Skip to main content
NCBI home page
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2022 Apr 7;28(4):911–920. doi: 10.1007/s12298-022-01171-x

Mercury toxicity affects oxidative metabolism and induces stress responsive mechanisms in wheat (Triticum aestivum L.)

Rabia İşkil 1, Yonca Surgun-Acar 2,✉, Şükrü Serter Çatav 3, Fahriye Zemheri-Navruz 4, Yavuz Erden 4
PMCID: PMC9110583  PMID: 35592475

Abstract

Mercury (Hg) toxicity is an increasing problem worldwide, with a negative impact on the environment and living organisms including both animals and plants. In this study, we analyzed molecular and biochemical changes related to Hg toxicity in wheat (Triticum aestivum L.) seedlings. Seven-day-old seedlings were exposed to various concentrations (5, 10, and 20 µM) of HgCl2 for 24 and 48 h. Our results showed that HgCl2 treatments led to an increase in the Hg content of wheat leaves in a time- and concentration-dependent manner. Furthermore, significant increases were observed in hydrogen peroxide, malondialdehyde, and proline contents in response to Hg toxicity. While all HgCl2 treatments decreased the level of superoxide dismutase (SOD), the level of catalase (CAT) was reduced only in seedlings exposed to 5 µM of HgCl2. Mercury stress caused a decline in the expression of Cu/Zn-SOD, Fe-SOD, TaWRKY19, and TaDREB1 genes at both exposure times. On the other hand, 10 and 20 µM HgCl2 treatments caused significant induction (1.9 to 6.1-fold) in the expression of the CAT gene in wheat leaves. The mRNA level of the Mn-SOD and TaWRKY2 genes showed different patterns depending on the concentration and exposure period of HgCl2. In conclusion, the findings of this work demonstrate that Hg toxicity causes oxidative damage in wheat seedlings and changes the expression of some genes encoding WRKY and DREB transcription factor families, which have important functions in abiotic stress response.

Keywords: Wheat, Mercury toxicity, Antioxidant enzymes, Oxidative stress, Gene expression, Transcription factors

Introduction

Heavy metal pollution is a global concern with a serious impact on the environment, agriculture, and human health (Küpper and Andresen 2016). Among the heavy metals, mercury (Hg, a highly toxic nonessential element) contaminates agricultural areas via mercury-containing compounds such as herbicides, pesticides, fertilizers, and limes (Han et al. 2002). The major reasons for the toxic nature of Hg are the long biological half-life and high accumulation capacity in living tissues (Ahmad et al. 2021). Mercury toxicity differs depending upon its chemical form. Inorganic Hg compounds, for instance, mercury (II) chloride (HgCl2), are formed as a consequence of the combination of Hg with different elements, and they have high water solubility (Liu et al. 2021).

Mercury is easily absorbed by the plant roots and affects growth and productivity by disturbing major biochemical and physiological processes in plants (Ahmad et al. 2018). Mercury ions impair the cellular structures as it reacts with sulfhydryl groups of biomolecules. Furthermore, Hg can induce mineral deficiencies due to the fact that it accounts for the displacement of many essential elements (Chen et al. 2014). Mercury toxicity triggers reactive oxygen species (ROS) formation by interfering electron transport chain, which results into oxidative stress in plant cells (Meng et al. 2011; Roychoudhury and Chakraborty 2020). Plants contain antioxidant defense systems, comprised of both enzymatic (e.g., superoxide dismutase, catalase, and ascorbate peroxidase) and non-enzymatic components (e.g., phenolic compounds, ascorbate, and glutathione), to scavenge ROS (Scandalios et al. 2005; Hasanuzzaman et al. 2020). An improved antioxidant system has been shown to play a key role in the amelioration of Hg-induced oxidative stress (Shiyab et al. 2009; Sahu et al. 2012; Malik et al. 2019; Safari et al. 2019).

The physiological response to stresses results from alterations in gene expression in cells. The products of these genes can be categorized into two main groups, (1) proteins that directly protect cells from abiotic and biotic stresses by scavenging ROS, and (2) transcription factors (TFs) and protein kinases that modify signal transduction under stress conditions (Kasuga et al. 1999). Alterations in expression patterns of genes are initiated by the involvement of stress-regulated cis-acting elements and stress-responsive TFs. Finally, these gene products can facilitate protecting cells from oxidative damage (Singh et al. 2019). Stress-inducible TFs include members of the ethylene-responsive factor (ERF), WRKY, dehydration-responsive element-binding (DREB), basic helix–loop–helix (bHLH), zinc-finger, MYeloBlastosis (MYB), NAC, basic-domain leucine zipper (bZIP), and homeodomain transcription factor families (Shinozaki et al. 1997; Baillo et al. 2019). It has been demonstrated that the expression of genes associated with photosynthesis, secondary metabolism, antioxidative system, and abiotic stress response is altered by Hg stress (Heidenreich et al. 2001; Chen et al. 2014).

Triticum aestivum L. (wheat) is one of the most important cereals in the world and a good source of protein and calories (Chaves et al. 2013). Wheat production is adversely affected by unfavorable environmental factors (Rahaie et al. 2013). To improve crop tolerance to abiotic stress conditions, increasing attention has been paid to understanding stress-related molecular and biochemical mechanisms in plants. However, little is known regarding the molecular mode of action of Hg toxicity and the defense responses against it (Chen et al. 2014). The determination of temporal and spatial expression patterns of stress-related genes is crucial for the understanding of plant stress responses (Singh et al. 2002). Therefore, we aimed in this study to evaluate the time-dependent physiological and molecular responses of wheat leaves to Hg stress. In this context, wheat seedlings were exposed to different concentrations of HgCl2 for 24 and 48 h. Mercury accumulation, oxidative stress marker (hydrogen peroxide and malondialdehyde) parameters, antioxidant enzyme (SOD and CAT) levels, proline content, and transcript levels of genes encoding antioxidant enzymes and TFs were then evaluated.

Materials and methods

Plant materials, growth conditions, and treatments

In this study, bread wheat (Triticum aestivum L. cv. Pehlivan) seeds were obtained from Trakya Agricultural Research Institute, Edirne (Türkiye). Healthy seeds were sterilized and germinated on moist filter paper in Petri plates for 4 days at 22.0 ± 0.5 °C in darkness. After germination, uniform seedlings were transferred to the hydroponic system (Çatav et al. 2021) containing one-fourth strength of the Hoagland medium (Hoagland and Arnon 1950) and allowed to adapt for 3 days. After 7 days of growth, the seedlings were exposed to 5, 10, and 20 µM mercury chloride (HgCl2) for 24 and 48 h. Mercury chloride concentrations were selected based on Sahu et al. (2012). Plants grown in the nutrient solution without HgCl2 were taken as control. Seedlings were grown at 23.0 ± 1.0 °C under a 16:8 h photoperiod cycle (180 µmol m− 2 s− 1) in the plant growth chamber. The nutrient solutions were continuously aerated and changed every other day. The experiments were carried out in 3 replicates with every set consisting of 30 plants. At the end of each treatment period, the leaves of wheat seedlings were collected and stored at − 80 °C for biochemical and molecular analyses.

Determination of mercury content

The leaf samples were dried at 70 °C for 48 h and ground into a powder. Sample preparation was performed according to the method reported earlier (Surgun-Acar and Zemheri-Navruz 2019). Mercury content in leaves was quantified using ICP-OES (Spectroblue, Germany) technique, and all samples were analyzed in triplicate.

Hydrogen peroxide (H2O2) and malondialdehyde (MDA) level

For determination of H2O2 and MDA levels, leaf samples (0.3 g) were grounded in 3 mL ice-cold 0.1% (v/w) trichloroacetic acid and centrifuged at 10,064 g for 15 min (4 °C). Supernatants were used for the H2O2 and MDA analyses according to Velikova et al. (2000) and Madhava Rao and Sresty (2000), respectively.

Antioxidant enzyme analyses

Frozen leaf samples (0.3 g) were homogenized in 400 µL cold phosphate-buffered saline solution (pH 7.2–7.4). After centrifugation at 2516 g for 20 min (4 °C), supernatants were used for antioxidant enzyme analysis. Superoxide dismutase (SOD) (EC1.15.1.1) and Catalase (CAT) (EC 1.11.1.6) amounts were determined utilizing Plant CAT and SOD Elisa Kits (SunRed, China), respectively. The levels of CAT and SOD enzymes were calculated using SOD and CAT standards, respectively, and expressed as ng mL− 1.

Proline content

The free proline content of wheat leaves was estimated as described by Shabnam et al. (2016). Leaf samples (0.3 g) were ground in 3 mL of 5-sulfosalicylic acid (3%) and filtered through Whatman filter papers (No. 2). Two mL of acid-ninhydrin solution was added to 1 mL filtrate of each sample and incubated at 100 °C for 30 min. After the reaction was stopped on ice, the absorbance of mixtures was measured at 508 nm. Proline content was estimated using a standard curve of known concentrations of l-proline and expressed as nmol g− 1 FW.

Molecular analysis

Total RNA was isolated from frozen leaf samples (0.1 g) using GeneJET Plant RNA Purification Kit (Thermo, Germany). RNA purity and concentration were determined on a spectrophotometer and the integrity of RNA was checked by gel electrophoresis. One microgram of total RNA was treated with DNaseI (Thermo, Germany), followed by reverse transcription using oligo(dT) primer and the iScript Reverse Transcriptase (Bio-Rad, USA). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to analyze the expression levels of SOD isoforms including copper/zinc superoxide dismutase (Cu/ZnSOD), iron superoxide dismutase (Fe-SOD), and manganese superoxide dismutase (Mn-SOD), catalase (CAT), and TFs (TaWRKY2, TaWRKY19, and TaDREB1). Sequences of gene-specific primers are given in Table 1. Transcript levels were normalized using Actin as a reference gene. The qRT-PCR reaction and conditions were employed as described in an earlier study (Çatav et al. 2021). The analyses were done using the CFX Connect Real-Time PCR System (Bio-Rad, USA) and CFX Manager 3.1 software (Bio-Rad, USA) was used to determine the relative expression level of genes. The specificity of PCR products was verified by melting curve analysis. In qRT-PCR analysis, three independent biological replicates were used for each treatment.

Table 1.

Primer sequences used in this study

Gene names GenBank accession no. Primer sequence (5′–3′) References
Cu/Zn-SOD U69632.1

CGCTCAGAGCCTCCTCTTT

CTCCTGGGGTGGAGACAAT

 Sheoran et al. (2015)
Fe-SOD JX398977.1

CCTACTGGATGAGACGGAGAG

GGACGAGGACAACGACGAA

 Sheoran et al. (2015)
Mn-SOD AF092524.1

CAGAGGGTGCTGCTTTACAA

GGTCACAAGAGGGTCCTGA

 Sheoran et al. (2015)
CAT D86327.1

CCATGAGATCAAGGCCATCT

ATCTTACATGCTCGGCTTGG

 Sheoran et al. (2015)
TaWRKY2 EU665425.1

GGCGCTGCCGACGTCATCTT

AGCAGAGGAGCGACTCGACGA

 Gao et al. (2018)
TaWRKY19 EU665430.1

AGGGAAGCATACGCATGACGTGC

GGCGAGATCGTTCAGAATGGCT

 Gao et al. (2018)
TaDREB1 AF303376.1

AGACCGAGGCGAGAGGAGAT

GCAACCGAATCAGGACCAGTG

 Gao et al. (2018)
Actin AB181991.1

CGAAGCGACATACAATTCCATC

GAACCTCCACTGAGAACAACAT

 Wang et al. (2017)
Open in a new tab

Data analysis

Data from molecular and biochemical assays were subjected to one- or two-way ANOVA in order to understand Hg toxicity-related responses at different times. Tukey’s post-hoc test was used in case of a significant difference among groups. Prior to each analysis, parametric test assumptions, such as normality of data and homogeneity of variance were verified by Anderson-Darling and Bartlett’s tests, respectively, and if required data transformations were applied.

Results

Mercury content in leaves

Mercury chloride treatments resulted in a time-dependent increase in the Hg content of wheat leaves as compared to control conditions (Fig. 1). Treatment of seedlings with 5, 10 and 20 µM HgCl2 for 24 h increased Hg accumulation in leaves 9.8, 11.2- and 21.1-fold, respectively. A maximum increase in Hg content was found after 48 h treatment with 20 µM HgCl2 (51.6-fold). In addition, there were differences in terms of Hg accumulation between wheat seedlings treated with HgCl2 for 24 and 48 h (Fig. 1; Table 2).

Fig. 1.

Fig. 1

Open in a new tab

Mercury content of wheat leaves subjected to different concentrations of HgCl2 for 24 and 48 h. Results are presented as mean ± SEM (n = 3). Different letters above error bars denote that mean values are markedly different from one another (p < 0.05)

Table 2.

Results of two-way ANOVA analysis about the direct and interactive effects of independent factors (treatment and exposure period) on physiological and biochemical parameters

Parameter Treatment Exposure time Interaction
% p % p % p
Hg content 80.21 < 0.0001 14.53 < 0.0001 5.16 < 0.0001
H2O2 level 71.96 < 0.0001 2.28 ns 3.07 ns
MDA content 69.97 < 0.0001 5.27 0.017 5.48 ns
Proline content 91.29 < 0.0001 2.31 0.0021 1.75 0.049
SOD level 73.79 < 0.0001 15.17 < 0.0001 6.69 0.0016
CAT level 62.30 < 0.0001 12.24 0.013 0.25 ns
Open in a new tab

ns: statistically not significant; %: percent of the total variation

Oxidative stress parameters

Treatment with HgCl2 caused changes in H2O2 content in leaves of wheat seedlings following 24 and 48 h exposure. The level of H2O2 increased significantly at similar rates in seedlings exposed to 5 (9.8–9.5%), 10 (11.1–15.0%) and 20 µM (18.4–15.0%) HgCl2 in both exposure time (Fig. 2A). The extent of lipid peroxidation in wheat leaves measured in terms of MDA contents is shown in Fig. 2B. Mercury toxicity resulted in a marked increase of MDA content in the leaves of seedlings. The highest content of MDA (4.1 and 4.3 nmol g− 1 FW) was found in seedlings exposed to 20 µM HgCl2 for 24 and 48 h, respectively (Fig. 2B).

Fig. 2.

Fig. 2

Open in a new tab

The effect of different concentrations of HgCl2 for 24 and 48 h on (A) H2O2 and (B) MDA contents of wheat leaves. Results are presented as mean ± SEM (n = 4). Different letters above error bars denote that mean values are markedly different from one another (p < 0.05)

Responses of antioxidant enzymes to Hg exposure

Superoxide dismutase and CAT levels of wheat seedlings subjected to different concentrations of HgCl2 for 24 and 48 h are demonstrated in Fig. 3. In leaves of seedlings treated with 5, 10, and 20 µM HgCl2, the SOD level was decreased by 27.6%, 28.9%, and 17.8%, respectively, after 24 h of exposure (Fig. 3A). Prolonged exposure to HgCl2 (48 h) resulted in a further reduction in the level of SOD. The CAT level decreased by 35.6 and 39.3% in the leaves of seedlings subjected to 5 µM HgCl2 for 24 and 48 h, respectively (Fig. 3B). Lastly, the results of the two-way ANOVA analysis indicate that Hg exposure time has a slight but significant effect on the levels of these antioxidant enzymes (Table 2).

Fig. 3.

Fig. 3

Open in a new tab

The effect of different concentrations of HgCl2 for 24 and 48 h on (A) SOD and (B) CAT levels in wheat leaves. Results are presented as mean ± SEM (n = 3). Different letters above error bars denote that mean values are markedly different from one another (p < 0.05)

Effect of Hg treatments on proline content in leaves

All Hg treatments gave rise to marked increases in proline content relative to control groups after 24 and 48 h of exposure (Fig. 4; Table 2). Moreover, wheat leaves accumulated more proline at 48 h compared to 24 h in the treatment of 5 µM HgCl2. However, there was no significant effect of exposure period on proline accumulation in wheat leaves for 10 and 20 µM HgCl2 treatments (Table 2).

Fig. 4.

Fig. 4

Open in a new tab

Proline content of wheat leaves exposed to different concentrations of HgCl2 for 24 and 48 h. Results are presented as mean ± SEM (n = 4). Different letters above error bars denote that mean values are markedly different from one another (p < 0.05)

The expression levels of stress-related genes

Except for the TaWRKY2 gene, stress-related genes generally showed a similar expression pattern after 24 and 48 h treatment with HgCl2 (Fig. 5). Mercury toxicity caused significant decreases in the mRNA levels of Cu/Zn-SOD and Fe-SOD genes compared with respective control groups (Fig. 5). Unlike other SOD genes, the expression level of Mn-SOD gene was up-regulated by higher concentrations of HgCl2 (10 and 20 µM) following 24 h (Fig. 5A). Treatment with 20 µM for 48 h increased the mRNA level of Mn-SOD gene in leaves (Fig. 5B). The transcript level of the CAT gene in wheat leaves grown under 10 and 20 µM HgCl2 for 24 h was 4.9- and 6.1-fold higher than those grown under control conditions, respectively (Fig. 5A). Marked increases (1.9–2.5-fold) in the expression level of the CAT gene were also observed in seedlings subjected to these treatments for 48 h (Fig. 5B).

Fig. 5.

Fig. 5

Open in a new tab

The relative expression levels of genes encoding antioxidant enzymes and TFs in wheat seedlings treated with different concentrations of HgCl2 for 24 h (A) and 48 h (B). Results are presented as mean ± SEM (n = 3). Values were calculated relative to the expression level of control, which was adjusted to 100%. Different letters above error bars denote that mean values are markedly different from one another for each gene (p < 0.05)

Transcript levels of TFs differed depending on the HgCl2 concentrations (Fig. 5). The mRNA level of the TaWRKY2 gene in wheat leaves was increased 2.1, 2.1- and 2.3-fold after 24 h exposure to 5, 10, and 20 µM HgCl2, respectively (Fig. 5A). The expression level of the TaWRKY2 gene up-regulated (1.73-fold) in leaves of seedlings subjected to 5 µM HgCl2 for 48 h while decreases were observed in the expression level of the gene after 10 and 20 µM HgCl2 treatments (Fig. 5B). Treatment with HgCl2 for 24 h caused declines in mRNA level of TaWRKY19 gene (between 1.2 and 1.5-fold) whereas further decreases in expression level were detected after 48 h exposure (between 3.2 and 3.7-fold) (Fig. 5). Exposure to 10 and 20 µM HgCl2 for 24 h led to a reduction in the transcript level (between 1.2 and 1.5-fold) of the TaDREB1 gene (Fig. 5A). Moreover, the decrease in expression of this gene was more pronounced in seedlings treated with HgCl2 for 48 h (between 1.8 and 2.9-fold) (Fig. 5B).

Discussion

Even though a few studies have attempted to evaluate Hg-related biochemical changes in wheat, studies on its molecular effects are scarce. For the first time in this study, the effects of Hg on the antioxidative system were evaluated at both biochemical and gene expression levels. Several factors, such as microbial activity, organic matter, and pH alter the bioavailability of Hg in soils. Plants can uptake Hg from root cells through copper (Cu), zinc (Zn), or iron (Fe) transporters/channels (Chen and Yang 2012; Shahid et al. 2020). The translocation of Hg from roots to leaves was demonstrated by autoradiographic analyses (Cavallini et al. 1995). In the present study, Hg concentrations in leaves increased with Hg exposure periods. Our results agree with the findings of Malik et al. (2019) for Cichorium intybus plants exposed to different concentrations of HgCl2 for 23 and 46 days.

Hydrogen peroxide is one of the most abundant ROS in higher plants. Hydrogen peroxide plays a prominent role in the regulation of various cellular processes at basal levels but excess H2O2 is known to damage biomolecules (Miller et al. 2008; Mittler 2017). Abiotic stress conditions (e.g. drought and heavy metal toxicity) have been shown to stimulate NADH oxidase, which is the main enzyme generating H2O2 in plants (Mittler 2002). The current study also found that Hg stress induced the production of H2O2 in wheat leaves. The increase in MDA content might be a result of Hg-induced ROS formation in chloroplasts and peroxisomes of plants (Hu et al. 2012). Ahmad et al. (2018) reported a significant increment in H2O2 and MDA levels in Cicer arietinum plants exposed to 15 and 30 µM HgCl2. The balance between ROS production and detoxification is maintained by enzymatic and non-enzymatic antioxidants (Caverzan et al. 2016). Superoxide dismutase, one of the key enzymes in the antioxidant system, catalyzes the dismutation of superoxide anion (O2·−) to H2O2, which is detoxified to oxygen and water by CAT enzyme or peroxidases (Miller et al. 2008). We observed a significant decline in the SOD level of Hg-stressed seedlings at both exposure times. Similar results were found in wheat (Sahu et al. 2012) and Sorghum vulgare (Mukhraiya and Bhat 2017) plants exposed to Hg. While redox-active metals (e.g. Cu, Cr, and Fe) enter redox cycling via Fenton reaction, redox-inactive metals (e.g. Cd, Hg, and Pb) reduce the activities of antioxidants by blocking their functional groups and active sites (Ercal et al. 2001; Jalmi et al. 2018). The decrease in the level of SOD enzyme in leaves of plants subjected to Hg could be based on enzyme inactivation by excess ROS, inhibition of enzyme synthesis, or an alteration in the assembly of its subunits under stress conditions (Ushimaru et al. 1999). In the current study, the expression levels of plastidic SOD genes (Cu/Zn-SOD and Fe-SOD) were down-regulated in leaves of wheat seedlings under Hg stress whereas an increase was observed in the transcript level of the Mn-SOD (mitochondrial SOD) gene at higher Hg concentrations. This may be explained by mitochondria have subjected to significantly increased ROS levels during the treatments or/and Mn-SOD can be a mechanism responsible for protecting mitochondria against increased ROS. Genome-wide identification analyses have shown that SOD genes are expressed differentially in response to the same stress conditions in wheat (Jiang et al. 2019). However, some studies have reported that expression profiles of SOD genes in Zea mays (Aysin et al. 2020) and Brassica napus (Yuan et al. 2021) are not changed by Hg stress. The alterations in expression pattern may depend on the nature of the plant, applied Hg levels, and treatment time (Küpper and Andresen 2016). Our results indicated that a lower concentration of Hg decreased the CAT enzyme level in wheat leaves in both exposure periods. Varying results have been reported for changes in the activity of the CAT enzyme in wheat plants under abiotic stress (Caverzan et al. 2016). No alteration in the activity of CAT enzyme could be noticed in wild-type Arabidopsis thaliana seedlings subjected to 10 µM Hg treatment for 12 h, whereas a decline was observed in enzyme activity after 36, 48, and 60 h treatment (Xu et al. 2017). An increase in the transcript level of the CAT gene was observed following treatment with higher concentrations of HgCl2. The discrepancies between CAT gene expression and CAT enzyme level might arise from the presence of multiple allo-or isozymes (Smeets et al. 2008) and/or post-transcriptional and -translational modifications (Mazzucotelli et al. 2008).

The WRKY gene family plays a crucial role in the regulation of transcriptional reprogramming related to plant stress responses (Chen and Yang 2012). Niu et al. (2012) revealed 43 putative TaWRKY genes in bread wheat (T. aestivum). To regulate gene expression, most defined WRKY proteins with the WRKYGQK sequence can bind to the W box (Wb) (TTGACT/C) that is found in the promoters of various defense genes in plants (Eulgem et al. 2000). We report here for the first time that Hg induces changes in the transcription level of TFs. In our study, the transcript level of the TaWRKY2 gene was increased after 24 h of Hg treatments. On the other hand, a decrease was observed in the expression of this gene in leaves of wheat seedlings subjected to 10 and 20 µM HgCl2 for 48 h. Moreover, the expression level of the TaWRKY19 gene was reduced at both exposure times as compared to respective controls. The variation in expression profiles may be due to different functions of TaWRKY genes in divergent signaling transduction pathways (Wu et al. 2008). Transcriptome profiling analysis revealed that major WRKY families significantly up-regulated in Oryza sativa (L.) plants subjected to short (1–3 h) and long term (24 h) Hg (Chen et al. 2014). The time-dependent expression levels of the TaWRKY2 and TAWRKY19 genes showed different induction patterns in wheat plants exposed to cold, drought, salt, and ABA treatments (Niu et al. 2012). In Egyptian wheat genotypes, TaWRKY genes, including the TaWRKY2 gene demonstrated distinct expression patterns after salt treatment for one week (Gowayed and El-Moneim 2021). Wu et al. (2020) reported a decrease in transcript level of TaWRKY2 and TaWRKY19 genes in wheat plants grown under salt, osmotic, and high light stress for 1 and 3 h (except for osmotic stress treatment for 1 h in TaWRKY19 gene).

The dehydration-responsive element-binding proteins are important TFs that enable plants to gain resistance to stresses by regulating a number of abiotic stress-related genes (Agarwal et al. 2006). DREB proteins interact with the dehydration-responsive element (DRE) motif and promote the expression of stress tolerance genes in plants (Liu et al. 1998). It was found a reduction in the expression level of the DREB1 gene in leaves of wheat subjected to Hg toxicity for 24 and 48 h. The time-course expression pattern of TaDREB1 showed a down-regulation in wheat (cv. Xiaoyan 54) seedlings after 24 and 48 h following ABA, salt, and PEG treatments (Shen et al. 2003). Rustamova et al. (2021) observed a higher expression level in the DREB1 gene in tolerant genotypes of Triticum durum (Desf.) as compared to sensitive ones and they asserted a significant difference in the expression of the DREB1 gene depending on the origin of wheat.

Proline is an amino acid with multiple functions in plants and overproduction of proline contributes to maintaining cellular homeostasis, osmotic adjustment, and redox balance to mitigate oxidative damage (Roychoudhury et al. 2015; Ghosh et al. 2021). Similar to our results, Hg treatments led to a rise in the level of proline in Eichhornia crassipes (Malar et al. 2015) and Melissa officinalis (Safari et al. 2019). In a different study, proline accumulation and the activity of D1-pyrroline-5-carboxylate synthetase (P5CS, proline biosynthesis enzyme) increased significantly in response to 50 and 100 µM Hg for 12 and 36 h. They concluded that the accumulation of proline in Hg-treated wheat plants was heavily dependent on the constitutive activity of P5CS (Shaw and Rou 2002).

Conclusions

Concentration-dependent accumulation of Hg for 24 and 48 h in wheat leaves led to an increase in H2O2 levels and lipid peroxidation. Mercury toxicity-induced stress responses included alterations in gene expression profiles, oxidative and antioxidative status, and proline content. The biochemical and molecular responses of wheat seedlings grown under different concentrations of HgCl2 generally showed a similar pattern at both exposure times. In conclusion, this study provided evidence that Hg toxicity could alter the expression of some genes encoding WRKY and DREB TF families regulating stress-related responses in plants.

Acknowledgements

We would like to thank Professor Mevlüt Akçura for providing seeds.

Declarations

Conflict of interest

All authors declare that they have no conflict of interest.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Rabia İşkil, Email: rabia.iskil@gmail.com.

Yonca Surgun-Acar, Email: yoncasurgun@gmail.com.

Şükrü Serter Çatav, Email: sertercatav@mu.edu.tr.

Fahriye Zemheri-Navruz, Email: fahriyezmhr@hotmail.com.

Yavuz Erden, Email: byerden@gmail.com.

References

  1. Agarwal PK, Agarwal P, Reddy MK, Sopory SK. Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 2006;25:1263–1274. doi: 10.1007/s00299-006-0204-8. [DOI] [PubMed] [Google Scholar]
  2. Ahmad P, Ahanger MA, Egamberdieva D, Alam P, Alyemeni MN, Ashraf M. Modification of osmolytes and antioxidant enzymes by 24-epibrassinolide in chickpea seedlings under mercury (Hg) toxicity. J Plant Growth Regul. 2018;37:309–322. doi: 10.1007/s00344-017-9730-6. [DOI] [Google Scholar]
  3. Ahmad P, Alyemeni MN, Wijaya L, Ahanger MA, Ashraf M, Alam P, Paray BA, Rinklebe J. Nitric oxide donor, sodium nitroprusside, mitigates mercury toxicity in different cultivars of soybean. J Hazard Mater. 2021;408:124852. doi: 10.1016/j.jhazmat.2020.124852. [DOI] [PubMed] [Google Scholar]
  4. Aysin F, Karaman A, Yılmaz, Aksakal Ö, Gezgincioglu E, Kohnehshahri SM. Exogenous cysteine alleviates mercury stress by promoting antioxidant defence in maize (Zea mays L.) seedlings. Turk J Agric For. 2020;44:506–516. doi: 10.3906/tar-1909-2. [DOI] [Google Scholar]
  5. Baillo EH, Kimotho RN, Zhang Z, Xu P. Transcription factors associated with abiotic and biotic stress tolerance and their potential for crops improvement. Genes. 2019;10:771. doi: 10.3390/genes10100771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Çatav ŞS, Surgun-Acar Y, Zemheri-Navruz F. Physiological, biochemical, and molecular responses of wheat seedlings to salinity and plant-derived smoke. S Afr J Bot. 2021;139:148–157. doi: 10.1016/j.sajb.2021.02.011. [DOI] [Google Scholar]
  7. Cavallini A, Natali L, Durante M, Maserti B. Mercury uptake, distribution and DNA affinity in durum wheat (Triticum durum Desf.) plants. Sci Total Environ. 1995;243:119–127. doi: 10.1016/S0048-9697(99)00367-8. [DOI] [Google Scholar]
  8. Caverzan A, Casassola A, Brammer SA. Antioxidant responses of wheat plants under stress. Genet Mol Biol. 2016;39:1–6. doi: 10.1590/1678-4685-GMB-2015-0109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chaves MS, Martinelli JA, Wesp-Guterres C, Graichen FAS, Brammer S, Scagliusi SM, Da Silva PR, Wiethölter P, Torres GAM, Lau EY, Consoli L, Chaves ALS. The importance for food security of maintaining rust resistance in wheat. Food Sec. 2013;5:157–176. doi: 10.1007/s12571-013-0248-x. [DOI] [Google Scholar]
  10. Chen J, Yang ZM. Mercury toxicity, molecular response and tolerance in higher plants. Biometals. 2012;25:847–857. doi: 10.1007/s10534-012-9560-8. [DOI] [PubMed] [Google Scholar]
  11. Chen YA, Chi WC, Trinh NN, Huang LY, Chen YC, Cheng KT, Huang TL, Lin CY, Huang HJ. Transcriptome profiling and physiological studies reveal a major role for aromatic amino acids in mercury stress tolerance in rice seedlings. PLoS ONE. 2014;9:e95163. doi: 10.1371/journal.pone.0095163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ercal N, Gurer-Orhan H, Aykin-Burns N. Toxic metals and oxidative stress part I: mechanisms involved in metal-induced oxidative damage. Curr Top Med Chem. 2001;1:529–539. doi: 10.2174/1568026013394831. [DOI] [PubMed] [Google Scholar]
  13. Eulgem T, Rushton PJ, Robatzek S, Somssich IE. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000;5:199–206. doi: 10.1016/S1360-1385(00)01600-9. [DOI] [PubMed] [Google Scholar]
  14. Gao HM, Wang YF, Xu P, Zhang ZB. Overexpression of a WRKY transcription factor TaWRKY2 enhances drought stress tolerance in transgenic wheat. Front Plant Sci. 2018;9:997. doi: 10.3389/fpls.2018.00997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ghosh UK, Islam MN, Siddiqui MN, Cao X, Khan MAR. Proline, a multifaceted signalling molecule in plant responses to abiotic stress: Understanding the physiological mechanisms. Plant Biol. 2021;24:227–239. doi: 10.1111/plb.13363. [DOI] [PubMed] [Google Scholar]
  16. Gowayed SMH, Abd El-Moneim D. Detection of genetic divergence among some wheat (Triticum aestivum L.) genotypes using molecular and biochemical indicators under salinity stress. PLoS ONE. 2021;16:e0248890. doi: 10.1371/journal.pone.0248890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Han FX, Banin A, Su Y, Monts DL, Plodinec MJ, Kingery WL, Triplett GB. Industrial age anthropogenic inputs of heavy metals into the pedosphere. Naturwissenschaften. 2002;89:497–504. doi: 10.1007/s00114-002-0373-4. [DOI] [PubMed] [Google Scholar]
  18. Hasanuzzaman M, Bhuyan MHM, Zulfiqar F, Raza A, Mohsin SM, Mahmud JA, Fujita M, Fotopoulos V. Reactive oxygen species and antioxidant defense in plants under abiotic stress: revisiting the crucial role of a universal defense regulator. Antioxidants. 2020;9:681. doi: 10.3390/antiox9080681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Heidenreich B, Mayer K, Sandermann JR, Ernst D. Mercury-induced genes in Arabidopsis thaliana: identification of induced genes upon long-term mercuric ion exposure. Plant Cell Environ. 2001;24:1227–1234. doi: 10.1046/j.0016-8025.2001.00775.x. [DOI] [Google Scholar]
  20. Hoagland DR, Arnon DI. The water culture method for growing plants without soil. Calif Agric Exp Stn. 1938;3:346–347. [Google Scholar]
  21. Hu R, Sunc K, Suc X, Pana Y, Zhanga Y, Wanga X. Physiological responses and tolerance mechanisms to Pb in two xerophils: Salsola passerina Bunge and Chenopodium album L. J Hazard Mater. 2012;205–206:131–138. doi: 10.1016/j.jhazmat.2011.12.051. [DOI] [PubMed] [Google Scholar]
  22. Jalmi SK, Bhagat PK, Verma D, Noryang S, Tayyeba S, Singh K, Sharma D, Sinha AK. Traversing the links between heavy metal stress and plant signaling. Front Plant Sci. 2018;9:12. doi: 10.3389/fpls.2018.00012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jiang WQ, Yang L, He YQ, Zhang HT, Li W, Chen HG, Ma DF, Yin JL. Genome-wide identification and transcriptional expression analysis of superoxide dismutase (SOD) family in wheat (Triticum aestivum) PeerJ. 2019;7:e8062. doi: 10.7717/peerj.8062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat Biotechnol. 1999;17:287–291. doi: 10.1038/7036. [DOI] [PubMed] [Google Scholar]
  25. Küpper H, Andresen E. Mechanisms of metal toxicity in plants. Metallomics. 2016;8:269–285. doi: 10.1039/c5mt00244c. [DOI] [PubMed] [Google Scholar]
  26. Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell. 1998;10:1391–1406. doi: 10.1105/tpc.10.8.1391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liu S, Wang X, Guo G, Yan Z. Status and environmental management of soil mercury pollution in China: a review. J Environ Manage. 2021;277:111442. doi: 10.1016/j.jenvman.2020.111442. [DOI] [PubMed] [Google Scholar]
  28. Madhava Rao KV, Sresty TVS. Antioxidative parameters in the seedlings of pigeonpea (Cajanus cajan (L.) Millspaugh) in response to Zn and Ni stresses. Plant Sci. 2000;157:113–128. doi: 10.1016/S0168-9452(00)00273-9. [DOI] [PubMed] [Google Scholar]
  29. Malar S, Sahi SV, Favas PJC, Venkatachalam P. Mercury heavy metal-induced physiochemical changes and genotoxic alterations in water hyacinths [Eichhornia crassipes (Mart.)] Environ Sci Pollut Res. 2015;22:4597–4608. doi: 10.1007/s11356-014-3576-2. [DOI] [PubMed] [Google Scholar]
  30. Malik B, Pirzadah TB, Tahir I, Rehman RU. Growth and physiological responses in chicory towards mercury induced in vitro oxidative stress. Plant Physiol Rep. 2019;24:236–248. doi: 10.1007/s40502-019-00442-2. [DOI] [Google Scholar]
  31. Mazzucotelli E, Mastrangelo AM, Crosatti C, Guerra D, Stanca AM, Cattivelli L. Abiotic stress response in plants: when post-transcriptional and posttranslational regulations control transcription. Plant Sci. 2008;174:420–432. doi: 10.1016/j.plantsci.2008.02.005. [DOI] [Google Scholar]
  32. Meng DK, Chen J, Yang ZM. Enhancement of tolerance of Indian mustard (Brassica juncea) to mercury by carbon monoxide. J Hazard Mater. 2011;186:1823–1829. doi: 10.1016/j.jhazmat.2010.12.062. [DOI] [PubMed] [Google Scholar]
  33. Miller G, Shulaev V, Mittler R. Reactive oxygen signaling and abiotic stress. Physiol Plant. 2008;133:481–489. doi: 10.1111/j.1399-3054.2008.01090.x. [DOI] [PubMed] [Google Scholar]
  34. Mittler R. Oxidative stress, antioxidants and stress tolerance. Trend Plant Sci. 2002;7:405–410. doi: 10.1016/S1360-1385(02)02312-9. [DOI] [PubMed] [Google Scholar]
  35. Mittler R. ROS are good. Trend Plant Sci. 2017;22:11–19. doi: 10.1016/j.tplants.2016.08.002. [DOI] [PubMed] [Google Scholar]
  36. Mukhraiya D, Bhat J. Assessment of mercury toxicity on seed germination, growth and antioxidant enzyme expression of Sorghum vulgare var. SG-1000 seedlings. Int J Theoretical Appl Sci. 2017;9:45–50. [Google Scholar]
  37. Niu CF, Wei W, Zhou QY, Tian AG, Hao YJ, Zhang WK, Ma B, Lin Q, Zhang ZB, Zhang JS, Chen SY. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ. 2012;35:1156–1170. doi: 10.1111/j.1365-3040.2012.02480.x. [DOI] [PubMed] [Google Scholar]
  38. Rahaie M, Xue GP, Schenk PM (2013) The role of transcription factors in wheat under different abiotic stresses. In: Vahdati K, Leslie C (ed) Abiotic Stress - Plant Responses and Applications in Agriculture, InTech, Rijeka, Croatia, pp 367–385
  39. Roychoudhury A, Chakraborty S (2020) Cellular and molecular phytotoxicity of Lead and Mercury. In: Faisal M, Saquib Q, Alatar AA, AlKhedhairy AA (eds) Cellular and molecular phytotoxicity of heavy metals nanotechnology in the life sciences. Springer, Cham, pp 373–387
  40. Roychoudhury A, Banerjee A, Lahiri V. Metabolic and molecular-genetic regulation of proline signaling and its cross-talk with major effectors mediates abiotic stress tolerance in plants. Turk J Bot. 2015;39:887–910. doi: 10.3906/bot-1503-27. [DOI] [Google Scholar]
  41. Rustamova S, Shrestha A, Naz AA, Huseynova I. Expression profiling of DREB1 and evaluation of vegetation indices in contrasting wheat genotypes exposed to drought stress. Plant Gene. 2021;25:100266. doi: 10.1016/j.plgene.2020.100266. [DOI] [Google Scholar]
  42. Safari F, Akramian M, Salehi-Arjmand H, Khadivi A. Physiological and molecular mechanisms underlying salicylic acid-mitigated mercury toxicity in lemon balm (Melissa ofcinalis L.) Ecotoxicol Environ Saf. 2019;183:109542. doi: 10.1016/j.ecoenv.2019.109542. [DOI] [PubMed] [Google Scholar]
  43. Sahu GK, Upadhyay S, Sahoo BB. Mercury induced phytotoxicity and oxidative stress in wheat (Triticum aestivum L.) plants. Physiol Mol Biol Plants. 2012;8:21–31. doi: 10.1007/s12298-011-0090-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Scandalios JG (20059 Oxidative stress: molecular perception and transduction of signals triggering antioxidant gene defenses. Braz J Med Biol Res 38:995–1014 [DOI] [PubMed]
  45. Shabnam N, Tripathi I, Sharmila P, Pardha-Saradhi P. A rapid, ideal, and eco-friendlier protocol for quantifying proline. Protoplasma. 2016;253:1577–1582. doi: 10.1007/s00709-015-0910-6. [DOI] [PubMed] [Google Scholar]
  46. Shahid M, Khalid S, Bibi I, Bundschuh J, Niazi NK, Dumat C. A critical review of mercury speciation, bioavailability, toxicity and detoxifcation in soil-plant environment: ecotoxicology and health risk assessment. Sci Total Environ. 2020;711:134749. doi: 10.1016/j.scitotenv.2019.134749. [DOI] [PubMed] [Google Scholar]
  47. Shaw BP, Rou NP (eds) (2002) Hg and Cd induced changes in proline content and activities of proline biosynthesizing enzymes in Phaseolus aureus and Triticum aestivum. Biol Plant 45: 267–271. 10.1023/A:1015109125988
  48. Shen YG, Zhang WK, He SJ, Zhang JS, Liu Q, Chen SY. An EREBP/AP-2-type protein in Triticum aestivum was a DRE-binding transcription factor induced by cold, dehydration and ABA stress. Theor Appl Genet. 2003;106:923–930. doi: 10.1007/s00122-002-1131-x. [DOI] [PubMed] [Google Scholar]
  49. Sheoran S, Thakur V, Narwal S, Turan R, Mamrutha HM, Singh V, Tiwari V, Sharma I. Differential activity and expression profile of antioxidant enzymes and physiological changes in wheat (Triticum aestivum L.) under drought. Appl Biochem Biotechnol. 2015;177:1282–1298. doi: 10.1007/s12010-015-1813-x. [DOI] [PubMed] [Google Scholar]
  50. Shinozaki K, Yamaguchi-Shinozaki K. Gene expression and signal transduction in water-stress response. Plant Physiol. 1997;115:327–334. doi: 10.1104/pp.115.2.327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Shiyab S, Chen J, Han FX, Monts DL, Matta FB, Gu M, Su Y. Phytotoxicity of mercury in Indian mustard (Brassica juncea L.) Ecotoxicol Environ Saf. 2009;72:619–625. doi: 10.1016/j.ecoenv.2008.06.002. [DOI] [PubMed] [Google Scholar]
  52. Singh K, Foley RC, Onate-Sanchez L. Transcription factors in plant defense and stress responses. Curr Opin Plant Biol. 2002;5:430–436. doi: 10.1016/S1369-5266(02)00289-3. [DOI] [PubMed] [Google Scholar]
  53. Singh A, Kumar A, Yadav S, Singh IK. Reactive oxygen species mediated signaling during abiotic stress. Plant Gene. 2019;18:100173. doi: 10.1016/j.plgene.2019.100173. [DOI] [Google Scholar]
  54. Smeets K, Ruytinx J, Semane B, Belleghem FV, Remans T, Sanden SV, Vangronsveld J, Cupers A. Cadmium-induced transcriptional and enzymatic alterations related to oxidative stress. Environ Exp Bot. 2008;63:1–8. doi: 10.1016/j.envexpbot.2007.10.028. [DOI] [Google Scholar]
  55. Surgun-Acar Y, Zemheri-Navruz F. 24-Epibrassinolide promotes arsenic tolerance in Arabidopsis thaliana L. by altering stress responses at biochemical and molecular level. J Plant Physiol. 2019;238:12–19. doi: 10.1016/j.jplph.2019.05.002. [DOI] [PubMed] [Google Scholar]
  56. Ushimaru T, Kanematsu S, Shibasaka M, Tsuji H. Effect of hypoxia on antioxidant enzymes in aerobically grown rice (Oryza sativa) seedlings. Physiol Plant. 1999;107:181–187. doi: 10.1034/j.1399-3054.1999.100205.x. [DOI] [Google Scholar]
  57. Velikova V, Yordanov I, Edreva A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: Protective role of exogenous polyamines. Plant Sci. 2000;151:59–66. doi: 10.1016/S0168-9452(99)00197-1. [DOI] [Google Scholar]
  58. Wang WQ, Hao QQ, Wang WL, Li QX, Wang W. The genetic characteristics in cytology and plant physiology of two wheat (Triticum aestivum) near isogenic lines with different freezing tolerances. Plant Cell Rep. 2017;36:1801–1814. doi: 10.1007/s00299-017-2195-z. [DOI] [PubMed] [Google Scholar]
  59. Wu H, Ni Z, Yao Y, Guo G, Sun Q. Cloning and expression profiles of 15 genes encoding WRKY transcription factor in wheat (Triticum aestivum L.) Prog Nat Sci. 2008;18:697–705. doi: 10.1016/j.pnsc.2007.12.006. [DOI] [Google Scholar]
  60. Wu N, Mao H, Chen MY, Dong J, Yuan M, Zhang ZW, Yuan S, Zhang HY, Chen YE. Different responses of photosystem and antioxidant defense system to three environmental stresses in wheat seedlings. Photosynthetica. 2020;58:87–99. doi: 10.32615/ps.2019.156. [DOI] [Google Scholar]
  61. Xu S, Sun B, Wang R, He J, Xia B, Xue Y, Wang R. Overexpression of a bacterial mercury transporter MerT in Arabidopsis enhances mercury tolerance. Biochem Biophys Res Commun. 2017;490:528–534. doi: 10.1016/j.bbrc.2017.06.073. [DOI] [PubMed] [Google Scholar]
  62. Yuan H, Liu Q, Guo Z, Fu J, Sun Y, Gu C, Xing B, Dhankher OP. Sulfur nanoparticles improved plant growth and reduced mercury toxicity via mitigating the oxidative stress in Brassica napus L. J Clean Prod. 2021;318:128589. doi: 10.1016/j.jclepro.2021.128589. [DOI] [Google Scholar]

Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES