barricade Coil System (Blockade Medical). Cell culture and molecular biology reagents were purchased from Life Technologies, unless otherwise indicated. IL-10 ELISA Kit was purchased from ProteinTech Group, Rosemont, IL (AuthentiKine Human IL-10 ELISA Kit).

2.2. Animal Model and Implantation

Animal studies were carried out following an institutionally approved Animal Use Protocol (TAMU IACUC 2017–0430), following the Guide for the Care and Use of Laboratory Animals. All tissues used for analysis were obtained from a previous study that utilized the rabbit elastase aneurysm model25. From the previous study briefly, a segment of the right common carotid artery was isolated, ligated distally, and exposed to elastase enzyme to break down part of the blood vessel wall. After elastase exposure, the access site was closed, and the aneurysm was allowed to grow for at least 3 weeks with exposure to hemodynamic pressure. At this point, the aneurysms were accessed via catheter and treated with either SMP FCCs or BPC controls using angiography.

The animals were sacrificed after 30 or 90 days, and the aneurysms were explanted, fixed in 10% formalin, processed and embedded in paraffin. The tissues were processed at the Neuroradiology Laboratory at the Mayo Clinic by trained technicians. Briefly, tissues were cut into 1mm thick sections using an Isomet Low Speed saw, metal coil pieces were removed from the 1mm blocks under a dissection microscope, and the blocks were re-embedded in paraffin. Standard paraffin microtomy followed, with 4–5μm sections, described in detail in Herting, et al.25.

2.3. Immunofluorescent Staining and Imaging

Tissue sections were dried overnight at 37°C, then heated to 56°C for 45 minutes immediately before deparaffinization. Paraffin was removed using two changes of Xylene, then sections were washed and rehydrated through descending ethanol concentrations from 100% ethanol to 80% ethanol. Rehydration was completed by immersing the sections in running tap water, then rinsing in 2 changes of deionized (DI) water. Antigen retrieval was performed using a 0.1 M citrate buffer at pH 6.0. Sections were immersed in this buffer and placed in a steamer for 45 minutes at 95°C. After cooling, the sections were washed in tris buffered saline (TBS) then blocked using 4% donkey serum with 0.3% Triton X in TBS for 30 minutes. An additional blocking step was added using 20 μg/mL donkey anti-rabbit IgG Fab fragment (Jackson Immunoresearch) in 0.3% Triton X in TBS for 30 minutes.

Primary antibodies were added to sections in TBS with 0.3% Triton X and 2% donkey serum overnight at 4°C. Primary antibodies used included rabbit anti Iba-1 (Wako, 2 μg/mL), goat anti CD206 (R&D Systems, 8 μg/mL), and mouse anti iNOS (Novus Biologicals, 10 μg/mL). After primary antibody incubation, sections were washed three times in TBS on a shaker. Secondary antibodies were added to sections in TBS for two hours at room temperature. Secondary antibodies used included donkey anti rabbit Alexa Fluor 488, donkey anti goat Cy3, and donkey anti mouse Cy5 (all Jackson Immunoresearch). Sections were washed again three times in TBS on a shaker after secondary incubation, then a nuclear counterstain (DAPI) was added in TBS. Slides were washed twice in TBS on a shaker, and finally the slides were mounted with coverslips using Fluoromount-G (Southern Biotech). Fluorescent staining was observed using a Leica DM6B upright microscope, with 8 independent regions for cell counting and fluorometry. NIH Image J was utilized to perform fluorometry.

2.4. THP-1 Culture and In Vitro Exposure to Aneurysm Devices

THP-1 monocytes (American Type Tissue Collection, Manassas, VA) were cultured in RPMI supplemented with 10% heat inactivated fetal bovine serum, 1X antibiotic/antimycotics. Cells were cultures upright in T-25 flasks in non-adherent cultures, at densities under 500,000 cells/ml to avoid spontaneous differentiation. Monocytes were differentiated into macrophages (M0) using 5 ng/mL phorbol 12-myristate 13-acetate (PMA; Sigma Aldrich) for 3 days. Macrophages were activated into an M2-like phenotype, following protocols established previously, using IL-4 exposure for 72hrs.

Devices (BPC or FCC) were cut to short pieces with 0.25 cm2 surface area and incubated in FBS for 30 minutes prior to cell seeding. Differentiated macrophages were harvested, and 1 million cells were seeded onto each device in 50 μL, to maximize cell contact with devices. Following an attachment period of 30 minutes, devices were submerged in complete media. Macrophages were harvested for downstream analysis at 6hrs and 72hrs following exposure to devices. Control macrophages were maintained in culture, with no device exposure or manipulation for the same timepoints. Images were obtained using a phase contrast microscope (Leica DmI8), to monitor cell attachment and morphology. NIH Image J was utilized to measure cell morphology changes, via circularity. Micrographs were manually thresholded into grayscale to outline each cell boundary. Circularity was measured using the analysis tool on Image J, and filtered to yield data from cells within an area range of 20μm – 250μm, to avoid counting doublets.

2.5. RNA Extraction and qPCR

Cell lysis was performed either 6 or 72 hours after cell seeding on devices using the RNeasy Mini Kit (Qiagen). RNA concentration and purity were evaluated using a NanoDrop OneC (ThermoFisher Scientific), and stored at −80°C until ready to use. Reverse transcription was performed following manufacturer’s protocols using the High Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific). qPCR was performed with a CFX96 Real-Time System (Bio-rad) using the Applied Biosystems PowerSYBR Green PCR Mastermix (Thermofisher Scientific) for detection. Genes that were investigated include IFNG, NOS2, HLADR, CD206, IL1B, IL10, and IL12. The primer sequences used for each gene are shown in Table 1. Changes in gene expression were calculated using the 2ΔΔCt method, with GAPDH as the housekeeping control. Comparisons were drawn between control macrophages that were not exposed to devices, at the same time points.

Table 1.

Forward and reverse primer sequences to be used for gene expression analysis.

Gene Forward Sequence Reverse Sequence
GAPDH CTGGGCTACACTGAGCACC AAGTGGTCGTTGAGGGCAATG
IFNG TCGGTAACTGACTTGAATGTCCA TCGCTTCCCTGTTTTAGCTGC
NOS2 TTCAGTATCACAACCTCAGCAAG TGGACCTGCAAGTTAAAATCCC
HLADR AGTCCCTGTGCTAGGATTTTTCA ACATAAACTCGCCTGATTGGTC
CD206 CGAGGAAGAGGTTCGGTTCACC GCAATCCCGGTTCTCATGGC
IL1B TTCGACACATGGGATAACGAGG TTTTTGCTGTGAGTCCCGGAG
IL10 GACTTTAAGGGTTACCTGGGTTG TCACATGCGCCTTGATGTCTG
IL12A ATGGCCCTGTGCCTTAGTAGT AGCTTTGCATTCATGGTCTTGA
Open in a new tab

2.6. Quantification of secreted 1L-10

The AuthetiKine Human IL-10 ELISA kit (Proteintech) was used to detect and quantify secreted IL-10 in macrophage samples. Media supernatants from each experimental condition (M0 or M2-like macrophages as controls, or encountering FCC or BPC devices) were collected, filtered, and stored in −80C till further use. The ELISA was performed following manufacturer’s protocols. Briefly, 100μl of samples and standards were loaded onto IL-10 pre-coated microwells, captured onto the well by the coated antibody in 2hrs of incubation. Following washing, 100μl of detection antibody was added to each well, and signal was developed using 100μl of tetramethyl benzidine (TMB). Following 15 minutes of TMB addition, a stop solution was added, and absorbance was detected at 450nm using a Tecan plate reader. A 4 parametric ELISA curve was generated on GraphPad Prism using the standards and their related absorbance values, and unknowns were interpolated using this curve on Prism, to determine the amounts of secreted IL-10 from macrophage-device samples.

2.7. Statistical Analysis

Statistical analysis was performed on GraphPad Prism. All reported values are means ± SEM, resulting from 3–7 biological replicates. When appropriate, all data was normalized to control conditions within each experimental set. ANOVA-based hypothesis testing was performed where appropriate, and statistical significance is indicated within each experimental data set, with associated p-values.

Results

Immunofluorescent Staining of Explanted Tissue Samples

Explanted tissues from rabbit aneurysms treated with BPC or FCC devices were processed for immunofluorescence. Sections of explanted tissue were stained with a pan macrophage marker (Iba1; green fluorescence, Fig 1A). At 30 days, implanted FCC devices had significantly more macrophages compared to BPC devices (2.5 fold higher, *p<0.05, two-way ANOVA; Fig 1B). On closer examination with macrophage activation markers iNOS (M1-like, inflammatory; cyan channel, Fig 1A) and CD206 (M2-like, pro-healing; red channel, Fig 1A), FCC devices had more M1-like and M2-like activated macrophages. A breakdown of the individual channels and their fluorescence is provided in Supplementary Fig 1. Confirmed by fluorometry (Fig 1B), although the differences were not statistically significant, they are indicative of the higher number of macrophages and a roughly 2.5–3 fold increase in M1-like and M2-like macrophages in FCC devices compared to BPC devices at the 30 day time point.

Figure 1: Immunofluorescent Staining of Explanted Tissue Samples treated with BPC or FCC devices.

Figure 1:

Open in a new tab

(A) Examination with a pan macrophage marker (Iba1; green fluorescence), macrophage activation markers iNOS (M1-like, inflammatory; teal channel) and CD206 (M2-like, pro-healing; red channel) in 30 days. (B): Fluorometry on explanted tissue samples treated with BPC (blue) or FCC (red) devices for 30 days. (C): Examination with a pan macrophage marker (Iba1; green fluorescence), macrophage activation markers iNOS (M1-like, inflammatory; teal channel) and CD206 (M2-like, pro-healing; red channel) in 90 days. (D): Fluorometry on explanted tissue samples treated with BPC (blue) or FCC (red) devices for 90 days.

Rabbit aneurysm occlusion devices were similarly evaluated at the 90 day time point (Fig 1C), following time lines established in previous studies 25, 26. The number of macrophages observed around devices, counted as cells/mm2 area was significantly (p<0.001, two-way ANOVA) higher in FCC vs. BPC implanted devices (compare 1090.03 ± 177.46 to 434.01 ± 137.3 cells/mm2). Similarly, although M1-like macrophage numbers were not significantly different at the 90 day time point, M2-like macrophages were significantly (*p<0.05, two-way ANOVA; Fig 1D) elevated in implanted FCC devices compared to BPC devices (compare 742.19 ± 135.7 to 288.25 ± 91.8 cells/mm2 positive for CD206). Together, these data suggest that implanted aneurysm occlusion devices had differential macrophage activation states and total macrophage numbers at the two time points evaluated, depending on the type of device and addition of shape memory polymer foam coatings.

In vitro activation of M0 macrophages encountering aneurysm occlusion devices

In order to dissect the observed differences in in vivo responses to aneurysm occlusion devices, we designed in vitro experiments to test the effect of BPC or FCC devices on macrophage activation (Fig 2). We generated M0 (differentiated, but non-activated macrophages) from THP-1 monocytes (Fig 3A; M0- no device control; Supplementary Fig 2). Representative phase contrast micrographs are shown in Fig 3A (6 hour time point) and Fig 3C (72 hour time point) for macrophages in contact with BPC of FCC devices. A no-device control is provided for both time points. Differentiated M0 macrophages demonstrate an elongated, almost spindle-like morphology compared to rounded monocytes (Fig 3A). Visual morphological changes between macrophages encountering BPC of FCC devices were not readily apparent. However, a quantification of circularity indicated that at 6 hours (Fig 3B) or 72 hours (Fig 3D), statistical differences existed in macrophage circularity, a surrogate measure for its activation. At 6hrs, macrophages encountering BPC or FCC devices were significantly (****p<0.0001, Fig 3B) less circular and more elongated compared to control macrophages, indicating an on-going activation event. At the 72 hour time point, macrophages encountering FCC devices were significantly (***p<0.001 compared to control; or **p<0.01 compared to BPC; Fig 3D) more elongated. Cells were seen interacting with both BPC and FCC devices, indicating that the in vitro experimental set up allowed for macrophages to access aneurysm occlusion devices effectively. As a consequence, we believe that differences in macrophage activation is a result of interactions with aneurysm devices.

Figure 2: Workflow of in vitro studies:

Figure 2:

Open in a new tab

Monocyte derived macrophages were exposed to BPC or FCC devices in vitro, ensuring maximal cell/device surface contact. Following 6 or 72hrs of device exposure, cells were harvested for downstream analysis including microscopy, gene expression, flow cytometry and secretion cytokine quantification.

Figure 3: Exposure of THP-1 macrophages (M0) encountering aneurysm occlusion devices.

Figure 3:

Open in a new tab

(A): Representative phase contrast micrograph of M0 (differentiated, but non-activated macrophages) from THP-1 monocytes at 6 hour time point in contact with no-device control, BPC or FCC devices. (B): Box and whisker plots of cells encountering devices, or control showing differences in circularity. (C) Representative phase contrast micrograph of M0 (differentiated, but non-activated macrophages) from THP-1 monocytes at 72 hour time point in contact with no-device control, BPC or FCC devices. (D) Box and whisker plots of circularity of M0 macrophages encountering aneurysm occlusion devices at 72 hours. Scale bar 100μm.

In order to further investigate morphological changes observed in micrographs, we utilized gene expression analysis. Macrophages encountering BPC or FCC devices were compared and normalized to no device control M0 macrophages maintained in culture for similar durations (Fig 4A,B). At 6 hours, M0 macrophages encountering FCC devices showed significant elevation in gene expression of IL-10 and IFN-Ɣ (*p<0.05, **p<0.001, one-way ANOVA). This suggested a strong mixed response of macrophages encountering FCC devices at an early time point, compared to BPC devices (Fig 4A). At the same time point, non-significant increases in CD206 (pro-regenerative) and HLA-DR (pro-inflammatory) were also observed, suggesting again of the same mixed response of macrophages. At 72 hours, the elevation in pro-regenerative genes (IL10 and CD206) were significantly (****p<0.0001, one-way ANOVA) higher in M0 macrophages on FCC devices compared to BPC devices. This strong significant elevation in gene expression in pro-healing macrophage markers indicated the development of an M2-like phenotype in macrophages that encounter FCC devices, compared to BPC devices.

Figure 4: Phenotype of THP-1 macrophages (M0) encountering aneurysm occlusion devices.

Figure 4:

Open in a new tab

(A): Gene expression analysis of THP-1 macrophages (M0) encountering BPC (blue) or FCC (red) at 6 hour time point. (B): Gene expression analysis of THP-1 macrophages (M0) encountering BPC (blue) or FCC (red) at 72 hour time point. Dotted line at 1 indicates the normalized level of gene expression in control macrophages at the same time points. (C): IL-10 secretion in THP-1 macrophages (M0) in no-device control, BPC (blue) or FCC (red) at 72 hours.

To follow up our gene expression studies, we performed an ELISA to measure levels of soluble, secreted IL-10 in macrophages (Fig 4C). M0 macrophages encountering FCC devices secreted significantly higher levels of IL-10 (**p<0.001, one-way ANOVA), averaging 1.2 fold times higher than BPC. IL-10 is a pro-regenerative anti-inflammatory cytokine, and macrophage secreted IL-10 is capable of regulating tissue inflammatory responses and wound healing 28, 29. An evaluation of CD206 expression using flow analysis is provided in Supplementary Figure 3. M0 macrophages encountering FCC devices had a similarly significant elevation in CD206 expression (*p<0.05, one-way ANOVA; Sup Fig 3) consistent with the elevation in CD206 at the gene expression level. Together, these results indicated that M0 macrophages encountering SMP FCC devices likely activated into a pro-healing pro-regenerative phenotype.

Retention of a pro-healing phenotype when pre-activated macrophages encounter aneurysm occlusion devices

Here, we tested for differences in the maintenance of the M2-like phenotype in pre-activated macrophages (M2-like) encountering FCC or BPC devices in vitro. THP-1 monocytes were differentiated into M0 macrophages, and activated to an M2-like phenotype using exposure to IL-4. M2-like macrophages were then maintained in control conditions with no devices for 6hrs (Fig 5A) or 72hrs (Fig 5C). An evaluation of macrophage circularity indicated that M2-like macrophages briefly switched to a more rounded pro-inflammatory phenotype (Fig 5B; compare circularity in control at 0.26 to FCC and BPC at 0.44). A mixed morphology was observed at 72 hrs in M2-like macrophages encountering BPC or FCC devices (Fig 5C), with both elongated and rounded cells observed. While M2-like macrophages were seen interacting with both types of devices, no obvious differences in morphology were apparent visually. However, a quantification of circularity indicated that M2-like macrophages in contact with FCC devices were significantly more M2-like and elongated (****p<0.0001, one-way ANOVA; Fig 5D) compared to those in contact with BPC devices (compared 0.36 in BPC to 0.26 in FCC conditions).

Figure 5: Exposure of pre-activated THP-1 macrophages (M2) encountering aneurysm occlusion devices.

Figure 5:

Open in a new tab

(A): Representative phase contrast micrograph of M2 (polarized, pre-activated macrophages) from THP-1 monocytes at 6 hour time point in contact with no-device control, BPC or FCC devices. (B): Box and whisker plot of circularity of M2 macrophages at 6 hour time points; (C): Representative phase contrast micrograph of M2 (polarized, pre-activated macrophages) from THP-1 monocytes at 72 hour time point in contact with no-device control, BPC or FCC devices. (D) Box and whisker plot of macrophage circularity at 72 hour time point. Scale bar 100μm.

Gene expression analysis of macrophages encountering BPC or FCC devices were compared and normalized to no device control M2 macrophages maintained in culture for similar durations (Fig 6A,B). At 6 hours, M2 macrophages encountering FCC devices showed slight non-significant elevation in gene expression of IL-10, IL1B, CD206, IFN-Ɣ and HLADR, compared to M2-like macrophages encountering BPC devices. Curiously, no change in the pro-inflammatory IL-12 gene was observed at 6 hours. The dotted line in Figures 6A,B represent the M2-like control macrophages with no devices at the same time point. The elevation in gene expression at the 6hr time point indicated the likelihood of M2-like macrophages possibly reverting to an inflammatory phenotype when encountering SMP-FCC devices, in line with the temporary morphological switch observed and quantified in Fig 5A,B. However, at 72hrs, gene expression analysis indicated a strong and significant difference in expression of several pro-healing genes. These included increased IL-10 (**p<0.001, two-way ANOVA), decreased IL-12, IL1B (*p<0.05, two-way ANOVA) and IFN-Ɣ (**p<0.001, two-way ANOVA). CD206 was not significantly different in gene expression, and importantly also not significantly different from control M2-like macrophages, suggesting that the invocation of an inflammatory phenotype may have been transient. By 72hrs, the pro-healing patterns in gene expression were well retained in M2-like macrophages encountering FCC devices, compared to BPC devices (Fig 6B). The non-significant change in CD206 gene expression was also observed at the protein level, evaluated by flow analysis (Supplementary Fig 3B).

Figure 6: Phenotype of pre-activated THP-1 macrophages (M2) encountering aneurysm occlusion devices.

Figure 6:

Open in a new tab

(A): Gene expression analysis of pre-activated THP-1 macrophages (M2) encountering BPC (blue) or FCC (red) at 6 hour time point. (B): Gene expression analysis of pre-activated THP-1 macrophages (M2) encountering BPC (blue) or FCC (red) at 72 hour time point. (C): Flow analysis on protein expression of CD206 in pre-activated THP-1 macrophages (M2) encountering no-device control, BPC (blue) or FCC (red) at 72 hours. (D): IL-10 expression in pre-activated THP-1 macrophages (M2) encountering no-device control, BPC (blue) or FCC (red) at 72 hours

Concomitant with gene expression, secreted levels of IL-10 were significantly higher (**p<0.01, one-way ANOVA; Fig 6C) in M2-like macrophage supernatants encountering FCC devices, compared to BPC devices (compare 128.3 ± 12.13 pg/ml in FCC, to 79.21 ± 12.1 pg/ml in BPC devices, and 147.6 ± 7.07 pg/ml in no device M2 controls).

Discussion

SMP foam has demonstrated positive healing results in multiple preclinical studies of occlusion applications in different animal models22–26,28,29. The porous structure is hypothesized to serve as a scaffold that promotes stable clot formation and provides support for the remodeling of this clot to a connective tissue matrix. There is a growing body of evidence that biomaterials and variations of their structure and chemical properties may influence the phenotype of macrophages responding to the implant15–21. Increased surface roughness and increased inter-connected porosity are both documented drivers of M2-like activation, and a pro-regenerative macrophage phenotype30, 31. Some studies have suggested that the macrophage phenotypes present in the foreign body response may determine the outcome of the implant14,15.

Our previous studies that implanted SMP-FCC devices in a rabbit elastase aneurysm model found improved neo-endothelialization and enhanced healing in aneurysm domes and necks25. The control comparisons used in the in vivo rabbit elastase study, and our current study, are against bare platinum coils (BPCs). The core material in BPC and FCC coils is a soft platinum-tungsten alloy. Furthermore, BPC coils from the Barricade Coil System have been extensively utilized in aneurysm treatment and commercially available through Blockade Medical, and hence prove to be a good control for our studies. Due to macrophage involvement in the inflammation and wound healing process following device implantation, we hypothesized that implanted aneurysm devices likely demonstrated high levels of pro-resolving/pro-healing M2-like macrophages at the implant site. In order to test this hypothesis, we followed up explants from the rabbit elastase aneurysm study with immunofluorescence and fluorometry. Our data suggested, indeed, that at 30 and 90 days following implantation, more infiltrated macrophages were present at the implantation site in FCC devices compared to BPC devices (Fig 1). This is indicative of a strong immunogenic response elicited by device implantation, resulting in robust monocyte recruitment during early inflammation32. Interestingly, a previous evaluation of the inflammatory cell types present in implanted aneurysm occlusion devices (BPC or FCC) found no difference in the number of macrophages at 30 days26. The likely increase we report in our study is due to different considerations of multinucleated giant cells (MNGCs) between these two evaluations. In this study, macrophages were determined by positivity for Iba1 and nuclear counterstain, DAPI. Each nucleus identified with DAPI was counted as one cell. The number of macrophages observed at 90 days was similar between this evaluation and the previous, referenced evaluation26. Importantly, in our study we observe increased pro-inflammatory and pro-healing phenotypes within macrophages in the FCC device implantation. This mixed phenotype of macrophages is in line with several reported studies in the wound healing literature that suggest that a wound bed may contain discrete or hybrid macrophage phenotypes33.

In order to further dissect the differences in activation of macrophages that come in close association with BPC and FCC devices, we chose to test their activation in response to devices in vitro. We studied a broad expression of genes associated with pro-inflammatory (IL12, IL1B, IFN-Ɣ and HLADR) and pro-healing (IL-10, CD206) activation states in line with literature reports34 and our own previous studies with monocyte-derived macrophages35. In line with hybrid macrophage phenotypes present in vivo, our in vitro data also suggested a mixed expression of pro-inflammatory and pro-healing markers, especially at the early 6 hr time point. However, in the 72hr time point, a definite significant shift to the pro-healing phenotype was observed, evidenced by increases in CD206 and IL-10. In addition to gene expression, we also confirmed activation into an M2-like pro-healing phenotype with surface marker expression for CD206, and quantification of levels of secreted IL-1036. Upon exposure to FCC or BPC devices, elongated macrophage morphologies are observed at different time points. Morphology of control M0 macrophages (mostly round with mild elongations noting adherence) were similar to several reports of THP-1 macrophages37, 38. Interestingly, macrophage morphology is correlated with its activation states and cytokine secretion 38, 39, which correlates with our morphometric measurements.

Lastly, we evaluated changes in macrophage plasticity in response to BPC or FCC devices in vitro, by exposing M2-like macrophages (activated with IL-4) to aneurysm occlusion devices. Our findings demonstrated that M2-like macrophages can rapidly (6 hrs) change gene expression upon exposure to FCC-devices when compared to control M2-like macrophages not exposed to any device (Fig 5A; red bars compared to dotted line controls). The ability to return to a robust M2-like phenotype is higher in M2-like macrophages associated with FCC devices (Fig 5B), implying the protection of macrophage plasticity40.

Conclusion

Changes in macrophage phenotypes have been previously evaluated related to aneurysm occlusion devices. Hoh and collaborators have utilized cytokine-releasing coils and evaluated the bioresponse in a mouse model6,8,32. They observed inflammation that stimulated enhanced healing and demonstrated peak M1 and M2 expression at 1 week that decreased with time thereafter32. Khashim, et al. suggest that M2 marker expression correlates well with increased histologic healing scores at late timepoints, but only moderately with collagen deposition33. Our previous studies indicated better re-endothelialization and healing at aneurysm necks and domes. In an attempt at isolating and delineating macrophage responses in vitro to FCC and control BPC devices, our current findings indicate that M0 macrophages, i.e. differentiated but unactivated, are activated into stronger pro-healing phenotypes when they encounter FCC aneurysm occlusion devices, compared to BPC. Furthermore, macrophages are still capable of phenotypic plasticity when encountering the FCC device, which can have implications in long-term healing at the aneurysm site. The phenotypic shifts we observe in vitro towards a more pro-regenerative activation state is likely responsible for the enhanced healing observed in rabbit elastase aneurysms treated with FCC devices. This sets up the shape memory polymer coatings to not only be biocompatible, but actively promoting pro-regenerative immunity and immune-mediated healing at the aneurysm site.

Supplementary Material

supinfo

Acknowledgements and Funding Statement

This work was supported by the NIH National Institute of Neurological Disorders and Stroke grant U01-NS089692 (DJM), and the Texas A&M Engineering Experiment Station and the Department of Biomedical Engineering (SR). This project was also supported in part by a fellowship award through the National Defense Science and Engineering Graduate (NDSEG) Fellowship Program (SMH). Devices used for the in vitro studies in this paper were supplied by Shape Memory Medical, Inc. Taryn Barry provided technical support in the staining and imaging of the in vivo study slides.

Footnotes

Data Availability Statement

Data supporting the findings of this study are available from the corresponding author upon reasonable request.

Conflict of Interest Disclosure

Dr. Duncan Maitland holds stock in a company, Shape Memory Medical, Inc. (Santa Clara, CA, shapemem.com), that is commercializing the shape memory polymer foam technology featured in this manuscript. Further, Dr. Maitland is a Director and Chief Technology Officer at Shape Memory Medical, Inc.

References

  • 1.Medical Advisory S. Coil embolization for intracranial aneurysms: an evidence-based analysis. Ont Health Technol Assess Ser 2006;6:1–114. [PMC free article] [PubMed] [Google Scholar]
  • 2.Raymond J, Klink R, Chagnon M, et al. Hydrogel versus Bare Platinum Coils in Patients with Large or Recurrent Aneurysms Prone to Recurrence after Endovascular Treatment: A Randomized Controlled Trial. AJNR Am J Neuroradiol 2017;38:432–441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Tan IY, Agid RF, Willinsky RA. Recanalization rates after endovascular coil embolization in a cohort of matched ruptured and unruptured cerebral aneurysms. Interv Neuroradiol 2011;17:27–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Crobeddu E, Lanzino G, Kallmes DF, et al. Review of 2 decades of aneurysm-recurrence literature, part 2: Managing recurrence after endovascular coiling. AJNR Am J Neuroradiol 2013;34:481–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.White PM, Lewis SC, Gholkar A, et al. Hydrogel-coated coils versus bare platinum coils for the endovascular treatment of intracranial aneurysms (HELPS): a randomised controlled trial. Lancet 2011;377:1655–62. [DOI] [PubMed] [Google Scholar]
  • 6.Ogilvy CS, Chua MH, Fusco MR, et al. Validation of a System to Predict Recanalization After Endovascular Treatment of Intracranial Aneurysms. Neurosurgery 2015;77:168–73; discussion 173–4. [DOI] [PubMed] [Google Scholar]
  • 7.Hoh BL, Hosaka K, Downes DP, et al. Monocyte chemotactic protein-1 promotes inflammatory vascular repair of murine carotid aneurysms via a macrophage inflammatory protein-1alpha and macrophage inflammatory protein-2-dependent pathway. Circulation 2011;124:2243–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hosaka K, Rojas K, Fazal HZ, et al. Monocyte Chemotactic Protein-1-Interleukin-6-Osteopontin Pathway of Intra-Aneurysmal Tissue Healing. Stroke 2017;48:1052–1060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Brinjikji W, Kallmes DF, Kadirvel R. Mechanisms of Healing in Coiled Intracranial Aneurysms: A Review of the Literature. AJNR Am J Neuroradiol 2015;36:1216–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Rouchaud A, Brinjikji W, Dai D, et al. Autologous adipose-derived mesenchymal stem cells improve healing of coiled experimental saccular aneurysms: an angiographic and histopathological study. J Neurointerv Surg 2018;10:60–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chen J, Yang L, Chen Y, et al. Controlled release of osteopontin and interleukin-10 from modified endovascular coil promote cerebral aneurysm healing. J Neurol Sci 2016;360:13–7. [DOI] [PubMed] [Google Scholar]
  • 12.Ohyama T, Nishide T, Iwata H, et al. Immobilization of basic fibroblast growth factor on a platinum microcoil to enhance tissue organization in intracranial aneurysms. J Neurosurg 2005;102:109–15. [DOI] [PubMed] [Google Scholar]
  • 13.Murayama Y, Tateshima S, Gonzalez NR, et al. Matrix and bioabsorbable polymeric coils accelerate healing of intracranial aneurysms: long-term experimental study. Stroke 2003;34:2031–7. [DOI] [PubMed] [Google Scholar]
  • 14.Muhammad S, Chaudhry SR, Dobreva G, et al. Vascular Macrophages as Therapeutic Targets to Treat Intracranial Aneurysms. Front Immunol 2021;12:630381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chyatte D, Bruno G, Desai S, et al. Inflammation and intracranial aneurysms. Neurosurgery 1999;45:1137–46; discussion 1146–7. [DOI] [PubMed] [Google Scholar]
  • 16.Shimizu K, Kushamae M, Mizutani T, et al. Intracranial Aneurysm as a Macrophage-mediated Inflammatory Disease. Neurol Med Chir (Tokyo) 2019;59:126–132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Frosen J, Piippo A, Paetau A, et al. Remodeling of saccular cerebral artery aneurysm wall is associated with rupture: histological analysis of 24 unruptured and 42 ruptured cases. Stroke 2004;35:2287–93. [DOI] [PubMed] [Google Scholar]
  • 18.Chalouhi N, Theofanis T, Starke RM, et al. Potential role of granulocyte-monocyte colony-stimulating factor in the progression of intracranial aneurysms. DNA Cell Biol 2015;34:78–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hasan D, Chalouhi N, Jabbour P, et al. Macrophage imbalance (M1 vs. M2) and upregulation of mast cells in wall of ruptured human cerebral aneurysms: preliminary results. J Neuroinflammation 2012;9:222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Khashim Z, Daying D, Hong DY, et al. The Distribution and Role of M1 and M2 Macrophages in Aneurysm Healing after Platinum Coil Embolization. AJNR Am J Neuroradiol 2020;41:1657–1662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sridharan R, Cameron AR, Kelly DJ, et al. Biomaterial based modulation of macrophage polarization: a review and suggested design principles. Materials Today 2015;18:313–325. [Google Scholar]
  • 22.Rodriguez JN, Yu YJ, Miller MW, et al. Opacification of shape memory polymer foam designed for treatment of intracranial aneurysms. Ann Biomed Eng 2012;40:883–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rodriguez JN, Clubb FJ, Wilson TS, et al. In vivo response to an implanted shape memory polyurethane foam in a porcine aneurysm model. J Biomed Mater Res A 2014;102:1231–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Horn J, Hwang W, Jessen SL, et al. Comparison of shape memory polymer foam versus bare metal coil treatments in an in vivo porcine sidewall aneurysm model. J Biomed Mater Res B Appl Biomater 2017;105:1892–1905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Herting SM, Ding Y, Boyle AJ, et al. In vivo comparison of shape memory polymer foam-coated and bare metal coils for aneurysm occlusion in the rabbit elastase model. J Biomed Mater Res B Appl Biomater 2019;107:2466–2475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Jessen SL, Friedemann MC, Mullen AE, et al. Micro-CT and histopathology methods to assess host response of aneurysms treated with shape memory polymer foam-coated coils versus bare metal coil occlusion devices. J Biomed Mater Res B Appl Biomater 2020;108:2238–2249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Boyle AJ, Wierzbicki MA, Herting S, et al. In vitro performance of a shape memory polymer foam-coated coil embolization device. Med Eng Phys 2017;49:56–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Steen EH, Wang X, Balaji S, et al. The Role of the Anti-Inflammatory Cytokine Interleukin-10 in Tissue Fibrosis. Adv Wound Care (New Rochelle) 2020;9:184–198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Deng B, Wehling-Henricks M, Villalta SA, et al. IL-10 triggers changes in macrophage phenotype that promote muscle growth and regeneration. J Immunol 2012;189:3669–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sussman EM, Halpin MC, Muster J, et al. Porous implants modulate healing and induce shifts in local macrophage polarization in the foreign body reaction. Ann Biomed Eng 2014;42:1508–16. [DOI] [PubMed] [Google Scholar]
  • 31.Barth KA, Waterfield JD, Brunette DM. The effect of surface roughness on RAW 264.7 macrophage phenotype. J Biomed Mater Res A 2013;101:2679–88. [DOI] [PubMed] [Google Scholar]
  • 32.Krzyszczyk P, Schloss R, Palmer A, et al. The Role of Macrophages in Acute and Chronic Wound Healing and Interventions to Promote Pro-wound Healing Phenotypes. Front Physiol 2018;9:419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Koh TJ, DiPietro LA. Inflammation and wound healing: the role of the macrophage. Expert Rev Mol Med 2011;13:e23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Martinez FO, Gordon S. The M1 and M2 paradigm of macrophage activation: time for reassessment. F1000Prime Rep 2014;6:13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Raghavan S, Mehta P, Xie Y, et al. Ovarian cancer stem cells and macrophages reciprocally interact through the WNT pathway to promote pro-tumoral and malignant phenotypes in 3D engineered microenvironments. J Immunother Cancer 2019;7:190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lock A, Cornish J, Musson DS. The Role of In Vitro Immune Response Assessment for Biomaterials. J Funct Biomater 2019;10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Gatto F, Cagliani R, Catelani T, et al. PMA-Induced THP-1 Macrophage Differentiation is Not Impaired by Citrate-Coated Platinum Nanoparticles. Nanomaterials (Basel) 2017;7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lee HS, Stachelek SJ, Tomczyk N, et al. Correlating macrophage morphology and cytokine production resulting from biomaterial contact. J Biomed Mater Res A 2013;101:203–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Rostam HM, Reynolds PM, Alexander MR, et al. Image based Machine Learning for identification of macrophage subsets. Sci Rep 2017;7:3521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sheikh Z, Brooks PJ, Barzilay O, et al. Macrophages, Foreign Body Giant Cells and Their Response to Implantable Biomaterials. Materials (Basel) 2015;8:5671–5701. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supinfo
NIHMS1773931-supplement-supinfo.docx (1.6MB, docx)

RESOURCES