Abstract
Background
Eriodictyol is a bioactive flavonoid compound that shows potential applications in medicine development and food processing. Microbial synthesis of eriodictyol has been attracting increasing attention due to several benefits. In this study, we employed a GRAS strain Corynebacterium glutamicum as the host to produce eriodictyol directly from tyrosine.
Results
We firstly optimized the biosynthetic module of naringenin, the upstream intermediate for eriodictyol production, through screening of different gene orthologues. Next, to improve the level of the precursor malonyl-CoA necessary for naringenin production, we introduced matB and matC from Rhizobium trifolii into C. glutamicum to convert extracellular malonate to intracellular malonyl-CoA. This combinatorial engineering resulted in around 35-fold increase in naringenin production from tyrosine compared to the initial recombinant C. glutamicum. Subsequently, the hpaBC genes from E. coli encoding 4-hydroxyphenylacetate 3-hydroxylase were expressed in C. glutamicum to synthesize eriodictyol from naringenin. Further optimization of the biotransformation process parameters led to the production of 14.10 mg/L eriodictyol.
Conclusions
The biosynthesis of the ortho-hydroxylated flavonoid eriodictyol in C. glutamicum was achieved for the first time via functional expression of E. coli hpaBC, providing a baseline strain for biosynthesis of other complex flavonoids. Our study demonstrates the potential application of C. glutamicum as a host microbe for the biosynthesis of value-added natural compounds from tyrosine.
Keywords: Eriodictyol, Corynebacterium glutamicum, Naringenin, Flavonoid, Tyrosine
Background
Eriodictyol is a hydroxylated flavonoid compound widely present in citrus fruits, vegetables, and many medicinal plants [1]. This plant-based natural product has antioxidative, anti-inflammatory and neuroprotective effects, and can thus be potentially used in pharmaceutical, nutraceutical, or food industries [1–3]. At present, the main way of obtaining eriodictyol is via extraction from plants or chemical synthesis [4]. As an alternative, microbial production of eriodictyol using engineered microorganisms is increasingly becoming an attractive approach due to its various advantages such as independence of seasonal variations, purity of end products, and rapid production [5, 6].
In plants, the eriodictyol biosynthetic pathway starts from L-tyrosine, the general precursor for flavonoid biosynthesis (Fig. 1A). Under the action of tyrosine ammonia-lyase (TAL) and 4-coumarate-CoA ligase (4CL), L-tyrosine is converted to coumaroyl-CoA, which then forms naringenin chalcone by chelating malonyl-CoA at a 1:3 molar ratio via chalcone synthase (CHS). Then, naringenin chalcone is isomerized into naringenin, an important precursor of eriodictyol, via chalcone isomerase (CHI). Finally, naringenin is converted to eriodictyol by flavonoid 3′-hydroxylase (F3′H), which is a membrane-bound cytochrome P450 monooxygenase [7, 8]. The eriodictyol biosynthetic pathway, when introduced into bacteria, is usually inefficient due to the difficulty in heterologous expression of P450 enzymes. Functional expression of plant-derived P450 enzymes often requires various modifications, such as removal of the signal peptides or membrane-binding regions, and selection of appropriate P450 reductases [9–11]. An alternative is screening and selection of suitable non-P450 enzymes for the hydroxylation reactions originally catalyzed by P450 enzymes. One such enzyme is HpaBC native to some strains of Gram-negative bacteria such as Escherichia coli, Pseudomonas putida, and Klebsiella species [12–14]. HpaBC is a 4-hydroxyphenylacetate 3-hydroxylase with a broad substrate range and is the first sequenced enzyme in the family of two-component aromatic hydroxylases [13, 14]. This enzyme contains a 4-hydroxyphenylacetate 3-monooxygenase (HpaB) and a NAD(P)H-flavin oxidoreductase (HpaC) [15, 16]. HpaB alone has very low hydroxylase activity unless HpaC is present [13, 16]. HpaBC overexpressed episomally in recombinant E. coli has been utilized to catalyze ortho-hydroxylation reactions of a wide range of plant phenolic compounds such as flavonoids and stilbenes [12, 17–21].
Fig. 1.
Biosynthetic pathway of eriodictyol from tyrosine. A The pathway introduced into the recombinant C. glutamicum in this study. B The monocistronic arrangement of the pathway genes responsible for naringenin production from tyrosine. TAL tyrosine ammonia lyase, 4CL 4-coumaroyl-CoA ligase, CHS chalcone synthase, CHI chalcone isomerase, F3′H flavonoid 3′-hydroxylase
The earliest attempts of microbial production of eriodictyol were achieved in S. cerevisiae and E. coli from caffeic acid with a respective titer of 6.5 mg/L and ~ 52 mg/L [22–25]. In all these pathways, the selection of precursors bypassed the step of P450-catalyzed hydroxylation. Later efforts have explored the conversion from tyrosine or naringenin still in E. coli and S. cerevisiae, either using E. coli-based HpaBC [17, 18] or via functionally expressed F3’H and P450 reductase identified by screening [26, 27] or engineering [28, 29]. These studies resulted in eriodictyol production at 13–200 mg/L. Recently, high-level production of eriodictyol was achieved in S. cerevisiae through expression of a F3′H and a cytochrome P450 reductase from Silybum marianum. Combined with promoter optimization and directed evolution of these enzymes, 3.3 g/L of eriodictyol was obtained from naringenin with a conversion rate of 62%, representing the highest titer reported to date [7].
In the past decade, Corynebacterium glutamicum has been attracting some attention since it is a GRAS (generally regarded as safe) bacterium not easily attacked by bacteriophages and is widely used in industry for the production of amino acids such as L-glutamate and L-lysine. Recently, this bacterium has been engineered to produce several subgroups of flavonoids and stilbenes, including flavanones, flavonols, pterostilbenes, and anthocyanins [30–32]. In addition, production of eriodictyol has also been reported in C. glutamicum using caffeic acid as a precursor with a final titer of 37 mg/L [32]. These studies demonstrate the applicability of C. glutamicum for the biosynthesis of various plant natural products.
In this study, we constructed a recombinant C. glutamicum strain capable of producing eriodictyol from tyrosine. Through screening of gene orthologues encoding pathway enzymes, enhancement in the supply of the precursor malonyl-CoA, introduction of hpaBC from E. coli, and optimization of fermentation conditions, the engineered strain was able to produce 14.10 mg/L of eriodictyol from tyrosine. To the best of our knowledge, this is the first report of C. glutamicum-based eriodictyol biosynthesis from tyrosine, and this study further broadens the potential of C. glutamicum for the production of hydroxylated flavonoids.
Results
Construction of naringenin biosynthetic module inC. glutamicum
Eriodictyol can be produced from naringenin in a single step. Therefore, to produce eriodictyol from tyrosine, we first introduced into C. glutamicum the naringenin biosynthetic pathway consisting of TAL, 4CL, CHS, and CHI (Fig. 1 A), all of which were expressed under the T7 promoter in a monocistronic form (Fig. 1B). TAL from Rhodotorula glutinis was chosen due to the high activity and strong preference of the TAL enzyme for tyrosine over phenylalanine [33]. The other three genes were selected from various sources and tested for the catalytic efficiency of the relevant enzymes. Specifically, 4CL was from Arabidopsis thaliana (At), Petroselium crispum (Pc), and Vitis vinifera (Vv); CHS was derived from Petunia hybrida (Ph) or Citrus maxima (Cm), whereas CHI had an origin of Cm or Medicago sativa (Ms). Sequence alignment of the corresponding enzyme orthologues showed 64–69% identity (78–84% similarity) between At4CL (NCBI accession number QJD21997.1), Pc4CL (CAA31696.1) and Vv4CL (AEX32786.1), 86% identity (92% similarity) between PhCHS (CAA27718.1) and CmCHS (ACX37403.1), and 54% identity (72% similarity) between MsCHI (AAB41524.1) and CmCHI (ADB92596.1). Assembly of these orthologues generated 12 recombinant pathway modules, which were then assayed for their capabilities of directing naringenin biosynthesis in shake flasks in AMM medium [30] supplemented with tyrosine. The titers of naringenin at different time points were determined, and the highest from each module was recorded and compared. Different combinations of orthologues exhibited more than 10-fold variations in naringenin production (0.50–6.98 mg/L), with Pc4CL-containing modules constantly yielding more naringenin than the Vv4CL counterparts regardless of the sources of CHS and CHI (Fig. 2). For At4CL, and for gene orthologues of CHS and CHI, it appeared that the performance of the pathway modules was independent of the origin of any individual genes but rather related to gene combinations. In addition, the CHS orthologues, which showed the highest degree of sequence identity and similarity among all the alignments, still led to large variations in the titer of naringenin. Among all the modules, the combination of Pc4CL, PhCHS and MsCHI resulted in the highest naringenin production, and was hence used in subsequent studies.
Fig. 2.
Naringenin production by recombinant C. glutamicum strains harboring 12 different combinations of 4CL, CHS and CHI orthologues. Abbreviations: At, Arabidopsis thaliana; Pc, Petroselinum crispum; Vv, Vitis vinifera; Ph, Petunia hybrida; Cm, Citrus maxima; Ms, Medicago sativa. Data represents mean ± standard deviation of three independent experiments
Enhancement in the supply of malonyl-CoA for better naringenin production
Malonyl-CoA is a co-substrate of CHS (Fig. 1), and its abundance is critical to naringenin production [19, 24]. As an important metabolic intermediate involved in fatty acid biosynthesis, malonyl-CoA is generally of low availability, restricting the high-level production of flavonoids [34]. To provide sufficient amount of malonyl-CoA for naringenin biosynthesis without greatly disturbing its metabolic pathway, we introduced a heterologous pathway, which is capable of converting malonate to malonyl-CoA, into C. glutamicum harboring the naringenin biosynthetic pathway (Fig. 3 A). This malonyl-CoA pathway consists of the malonate transporter gene matC and the malonyl-CoA synthase gene matB derived from R. trifolii [24]. These genes were expressed on plasmid pEKEx3-MatBC under the control of the tac promoter. We then tracked naringenin production at 24, 48, and 72 h of fermentation in the engineered C. glutamicum strains by feeding 2 g/L of sodium malonate into the growth medium in shake flasks. We observed an increase in the titer of naringenin at all time points compared with the strain expressing the naringenin pathway alone. The highest titer (17.96 mg/L) was reached after 48 h of fermentation, representing 83% improvement over the strain without MatBC (Fig. 3B). Naringenin accumulation declined at 72 h of fermentation in strains either with or without MatBC, suggesting possible degradation [32]. It is interesting to note that although naringenin production was time-dependent in both strains, the time-to-time difference was more prominent in the strain expressing MatBC.
Fig. 3.
Introduction of malonate-to-malonyl-CoA pathway to increase naringenin production. (A) The malonyl-CoA synthetic pathway from malonate. Malonate is transported into cells by the MatC transporter and converted to malonyl-CoA by MatB. (B) The time-dependent naringenin production by recombinant C. glutamicum strains with (carrying plasmid pEKEx3-MatBC) or without (carrying plasmid pEKEx3) the expression of MatBC when fed with sodium malonate. Data represents mean ± standard deviation of three independent experiments
Construction of the synthesis module of eriodictyol inC. glutamicum
To convert naringenin to eriodictyol using a non-P450 hydroxylase, we introduced HpaBC from E. coli to catalyze the hydroxylation reaction [18] (Fig. 4 A). The genes hpaB and hpaC were cloned from the genomic DNA of E. coli, assembled in monocistronic form under the control of promoter Ptac on plasmid pEKEx3-MatBC downstream of matBC, and introduced into naringenin-producing C. glutamicum. The metabolic performance of this strain was assayed in medium supplemented with sodium malonate and tyrosine in shake flasks. At 24 h of fermentation post induction with 0.5 mM IPTG, eriodictyol was detected in the fermentation culture with HpaBC expression as confirmed by LC-MS analysis (Fig. 4B and C). Therefore, it can be concluded that HpaBC from E. coli is functional in C. glutamicum and can convert naringenin to eriodictyol. However, only a small portion of naringenin was converted, indicating the necessity of further process optimization.
Fig. 4.
Eriodictyol production from naringenin via the expression of HpaBC in naringenin-producing C. glutamicum. A The hydroxylation reaction of naringenin conversion to eriodictyol catalyzed by HpaBC. B HPLC chromatograms of the naringenin and eriodictyol standards and the compounds produced from the recombinant strain expressing HpaBC. C Mass spectrometry analysis of eriodictyol in the fermentation products of recombinant C. glutamicum strains
Optimization of fermentation conditions for eriodictyol production
To increase the conversion rate of naringenin and the titer of eriodictyol, we optimized several crucial fermentation conditions, including inoculum size, dissolved oxygen, IPTG concentration, carbon source, nitrogen source, and time of tyrosine addition (substrate delay). First, the overnight seed culture was inoculated into AMM medium at different ratios ranging from 0.5 to 7.5%. As shown in Fig. 5 A, the highest production of either naringenin or eriodictyol was achieved with 1.5% inoculum size. Higher inoculation ratio led to sharp decline in the titers of both compounds.
Fig. 5.
Optimization of fermentation conditions for improved eriodictyol production. The optimized bioprocess parameters include (A) inoculum size, (B) IPTG concentration, (C) fermentation volume, and (D) time of supplementation of malonate and tyrosine after IPTG induction. Data represents mean ± standard deviation of three independent experiments
Next, the effect of IPTG concentration (ranging from 0.1 to 1.5 mM) on the production process was studied using 1.5% inoculation ratio. The production of both naringenin and eriodictyol was not very sensitive to IPTG concentration, and the optimum production was obtained with 0.5 mM IPTG induction (Fig. 5B), which was then adopted for all the subsequent optimization studies.
To optimize the level of dissolved oxygen in the fermentation system, we used an indirect method by changing the volume of fermentation culture from 10 to 30 mL in 100 mL shake flasks while keeping the agitation speed constant. A lower volume corresponds to more vigorous agitation and more supply of oxygen. The effect of culture volume on the production of naringenin and eriodictyol followed a similar nonlinear trend, and the highest titers of naringenin and eriodictyol were obtained with 10 mL of fermentation volume (Fig. 5C).
Previous literature has reported that the presence of flavonoid compounds may cause cell damage [18]. To minimize the possible negative effect, we intended to delay the production of naringenin and eriodictyol by adding the substrate tyrosine at different time points after IPTG induction of pathway enzyme expression. The highest titers of both naringenin and eriodictyol were achieved when tyrosine and IPTG were added simultaneously (Fig. 5D), probably due to high cell tolerance to the concentrations of both compounds produced.
We further investigated the impact of carbon and nitrogen sources on cell growth and eriodictyol production. Among the four carbon sources tested, sucrose and glucose supported fastest cell growth (Fig. 6A), while glucose resulted in the highest concentrations of naringenin and eriodictyol at almost all the time points peaking at 48 h post induction (Fig. 6B and C). The nitrogen sources tested were 2 g/L of peptone or yeast extract, and faster cell growth was constantly observed in peptone (Fig. 6D). The titers of naringenin and eriodictyol were both higher within 24 h when yeast extract was used; however, naringenin appeared to be degraded rapidly thereafter leading to inefficient production of eriodictyol (Fig. 6E and F). In contrast, peptone supported slow yet steady accumulation of naringenin and eriodictyol, with the highest eriodictyol titer of 14.10 mg/L obtained at 48 h post induction.
Fig. 6.
Effect of different carbon sources (A–C) and nitrogen sources (D–F) on (A, D) cell growth, (B, E) naringenin production, and (C, F) eriodictyol production. Data represents mean ± standard deviation of three independent experiments
In summary, the optimum fermentation condition was set as 1.5% inoculation size in 10 mL culture using glucose as the carbon source and peptone as the nitrogen source, and enzyme expression was induced with 0.5 mM IPTG at 7 h of fermentation, at which time point the substrate tyrosine was supplemented. Such optimization improved the production of eriodictyol in C. glutamicum by one-fold compared with the production from the un-optimized fermentation system.
Discussion
C. glutamicum is a promising strain to produce diverse flavonoids and has attracted much attention in recent years. In this study, we constructed a recombinant C. glutamicum that can produce eriodictyol from tyrosine. Through pathway engineering via selection of gene orthologues, enhancement of malonyl-CoA supply, and expression of the non-P450 hydroxylase HpaBC, and by means of process optimization, the eriodictyol production reached 14.10 mg/L. This study demonstrates the potential of C. glutamicum in the production of eriodictyol and other flavonoids for future applications, which could be coupled with tyrosine- or phenylalanine-producing C. glutamicum strains in a co-culture system.
In the current study, we applied HpaBC from E. coli to conduct the hydroxylation at 3’ position in the B ring of naringenin, which is the first attempt in C. glutamicum. In previous eriodictyol production using C. glutamicum as a host, the production process lies in the supplementation of caffeic acid, in which the C3’ site is already replaced by a hydroxyl group [32]. In other microbial production systems, the hydroxylation is generally carried out by the introduction of P450 hydroxylase. In E. coli, the expression of P450 hydroxylase, such as F3′-hydroxylase from plants, requires the removal of hydrophobic membrane anchors to maintain the activity and selection of appropriate cytochrome P450 reductase. In contrast, the expression of HpaBC, a native enzyme in E. coli, is much more convenient than the expression of P450 enzyme in E. coli and other prokaryotic microorganisms, such as C. glutamicum in this study. Expression of HpaBC does not need any special enzyme engineering efforts. Additionally, HpaBC has a spectrum of substrates to be hydroxylated at ortho-position, resulting in diverse flavonoid compounds [17]. Among them, naringenin is the most preferred substrate. In the current study, the highest conversion yield of naringenin to eriodictyol is about 50%, equivalent to other studies [7, 17, 18].
The enzyme complex HpaBC generally has a great demand for oxygen in the hydroxylation reaction [20]. However, we found that eriodictyol production was not linearly correlated with the culture volume, which is an indirect measure of oxygen supply. The highest eriodictyol production was actually achieved when the culture volume was either 10 mL or 25 mL, and the titer of eriodictyol was higher in 25-mL and 30-mL systems than in 15-mL and 20-mL culture. This was unexpected due to less oxygen supply in larger fermentation volumes. Given the same concentrations of medium components used for various culture volumes, a possible explanation is that cells cultured in larger volumes could accumulate more biomass and produce more eriodictyol due to the presence of more nutrients, which could partially compensate for the lower specific yield of eriodictyol produced by each single cell.
The limited supply of malonyl-CoA has been recognized as a bottleneck in the biosynthesis of flavonoids in microbial hosts such as C. glutamicum and E. coli [35]. Since malonyl-CoA is closely related to the endogenous biosynthesis of fatty acids, strategies that aim to inhibit fatty acid synthesis have been adopted with much success. These include the supplementation of the antibiotic cerulenin that blocks the activity of FabB and FabF in fatty acid synthesis [24, 32], the overexpression of acetyl-CoA carboxylase AccBC and AccD1 [34], and deletion of the gene encoding FasR that represses the transcription of accBC and accD1 [34, 36]. However, FasR in C. glutamicum also represses the expression of fatty acid synthase Fas-IA and Fas-IB [37]. Thus, the deletion of fasR has a dual role to increase both the synthesis and consumption of malonyl-CoA, making it difficult to predict the actual change in the abundance of malonyl-CoA. Other strategies for improving the pool of malonyl-CoA involves modifications of the central metabolic pathway to increase the availability of acetyl-CoA, which include enhancement of the uptake of carbon sources, increase in the flux towards glycolysis, and partial elimination of the anaplerotic pyruvate carboxylation, etc. [34, 35].
Regarding the pathway enzyme orthologues, the best combination of 4CL, CHS and CHI orthologues in C. glutamicum is different from that in E. coli [38] although the enzyme sequences and promoters used are the same for the two systems. In the E. coli-based system, 4CL was identified as the key enzyme to determine the final production titer, and At4CL always led to higher naringenin production irrespective of the sources of CHS and CHI [38]. In the current study using the C. glutamicum-based system, although the decisive role of 4CL was not observed, its origin (more specifically, the protein sequence) was more critical than that of the other two enzymes in determining the final production titer. This is consistent with previous findings that 4CL catalyzes the conversion of p-coumaric acid to 4-coumaryol-CoA, which is considered as a difficult and rate-limiting reaction [39, 40]. However, the detailed reasoning behind the importance of the origin of 4CL is not clear, which could be due to poor expression or slow kinetics of this enzyme, instability or short half-life of 4-coumaryol-CoA, or strict selectivity of the enzyme. Moreover, high sequence similarity among any single set of enzyme orthologues, especially CHS, did not translate into similar naringenin production titers, indicating that it is the enzyme combination rather than a particular enzyme sequence that determines the catalytic efficiency of the pathway. This further suggests the significant role of compatibility of the enzymes along a pathway, likely on both the expression level and the catalytic level. More studies are needed to explore these complicated issues so as to better guide microbial synthesis of flavonoids and other plant natural products.
Conclusions
We have demonstrated successful production of eriodictyol in C. glutamicum from tyrosine, which is more abundant and cheaper than previously used precursors naringenin and caffeic acid. Through screening of pathway gene orthologues and introduction of MatBC to increase the intracellular supply of malonyl-CoA, we achieved naringenin production from tyrosine in the first step. Further expression of E. coli-derived HpaBC followed by process optimization enabled 14.10 mg/L of eriodictyol produced from tyrosine. This is the first report on eriodictyol biosynthesis from tyrosine in C. glutamicum, and opens up new possibilities of microbial synthesis of plant flavonoids in this GRAS microbe. Since high-titer synthesis of tyrosine from glucose has been achieved in C. glutamicum [41, 42], it can be anticipated that de novo biosynthesis of eriodictyol from cheap carbon sources using C. glutamicum mono-culture or multi-cultures can be achieved.
Methods
Bacterial strains and media
E. coli DH5α was used for cloning and plasmid propagation and was grown in Luria Broth (LB) medium supplemented with 50 mg/L kanamycin or spectinomycin when necessary; agar was added to 20 g/L for the preparation of agar plates. C. glutamicum ATCC 13032 (DE3) was used as the host for flavonoid production in this study. C. glutamicum was generally grown in Brain Heart Infusion (BHI) medium and kept in BHI with glycerol (20%, v/v) at −80 ℃ for long-term storage. Fermentation by C. glutamicum was conducted at 30 ℃ in modified AMM medium [30] containing 0.2 mg/L of biotin with casamino acids replaced by peptone.
Plasmid and strain construction
To construct the plasmids expressing TAL, 4CL, CHS and CHI, the fragments containing 4CL, CHS and CHI were released from previously constructed plasmids [38] by ApaI and NheI and ligated into the ApaI-AvrII digested plasmid pETM6-RgTAL [19]. The four genes were then excised and cloned into the C. glutamicum-E. coli shuttle vector pZM1 [30] by ApaI and NheI, forming the plasmids used for this study.
To construct the plasmid for the expression of the malonate-to-malonyl-CoA pathway, genes matB and matC from Rhizobium trifolii were PCR amplified using the plasmid pACYC-MatBC [24] as the template with primers MatB-F-BamHI/MatB-R and MatC-F/MatC-R-MfeI, and assembled together by overlap extension PCR. The fragment was then digested by BamHI and MfeI and cloned into BamHI/EcoRI-digested pEKEx3, forming pEKEx3-MatBC.
To construct the plasmid carrying the eriodictyol biosynthesis module, the HpaB and HpaC genes were amplified from the genomic DNA of BL21(DE3) using primers HpaB-NdeI-F/ HpaB-SpeI-R and HpaC-NdeI-F/HpaC-SpeI-R and were then separately inserted into the plasmid pZM1 digested with NdeI and SpeI. The expression cassette of HpaC, consisting of the promoter Ptac, the gene HpaC, and the T7 terminator, was amplified with the primer pair pZM1-HpaC-F/R and inserted into pZM1-HpaB through in-fusion cloning (Takara Bio) to obtain the plasmid pZM1-HpaBC. Subsequently, the expression cassettes of HpaB and HpaC in pZM1-HpaBC were amplified by primer pair pZM1-HpaBC-F/R and cloned into plasmid pEKEx3-MatBC by in-fusion cloning using primers pEKEx3-MatBC-F1/F/R/R2, resulting in the plasmid pEKEx3-MatBC-HpaBC.
The plasmids were electroporated into C. glutamicum ATCC 13032 (DE3) using an established method [30]. Briefly, competent cells were thawed on ice, mixed with ~ 100 ng of each plasmid, and transferred to an electroporation cuvette (2 mm gap). Cells were electroporated at 25 µF, 200 W and 2.5 kV using a Bio-Rad electroporator, and mixed with 1 mL pre-warmed BHI, followed by heat shock at 46 °C for 6 min. Cells were recovered at 30 °C for 2 h, and spread onto LB-agar plates containing antibiotics when necessary. Positive clones were selected by colony PCR, and plasmids were confirmed by sequencing (Sangon, Shanghai, China).
The plasmids and primers used for the cloning work are listed in Tables 1 and 2, respectively.
Table 1.
Strains and plasmids used in this study
Plasmids or strains | Relevant properties | Source or references |
---|---|---|
Escherichia coli DH5α | Cloning of plasmids | Invitrogen |
E. coli BL21 Star™ (DE3) | Template for cloning of HpaB and HpaC | Invitrogen |
C. glutamicum (DE3) | Host, integrating T7 RNA polymerase | [43] |
pZM1 | An E. coli-C. glutamicum shuttle vector, pHM1519 ori, KanR | [30] |
pEKEx3 | An E. coli-C. glutamicum shuttle vector, pBL1 ori, SpecR | [32] |
pETM6-RgTAL | pETM6 carrying R. glutinis TAL | [19] |
pZM1-HpaB | pZM1 carrying HpaB from E. coli | This study |
pZM1-HpaC | pZM1 carrying HpaC from E. coli | This study |
pZM1-HpaBC | pZM1 carrying HpaB and HpaC from E. coli | This study |
pZM1-RgTAL-x4CL-yCHS-zCHI | pZM1 carrying R. glutinis TAL, 4CL, CHS, and CHI. X means genes from Arabidopsis thaliana, Petroselinum crispum, and Vitis vinifera; y means genes from Petunia hybrida and Citrus maxima (Cm); z means gene from Cm and Medicago sativa. | This study |
pACYC-MatBC | pACYCDuet-1 carrying R. trifolii MatB and MatC | [24] |
pEKEx3-MatB | pEKEx3 carrying R. trifolii MatB | This study |
pEKEx3-MatBC | pEKEx3 carrying R. trifolii MatB and MatC | This study |
pEKEx3-MatBC-HpaBC | pEKEx3 carrying R. trifolii MatB and MatC, and E. coli HpaB and HpaC | This study |
Table 2.
Oligonucleotides used in this study
Primers | Sequence (5’–3’ with restriction sites underlined) |
---|---|
HpaB-NdeI-F | GGGCCTCATATGAAACCAGAAGATTTCCGCGCCAG |
HpaB-SpeI-R | GGGCCCACTAGTTATTTCAGCAGCTTATCCAGCATGTTGA |
HpaC-NdeI- F | GGGTTTCATATGCAATTAGATGAACAACGCCTGCGC |
HpaC-SpeI-R | GGGCCCACTAGTTAAATCGCAGCTTCCATTTCCAGCATCA |
pZM1-HpaC-F | CTAGCGAAAGGAGGAGTTGACAATTAATCATCGGCTCGTATAATGTGTGGA |
pZM1-HpaC-R | AGAGTTTGTAGAAACGCGTCGACTCCTC |
MatB-F-BamHI | CCGGGATCCAAAGGAGGACAACCATGAGCAACCATCTTTTCGACG |
MatB-R | CGACCTCCTTTAGCACCTTACGTCCTGGTATAAAGATCGGC |
MatC-F | CGTAAGGTGCTAAAGGAGGTCGAAGATGGGTATTGAATTACTGTCCATAGG |
MatC-R-MfeI | CCGCAATTGTCAAACCAGCCCGGGC |
pEKEx3-MatBC-F1 | AGCGCATTGTTAGATTTCATACACGG |
pEKEx3-MatBC-F | CAGGAACCGTAAAAAGGCCGCGTTG |
pEKEx3-MatBC-R | TTGTAGAAACGCAAAAAGGCCATCC |
pEKEx3-MatBC-R2 | TGAAATCTAACAATGCGCTCATCGTCA |
pZM1-HpaBC-F | CGGCCTTTTTACGGTTCCTGTTGTAGAAACGCGTCGACTCCTCC |
pZM1-HpaBC-R | GCCTTTTTGCGTTTCTACAATCCCAGTCACGACCCTAGGG |
Fermentation conditions
Glycerol stocks were streaked onto LB-agar plates with 25 mg/L kanamycin and 100 mg/L spectinomycin. Single colonies were inoculated into 3 mL of BHI medium with 25 mg/L kanamycin and 100 mg/L spectinomycin in a 20-mL culture tube for overnight growth at 30 ℃ and 200 rpm. Fresh modified AMM (15 mL) with 25 mg/L kanamycin and 100 mg/L spectinomycin in a 100 mL flask was inoculated with 375 µL of the overnight culture, or other volumes when noted. After 7 h of cultivation at 30 ℃ and 200 rpm, IPTG was added to a final concentration of 0.5 mM or specified otherwise, and sodium malonate (prepared as a 100 g/L stock solution in deionized water) and tyrosine (prepared as a 25 mg/mL stock solution in DMSO) were also added to final concentrations of 2 g/L and 500 mg/L, respectively. For the optimization of carbon and nitrogen sources, the glucose in modified AMM was replaced with 20 g/L of fructose or sucrose, and peptone was replaced with 2 g/L yeast extract. The culture was further grown at 30 ℃ and 200 rpm for 72 h. Every 12 h, the optical density at 600 nm (OD600) was measured, and 200 µL of the culture were collected and stored at − 20℃ for later use.
Metabolite analysis
The collected fermentation culture was mixed well with an equal volume of anhydrous ethanol, and centrifuged at 21,000×g for 10 min. The supernatants were analyzed by a previously established method [18]. Briefly, 10 µL of each sample was loaded into a Shimadzu Essentia LC-16 HPLC system equipped with a Unitary C18 column (5 μm, 4.6 × 250 mm) and a diode array detector. The mobile phase was acetonitrile with 0.1% formic acid (solvent A) and 0.1% formic acid in water (solvent B). HPLC program was set as 10–40% A at 0–10 min and 40–60% A at 10–15 min with a constant flow rate of 1 mL/min. Absorbance at 280 nm was monitored.
LC-MS analysis
Agilent 1200 series HPLC equipped with an Eclipse XDB-C18 column (5 μm, 150 × 4.6 mm) and an LTQ-ORBITRAP XL mass spectrometer was used. HPLC analysis was performed with solvent A (0.1% formic acid in water) and solvent B (0.1% formic acid in acetonitrile) at a flow rate of 250 µL/min with a linear gradient (5% B at 0–5 min, 5–45% B at 5–40 min, 45–90% B at 40–45 min, 90% B at 45–49.9 min, 90–5% B at 49.9–50 min, and 5% B at 50–60 min). Mass spectrometer was operated in a negative ion mode with 2-ppm mass accuracy. Mass spectra were acquired at a resolution of 60,000 in a detection range of M/Z 100–700. Acquisition parameters were set as follows: spray voltage 4.5 kV, capillary voltage 44 V, tube lens voltage 150 V, capillary temperature 250 °C, sheath flow rate 25, and auxiliary gas flow rate 5.
Author contributions
MAGK and JZ conceived the idea. JZ and XW designed experiments. XW, JL, DL, MY and JZ conducted experiments. XW, JL and JZ analyzed the data and wrote the manuscript. MAGK contributed with scientific discussions and commented on the manuscript. All authors read and approved the manuscript.
Funding
The authors would like to thank the financial support from the Natural Science Foundation of Shaanxi Province (2020JQ-703 and 2020JQ-702), and the National Natural Science Foundation of China (31900114). This work was also supported by the startup funds from Shaanxi University of Science and Technology awarded to JZ and XW.
Availability of data and materials
The data supporting our findings can be found in the main paper and the supplementary file.
Declarations
Competing interests
The authors declare that they have no conflict of interest.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Xia Wu, Email: wuxia@sust.edu.cn.
Jingyi Liu, Email: 13627650679@163.com.
Dan Liu, Email: 1658826975@qq.com.
Miaomiao Yuwen, Email: 1477720314@qq.com.
Mattheos A. G. Koffas, Email: koffam@rpi.edu
Jian Zha, Email: zhajian1985@sust.edu.cn.
References
- 1.Deng Z, Hassan S, Rafiq M, Li H, He Y, Cai Y, Kang X, Liu Z, Yan T. Pharmacological activity of eriodictyol: the major natural polyphenolic flavanone. Evidence-Based Complementary Altern Med. 2020;2020:6681352. doi: 10.1155/2020/6681352. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Islam A, Islam MS, Rahman MK, Uddin MN, Akanda MR. The pharmacological and biological roles of eriodictyol. Arch Pharmacal Res. 2020;43:582–92. doi: 10.1007/s12272-020-01243-0. [DOI] [PubMed] [Google Scholar]
- 3.Lee E-R, Kim J-H, Kang Y-J, Cho S-G. The anti-apoptotic and anti-oxidant effect of eriodictyol on UV-induced apoptosis in keratinocytes. Biol Pharm Bull. 2007;30:32–7. doi: 10.1248/bpb.30.32. [DOI] [PubMed] [Google Scholar]
- 4.Zha J, Wu X, Koffas MAG. Making brilliant colors by microorganisms. Curr Opin Biotechnol. 2020;61:135–41. doi: 10.1016/j.copbio.2019.12.020. [DOI] [PubMed] [Google Scholar]
- 5.Marsafari M, Samizadeh H, Rabiei B, Mehrabi A, Koffas M, Xu P. Biotechnological production of flavonoids: an update on plant metabolic engineering, microbial host selection, and genetically encoded biosensors. Biotechnol J. 2020;15:1900432. doi: 10.1002/biot.201900432. [DOI] [PubMed] [Google Scholar]
- 6.Pandey RP, Parajuli P, Koffas MAG, Sohng JK. Microbial production of natural and non-natural flavonoids: pathway engineering, directed evolution and systems/synthetic biology. Biotechnol Adv. 2016;34:634–62. doi: 10.1016/j.biotechadv.2016.02.012. [DOI] [PubMed] [Google Scholar]
- 7.Gao S, Xu X, Zeng W, Xu S, Lyv Y, Feng Y, Kai G, Zhou J, Chen J. Efficient biosynthesis of (2S)-eriodictyol from (2S)-naringenin in Saccharomyces cerevisiae through a combination of promoter adjustment and directed evolution. ACS Synth Biol. 2020;9:3288–97. doi: 10.1021/acssynbio.0c00346. [DOI] [PubMed] [Google Scholar]
- 8.Dunstan MS, Robinson CJ, Jervis AJ, Yan C, Carbonell P, Hollywood KA, Currin A, Swainston N, Feuvre RL, Micklefield J, Faulon J-L, Breitling R, Turner N, Takano E, Scrutton NS. Engineering Escherichia coli towards de novo production of gatekeeper (2S)-flavanones: naringenin, pinocembrin, eriodictyol and homoeriodictyol. Synth Biol. 2020;5:ysaa012. doi: 10.1093/synbio/ysaa012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Li J, Tian C, Xia Y, Mutanda I, Wang K, Wang Y. Production of plant-specific flavones baicalein and scutellarein in an engineered E. coli from available phenylalanine and tyrosine. Metab Eng. 2019;52:124–33. doi: 10.1016/j.ymben.2018.11.008. [DOI] [PubMed] [Google Scholar]
- 10.Leonard E, Yan Y, Koffas MAG. Functional expression of a P450 flavonoid hydroxylase for the biosynthesis of plant-specific hydroxylated flavonols in Escherichia coli. Metab Eng. 2006;8:172–81. doi: 10.1016/j.ymben.2005.11.001. [DOI] [PubMed] [Google Scholar]
- 11.Fowler ZL, Koffas MAG. Biosynthesis and biotechnological production of flavanones: current state and perspectives. Appl Microbiol Biotechnol. 2009;83:799–808. doi: 10.1007/s00253-009-2039-z. [DOI] [PubMed] [Google Scholar]
- 12.Lin Y, Yan Y. Biosynthesis of caffeic acid in Escherichia coli using its endogenous hydroxylase complex. Microb Cell Fact. 2012;11:42. doi: 10.1186/1475-2859-11-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Prieto MA, Garcia JL. Molecular characterization of 4-hydroxyphenylacetate 3-hydroxylase of Escherichia coli. A two-protein component enzyme. J Biol Chem. 1994;269:22823–9. doi: 10.1016/S0021-9258(17)31719-2. [DOI] [PubMed] [Google Scholar]
- 14.Prieto MA, Perez-Aranda A, Garcia JL. Characterization of an Escherichia coli aromatic hydroxylase with a broad substrate range. J Bacteriol. 1993;175:2162–7. doi: 10.1128/jb.175.7.2162-2167.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Xun L, Sandvik ER. Characterization of 4-hydroxyphenylacetate 3-hydroxylase (HpaB) of Escherichia coli as a reduced flavin adenine dinucleotide-utilizing monooxygenase. Appl Environ Microbiol. 2000;66:481–6. doi: 10.1128/AEM.66.2.481-486.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Galán B, Díaz E, Prieto MA, García JL. Functional analysis of the small component of the 4-hydroxyphenylacetate 3-monooxygenase of Escherichia coli W: a prototype of a new flavin:NAD(P)H reductase subfamily. J Bacteriol. 2000;182:627–36. doi: 10.1128/JB.182.3.627-636.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Wang L, Ma X, Ruan H, Chen Y, Gao L, Lei T, Li Y, Gui L, Guo L, Xia T, Wang Y. Optimization of the biosynthesis of B-ring ortho-hydroxylated flavonoids using the 4-hydroxyphenylacetate 3-hydroxylase complex (HpaBC) of Escherichia coli. Molecules. 2021;26:2919. doi: 10.3390/molecules26102919. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Jones JA, Collins SM, Vernacchio VR, Lachance DM, Koffas MAG. Optimization of naringenin and p-coumaric acid hydroxylation using the native E. coli hydroxylase complex, HpaBC. Biotechnol Prog. 2016;32:21–5. doi: 10.1002/btpr.2185. [DOI] [PubMed] [Google Scholar]
- 19.Jones JA, Vernacchio VR, Collins SM, Shirke AN, Xiu Y, Englaender JA, Cress BF, McCutcheon CC, Linhardt RJ, Gross RA, Koffas MAG. Complete biosynthesis of anthocyanins using E. coli polycultures. mBio. 2017;8:e00621-17. doi: 10.1128/mBio.00621-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Furuya T, Sai M, Kino K. Biocatalytic synthesis of 3,4,5,3’,5’-pentahydroxy-trans-stilbene from piceatannol by two-component flavin-dependent monooxygenase HpaBC. Biosci Biotechnol Biochem. 2016;80:193–8. doi: 10.1080/09168451.2015.1072463. [DOI] [PubMed] [Google Scholar]
- 21.Ni J, Tao F, Du H, Xu P. Mimicking a natural pathway for de novo biosynthesis: natural vanillin production from accessible carbon sources. Sci Rep. 2015;5:13670. doi: 10.1038/srep13670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Leonard E, Lim K-H, Saw P-N, Koffas MAG. Engineering central metabolic pathways for high-level flavonoid production in Escherichia coli. Appl Environ Microbiol. 2007;73:3877–86. doi: 10.1128/AEM.00200-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Yan Y, Kohli A, Koffas MAG. Biosynthesis of natural flavanones in Saccharomyces cerevisiae. Appl Environ Microbiol. 2005;71:5610–3. doi: 10.1128/AEM.71.9.5610-5613.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Leonard E, Yan Y, Fowler ZL, Li Z, Lim CG, Lim KH, Koffas MA. Strain improvement of recombinant Escherichia coli for efficient production of plant flavonoids. Mol Pharmaceutics. 2008;5:257–65. doi: 10.1021/mp7001472. [DOI] [PubMed] [Google Scholar]
- 25.Fowler ZL, Gikandi WW, Koffas MAG. Increased malonyl coenzyme A biosynthesis by tuning the Escherichia coli metabolic network and its application to flavanone production. Appl Environ Microbiol. 2009;75:5831–9. doi: 10.1128/AEM.00270-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Amor IL, Hehn A, Guedone E, Ghedira K, Engasser JM, Chekir-Ghedrira L, Ghoul M. Biotransformation of naringenin to eriodictyol by Saccharomyces cerevisiea functionally expressing flavonoid 3’ hydroxylase. Nat Prod Commun. 2010;5:1893–8. [PubMed] [Google Scholar]
- 27.Kasai N, Ikushiro S, Hirosue S, Arisawa A, Ichinose H, Wariishi H, Ohta M, Sakaki T. Enzymatic properties of cytochrome P450 catalyzing 3’-hydroxylation of naringenin from the white-rot fungus Phanerochaete chrysosporium. Biochem Biophys Res Commun. 2009;387:103–8. doi: 10.1016/j.bbrc.2009.06.134. [DOI] [PubMed] [Google Scholar]
- 28.Zhu S, Wu J, Du G, Zhou J, Chen J. Efficient synthesis of eriodictyol from L-tyrosine in Escherichia coli. Appl Environ Microbiol. 2014;80:3072–80. doi: 10.1128/AEM.03986-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chu LL, Pandey RP, Jung N, Jung HJ, Kim E-H, Sohng JK. Hydroxylation of diverse flavonoids by CYP450 BM3 variants: biosynthesis of eriodictyol from naringenin in whole cells and its biological activities. Microb Cell Fact. 2016;15:135. doi: 10.1186/s12934-016-0533-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Zha J, Zang Y, Mattozzi M, Plassmeier J, Gupta M, Wu X, Clarkson S, Koffas MAG. Metabolic engineering of Corynebacterium glutamicum for anthocyanin production. Microb Cell Fact. 2018;17:143. doi: 10.1186/s12934-018-0990-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Kallscheuer N, Vogt M, Bott M, Marienhagen J. Functional expression of plant-derived O-methyltransferase, flavanone 3-hydroxylase, and flavonol synthase in Corynebacterium glutamicum for production of pterostilbene, kaempferol, and quercetin. J Biotechnol. 2017;258:190–6. doi: 10.1016/j.jbiotec.2017.01.006. [DOI] [PubMed] [Google Scholar]
- 32.Kallscheuer N, Vogt M, Stenzel A, Gätgens J, Bott M, Marienhagen J. Construction of a Corynebacterium glutamicum platform strain for the production of stilbenes and (2S)-flavanones. Metab Eng. 2016;38:47–55. doi: 10.1016/j.ymben.2016.06.003. [DOI] [PubMed] [Google Scholar]
- 33.Vannelli T, Wei Qi W, Sweigard J, Gatenby AA, Sariaslani FS. Production of p-hydroxycinnamic acid from glucose in Saccharomyces cerevisiae and Escherichia coli by expression of heterologous genes from plants and fungi. Metab Eng. 2007;9:142–51. doi: 10.1016/j.ymben.2006.11.001. [DOI] [PubMed] [Google Scholar]
- 34.Milke L, Kallscheuer N, Kappelmann J, Marienhagen J. Tailoring Corynebacterium glutamicum towards increased malonyl-CoA availability for efficient synthesis of the plant pentaketide noreugenin. Microb Cell Fact. 2019;18:71. doi: 10.1186/s12934-019-1117-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Milke L, Marienhagen J. Engineering intracellular malonyl-CoA availability in microbial hosts and its impact on polyketide and fatty acid synthesis. Appl Microbiol Biotechnol. 2020;104:6057–65. doi: 10.1007/s00253-020-10643-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Milke L, Ferreira P, Kallscheuer N, Braga A, Vogt M, Kappelmann J, Oliveira J, Silva AR, Rocha I, Bott M, Noack S, Faria N, Marienhagen J. Modulation of the central carbon metabolism of Corynebacterium glutamicum improves malonyl-CoA availability and increases plant polyphenol synthesis. Biotechnol Bioeng. 2019;116:1380–91. doi: 10.1002/bit.26939. [DOI] [PubMed] [Google Scholar]
- 37.Nickel J, Irzik K, van Ooyen J, Eggeling L. The TetR-type transcriptional regulator FasR of Corynebacterium glutamicum controls genes of lipid synthesis during growth on acetate. Mol Microbiol. 2010;78:253–65. doi: 10.1111/j.1365-2958.2010.07337.x. [DOI] [PubMed] [Google Scholar]
- 38.Jones JA, Vernacchio VR, Sinkoe AL, Collins SM, Ibrahim MHA, Lachance DM, Hahn J, Koffas MAG. Experimental and computational optimization of an Escherichia coli co-culture for the efficient production of flavonoids. Metab Eng. 2016;35:55–63. doi: 10.1016/j.ymben.2016.01.006. [DOI] [PubMed] [Google Scholar]
- 39.Chen X, Wang H, Li X, Ma K, Zhan Y, Zeng F. Molecular cloning and functional analysis of 4-coumarate:CoA ligase 4 (4CL-like 1) from Fraxinus mandshurica and its role in abiotic stress tolerance and cell wall synthesis. BMC Plant Biol. 2019;19:231. doi: 10.1186/s12870-019-1812-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Xiong D, Lu S, Wu J, Liang C, Wang W, Wang W, Jin J-M, Tang S-Y. Improving key enzyme activity in phenylpropanoid pathway with a designed biosensor. Metab Eng. 2017;40:115–23. doi: 10.1016/j.ymben.2017.01.006. [DOI] [PubMed] [Google Scholar]
- 41.Lütke-Eversloh T, Santos CNS, Stephanopoulos G. Perspectives of biotechnological production of L-tyrosine and its applications. Appl Microbiol Biotechnol. 2007;77:751–62. doi: 10.1007/s00253-007-1243-y. [DOI] [PubMed] [Google Scholar]
- 42.Ikeda M, Katsumata R. Metabolic engineering to produce tyrosine or phenylalanine in a tryptophan-producing Corynebacterium glutamicum strain. Appl Environ Microbiol. 1992;58:781–5. doi: 10.1128/aem.58.3.781-785.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Kortmann M, Kuhl V, Klaffl S, Bott M. A chromosomally encoded T7 RNA polymerase-dependent gene expression system for Corynebacterium glutamicum: construction and comparative evaluation at the single-cell level. Microb Biotechnol. 2015;8:253–65. doi: 10.1111/1751-7915.12236. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data supporting our findings can be found in the main paper and the supplementary file.