Skip to main content
BMC Plant Biology logoLink to BMC Plant Biology
. 2022 May 19;22:248. doi: 10.1186/s12870-022-03622-9

Overexpression of AHL9 accelerates leaf senescence in Arabidopsis thaliana

Yusen Zhou 1,2,#, Xiaomin Zhang 1,2,#, Jing Chen 1,2,#, Xiaopeng Guo 1,2, Hongyan Wang 1,2, Weibo Zhen 1,2, Junli Zhang 1,2, Zhubing Hu 1,2, Xuebing Zhang 1,2, José Ramón Botella 3, Toshiro Ito 4,, Siyi Guo 1,2,
PMCID: PMC9118680  PMID: 35590269

Abstract

Background

Leaf senescence, the final stage of leaf growth and development, is regulated by numerous internal factors and environmental cues. Ethylene is one of the key senescence related hormones, but the underlying molecular mechanism of ethylene-induced leaf senescence remains poorly understood.

Results

In this study, we identified one AT-hook like (AHL) protein, AHL9, as a positive regulator of leaf senescence in Arabidopsis thaliana. Overexpression of AHL9 significantly accelerates age-related leaf senescence and promotes dark-induced leaf chlorosis. The early senescence phenotype observed in AHL9 overexpressing lines is inhibited by the ethylene biosynthesis inhibitor aminooxyacetic acid suggesting the involvement of ethylene in the AHL9-associated senescence. RNA-seq and quantitative reverse transcription PCR (qRT-PCR) data identified numerous senescence-associated genes differentially expressed in leaves of AHL9 overexpressing transgenic plants.

Conclusions

Our investigation demonstrates that AHL9 functions in accelerating the leaf senescence process via ethylene synthesis or signalling.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12870-022-03622-9.

Keywords: Arabidopsis thaliana, AT-hook like proteins, Ethylene, Leaf senescence, Transcription regulation

Background

Senescence is an intricate and highly orchestrated process in the plant’s life cycle. A range of biological events occur at the physiological, biochemical, and molecular levels during this period, including chloroplast degradation, hydrolization of macromolecules, reduction of cytoplasmic volume, and decrease in cellular metabolic activity. The most noticeable feature in leaf senescence is the rapid degradation of chlorophyll during chloroplast disassembly, which leads to the yellowing of leaves [1]. During senescence, leaf nutrients are remobilized and relocated from the dying leaves to seeds or other storage tissues, thereby contributing to the fitness and survival of plant [24]. Although senescence is an active process to relocate nutrients from old tissues, precocious senescence will shorten the growth stage of crops and result in reduced yield and crop quality [2, 5, 6].

Senescence involves massive transcriptional changes, and a large number of senescence-associated genes (SAGs) have been identified. The expression of SAGs is regulated by senescence-related transcription factors TFs such as NACs (NAM [No Apical Meristem], ATAF2 [Arabidopsis Transcription Activation Factor2] and CUC2 [Cup-shaped Cotyledon2]), MYBs, bZIPs (basic region/leucine zipper motifs) and WRKYs TFs [710]. Incubation of detached leaves in the dark is highly effective for induction of SAGs, leaf yellowing and chlorophyll loss. Therefore, it has been widely used as a model system for the study of leaf senescence [11].

Although leaf senescence occurs in an age-dependent manner, the process is also greatly affected by multiple endogenous and environmental signals coordinating the life span of leaves to optimize plant fitness. Endogenous signals such as plant hormones play vital roles in the senescence process via complex interconnecting pathways. Positive regulators include abscisic acid, ethylene, jasmonic acid, salicylic acid, brassinosteroid and strigolactone, in contrast, cytokinin, gibberellic acid and auxin suppress senescence [12, 13]. Ethylene has long been established as a key hormone regulating the timing and progression rate of leaf senescence [14, 15]. In vitro application of ethylene induces premature leaf senescence, while application of inhibitors of ethylene biosynthesis or action can delay leaf senescence symptoms [16, 17].

Transcriptional analysis has shown that the expression levels of a number of genes encoding ethylene biosynthesis, such as 1-aminocyclopropane-1-carboxylic acid synthase (ACS) and ACC oxidase (ACO), and signaling components increase in senescence leaves [16], indicating ethylene signaling is involved in the regulation of senescence leaves. This is further supported by the extended leaf longevity of ethylene-insensitive mutants that are defective in ethylene signaling transduction, such as etr1 (ethylene resistant 1), ein2 (ethylene insensitive 2) and ein3 [1820]. To date, the regulation of ethylene seems to be achieved by the EIN2-EIN3-miR164-NAC2 signalling cascade. EIN2 regulates miR164 expression, as well as its downstream target gene ORESARA1 (ORE1) ORE1/NAC2 [21]. EIN3 acts at the downstream of EIN2 to promote chlorophyll degradation by affecting chlorophyll catabolic genes [22]. Although the ethylene biosynthetic pathway and downstream key elements involved in ethylene signal transduction have been extensively studied through genetic approaches, the transcriptional network leading to leaf senescence remains largely unknown.

AT-HOOK MOTIF CONTAINING NUCLEAR LOCALIZED (AHL) proteins are transcription factors featured with two conserved structural units: a plant and prokaryote conserved (PPC) domain, involved in protein–protein interactions, and one or two DNA-binding AT-hook motif(s) [2327]. The AT-hook motif contains a conserved palindromic core sequence, Arg-Gly-Arg, capable to bind to the minor groove of AT-rich B-form chromosomal DNA, thus changing its architecture and controlling the expression of corresponding genes [25, 2830]. AHL family proteins have been proposed to regulate plant growth and development. AHL22 acts as a chromatin remodeling factor that regulates FT (FLOWERING LOCUS T) expression to promote flowering [31]. Several AHLs are involved in hormonal homeostasis and response, especially gibberellins, cytokinins and jasmonic acid [28, 32, 33]. ESC/AHL27 (ESCAROLA) and SOB3/AHL29 (SUPPRESSOR OF PHYTOCHROME B-4 #3) act redundantly to repress hypocotyl elongation in response to light [24, 34]. Overexpression of AHL27 in Arabidopsis delays senescence and increases post-harvest storage life, but the molecular mechanism is unclear [29]. Recently, it has been reported that SOB3/AHL29 repress petiole growth by antagonizing PIF-mediated transcriptional activation of genes associated with growth and hormonal pathways [35].

Although the fact that one member of the AHL clade A is involved in leaf senescence, the detailed mechanism by which AHL transcription factors regulate leaf senescence still remain largely unknown. Here, we identified AHL9 as a positive regulator of leaf senescence in Arabidopsis. The overexpression of AHL9 causes a severely early senescence phenotype. Moreover, we showed in the current study that AHL9 not only promotes dark-induced but also ethylene-induced leaf chlorosis. Our RNA-seq analysis showed that the expression of multiple SAGs is altered in AHL9 overexpressing lines. Our results provide new insights into the molecular mechanism of leaf senescence highlighting AHL9 as a prominent regulatory component in dark-induced and ethylene-induced leaf senescence.

Results

Overexpression of AHL9 results in premature leaf senescence

AHL family proteins include clade A and clade B subfamilies [24, 26]. To further explore the functions of AHL clade B subfamily, a phylogenetic tree was generated and analysed (Fig. S1). AHL9 was chosen to study its biological functions. Bioinformatics analysis demonstrates that AHL9 genome fragments contain 5 exons and 4 introns, the AHL9 protein has two AT-hook motifs and one DUF296 (plant and prokaryote conserved (PPC)/domain of unknown function #296 domain) (Fig. S2). AHL11 is the closest homolog of AHL9 in Arabidopsis genome, which exhibits 62.2% sequence identity with AHL9 based on full-length alignment (Fig. S3). Through the quantitative reverse transcription PCR (qRT-PCR) assay, various expression abundancy of AHL9 was detected. However, a higher expression in the aging tissues (the fourth and fifth rosette leaves) than in proliferative tissue (the siliques) was observed, indicating AHL9 may have the role during the senescence process (Fig. S4). To test the biological function of AHL9, 35S::AHL9 transgenic Arabidopsis lines were generated. Two independent transgenic lines (35S::AHL9-OE10 and OE11) were further analysed. Compared with WT, both transgenic lines displayed premature leaf senescence at 32 d (Fig. 1A). In addition to precocious leaf senescence, the rosette leaves of both AHL9 transgenic lines became elongated and narrow (Fig. 1A). To gain a better view of the function of AHL9 in leaf senescence, the rosette leaves of transgenic lines were compared with their corresponding WT at the same stage. As shown in Fig. 1B, when the first five leaves of AHL9-OE10 and AHL9-OE11 had already turned yellow, only the first three leaves became yellow in WT. In contrast with an apparent premature senescence of AHL9 transgenic lines, the AHL9 T-DNA insertion mutant was almost like the WT (Fig. S5). Phylogenetic analysis showed that AHL9 hold the similarity with AHL11, AHL5 and AHL12, indicating the possible functional redundancy. As AHL11 exhibited the highest similarity with AHL9, we generated the double mutants that lack of both AHL9 and AHL11. All plants (WT, ahl11, ahl9 ahl11-1 and ahl9 ahl11-2) exhibited the similar rate in leaf senescence, implying the higher-order redundancy among the proteins belonging to AHLs family. (Fig. S6).

Fig. 1.

Fig. 1

Overexpression of AHL9 causes early senescence in rosette leaves. A Leaf phenotypes of 32-d-old WT, AHL9-OE10 and AHL9-OE11 overexpressing plants. Scale bar = 1 cm. B Leaves detached from (A) and arranged according to their age. Rosette leaves were numbered from bottom to top with the first leaf being the oldest. Scale bar = 1 cm. C Representative images of the fourth and fifth rosette leaves detached from WT, AHL9-OE10 and AHL9-OE11 plants of the different ages. D Chlorophyll contents of the leaves shown in (C). *P < 0.05, **P < 0.01, Data indicate means ± SD, n = 3. Statistical analyses were performed using one-way ANOVA. Means with different letters above the bars indicate statistically significant results (P < 0.05). The experiment was conducted three times with similar results

To further analyse the development of age-related senescence in WT and AHL9 overexpressing plants, the fourth and fifth rosette leaves detached from WT and 35S::AHL9 transgenic lines were used for further analysis in the different stages. At 20 and 26 d after germination, there was no significant difference in leaf colour between transgenic lines and WT. However, at 32 d after sowing, the fourth and fifth rosette leaves of 35S::AHL9 transgenic lines became yellow, while the same stage leaves of WT were still green. The yellowing of these leaves progressed rapidly in the AHL9-OEs transgenic lines, and the majority of them become completely yellow at 38 d after germination, at this stage, WT plants only started to show signs of leaf senescence with only the tip of the leaf turning yellow (Fig. 1C). This is consistent with previous reports showing that senescence symptoms usually start from the tip and outer edge of a rosette leaf at a given age [36]. Chlorophyll quantification assays confirmed the visual phenotypic observations showing significantly lower chlorophyll content in the fourth and fifth rosette leaves in AHL9 overexpressing transgenic lines in 32 d and 38 d-old plants, compared with WT plants (Fig. 1D).

AHL9 regulates dark- and ethylene-induced leaf senescence

Incubation of detached leaves in darkness is often used as an effective method to stimulate synchronous senescence [37]. To further probe the potential roles of AHL9 in leaf senescence, we examined dark-induced leaf senescence in three-week-old WT and 35S::AHL9 transgenic plants. Rosette leaves of the same age detached from 3-week-old WT and 35S::AHL9 plants were similar in colour before dark treatment; however, after 3 days darkness, 35S::AHL9 leaves exhibited stronger leaf chlorosis than WT (Fig. 2A). The phenotypic observations were confirmed by chlorophyll assays showing a more pronounced decrease in chlorophyll levels in the AHL9-OE leaves compared to WT (Fig. 2B), suggesting that dark-induced leaf senescence is promoted by the overexpression of AHL9.

Fig. 2.

Fig. 2

AHL9 is involved in dark-induced and ethylene-induced leaf senescence. A Phenotype of detached leaves from 3-week-old WT and two independent AHL9 overexpressing lines subjected to dark treatment. Detached leaves were incubated in MES buffer for 3 d under dark conditions. Scale bar = 1 cm. B Chlorophyll content of detached leaves from (A). The data were analyzed using one-way ANOVA analysis. Means with different letters above the bars indicate statistically significant results (P < 0.05). Data indicate means ± SD, n = 3. The experiment was conducted three times with similar results. C Phenotype of detached leaves from 3-week-old WT and two independent AHL9 overexpressing lines ACC or ACC + AOA in the dark. Detached leaves were treated with MES buffer, 100 µM ACC or 100 µM ACC + 500 µM AOA for 3 d under the dark conditions. D Chlorophyll contents in leaves from (C). The data were analyzed using one-way ANOVA analysis. Means with different letters above the bars indicate statistically significant results (P < 0.05). Data indicate means ± SD, n = 3. The experiment was conducted three times with similar results

Phytohormones play critical roles in leaf senescence, therefore we queried whether the overexpression of AHL9 altered the ethylene- and ABA-induced senescence. For this purpose, we first examined the darkness-induced senescence of detached leaves upon treatment with either the ethylene precursor 1-aminocyclopropane-1-carboxylic acid or ACC plus aminooxyacetic acid (AOA), an ethylene biosynthesis inhibitor, respectively. As expected, pre-treatment with ACC increased senescence in WT and 35S::AHL9 leaves (Fig. 2C, D). In contrast, the enhanced senescence observed in 35S::AHL9 leaves was suppressed by treatment with ACC and AOA (Fig. 2C, D), suggesting that the role of AHL9 in senescence is dependent on ethylene. Unlike ethylene, ABA treatment did not significantly increase the difference of chlorophyll content between WT and AHL9 overexpression transgenic lines (Fig. S7). These results indicate the involvement of AHL9 in ethylene-induced leaf senescence.

AHL9 is a nuclear localized AT-hook protein

To establish the AHL9 subcellular localization, an AHL9-GFP fusion construct or GFP (control) were transiently expressed in Arabidopsis mesophyll protoplasts under the control of the cauliflower mosaic virus 35S promoter. The nuclear marker protein H2B-mCherry was co-expressed to visualize nuclei [38]. In the GFP controls, green fluorescence was observed throughout the protoplasts (Fig. 3). Green fluorescence in AHL9-GFP transfected protoplasts was restricted to the nuclei and overlaped with the yellow fluorescence of the nuclear marker, indicating that AHL9-GFP is located in the nucleus (Fig. 3).

Fig. 3.

Fig. 3

AHL9 is localized exclusively in the nucleus. Arabidopsis protoplasts were co-transfected with expression cassettes containing either 35S::GFP and 35S::H2B-mCherry or 35S::AHL9-GFP and 35S::H2B-mCherry. GFP signals were detected using a laser confocal scanning microscopy. H2B-mCherry was used as a nuclear marker. From left to right are green fluorescence signal, nuclear marker, chlorophyll red auto fluorescence, bright-field and merged images, respectively. Scale bars = 10 μm

Identification of differentially expressed genes in AHL9 overexpression lines

In order to investigate the possible roles of AHL9 in leaf senescence, we performed genome-wide expression profiling of AHL9-OEs and WT plants under normal growth conditions. Leaves from 30-d old WT and both AHL9-OEs transgenic lines were used for RNA-seq experiments. In total 20 million uniquely mapped reads per sample with high reproducibility among all three biological replicates were generated (Table S1). Analysis of AHL9-OE10 vs WT identified 953 genes with statistically significant differences in gene expression (log2(fold_change) > 1, q-values < 0.01), including 342 up-regulated and 611 down-regulated genes (Fig. 4A-B and Table S2). In the case of AHL9-OE11, 1451 genes showed statistically significant differences with WT, with 556 up-regulated and 895 down-regulated genes. When both datasets are put together, a common set of 665 differentially expressed genes (DEGs) were identified in AHL9-OE10 and AHL9-OE11 vs WT (Fig. 4C). Interestingly, some of the genes with altered expression belong to NAC, WRKY, IAA, and AP2 transcription factors, ACC oxidase, and the ETHYLENE RESPONSE SENSOR (Fig. 4D). Principal component analysis (PCA) and correlation analysis of all datasets indicated strong RNA-seq reliability (Fig. S8-S9). qRT-PCR analysis of 10 randomly chosen DEGs are consistent with the RNA-seq results (Fig. 4E, Table S3). Gene Ontology analysis highlighted the expression changes of genes involved in response to stimuli, hormone response, biological process and biological regulation (Fig. 5). Given that gene regulatory networks composed of interactions between TFs (transcription factors) and their targets have been implicated in controlling leaf senescence, we conducted GO enrichment analysis for these TFs. Indeed, we found most of these TFs were significantly enriched in GO terms that may associate with biological process, such as the RNA biosynthetic or metabolic process, cellular macromolecule biosynthetic process and nitrogen compound metabolic process (Fig. S10). These results provided molecular evidence supporting premature leaf senescence in AHL9 overexpression lines.

Fig. 4.

Fig. 4

RNA-seq analysis of WT, AHL9-OE10 and AHL9-OE11 transgenic lines. A-C Diagram showing differentially expressed genes (DEGs). DEGs were classified according to their expression fold-changes (FC) in the pairwise genotypic comparison between AHL9-OE10 or AHL9-OE11 and WT leaves (q-value < 0.01, |log2(fold change)|> 1). D Heatmap of senescence-associated genes (SAGs) in DEGs of AHL9-OE10, AHL9-OE11 and WT. The color bar indicates the normalized gene expression. E Expression levels of ten randomly chosen DEGs identified in the RNA-seq experiments. qRT-PCR was performed using cDNA from 30-d old leaves of AHL9-OE10, AHL9-OE11 and WT. qRT-PCR values are expressed as the mean ± SD compared to that of the internal control (UBQ10). The fold change of the qRT-PCR was determined by the efficiency method (2−ΔΔCT). Error bars indicate SD. n = 3, t-test, **P < 0.01. Assays were done in triplicate

Fig. 5.

Fig. 5

Gene ontology analysis of DEGs. Gene ontology terms of DEGs identified in the RNA-seq experiments. A-B AHL9-OE10 vs WT (A), and (B) AHL9-OE11 vs WT. CC, cellular component. MF, molecular function. BP, biological process

Discussion

In recent years, our knowledge about the molecular mechanisms triggering leaf senescence has expanded significantly. Transcriptomic analysis of leaf senescence revealed the expression changes of thousands of SAGs, however, only a small portion of them have been functionally characterized [8]. Besides, factors on the top of the regulation module regulating diverse SAGs and/or other functional genes have also been identified through either loss-of-function and/or gain-of-function studies in model plants such as Arabidopsis and rice [2, 23]. Among these regulators, transcription factors are interesting candidates as they can influence the expression of multiple genes during the senescence process.

The study of AHL family genes revealed different roles in plant growth and development, such as hypocotyl elongation, flower development, gibberellin biosynthesis and leaf longevity [25, 28, 31, 34]. Although knowledge about the functional role of AT-hook motif proteins is still very limited in plants. Notably, Ectopic ORE7/ESC delays leaf senescence, which probably up-regulate genes that suppress senescence and down-regulate genes that enable the progression of the senescence process through modification of chromatin architecture[29]. In this study, we identify and characterize an AHL protein, AHL9, involved in leaf senescence. Overexpression of AHL9 results in early senescence in Arabidopsis (Fig. 1). Transgenic plants overexpressing AHL9 also exhibited accelerated dark-induced leaf senescence (Fig. 2A). In contrast, the lack of senescence-related phenotype in the ahl9 mutant may be due to the existence of functionally redundant genes, since 4 paralogs were identified in Arabidopsis, including AHL5, AHL12, AHL9, and AHL11 [26]. The lack of phenotype in the ahl9 mutant could also be explained by functional compensation from other senescence-associated pathways, since leaf senescence is the integrated result of various pathways that incorporate numerous endogenous factors and environmental signals [8, 23]. Taken together, these results suggest that AHL9 behaves like an early senescence-activator that influences both age and dark-induced leaf senescence.

Although ethylene has been known for many decades to be a senescence-inducing plant hormone, the molecular mechanism underlying ethylene-mediated senescence remains largely unknown. Comparative transcriptome analyses have revealed a number of ethylene biosynthesis and signalling genes, with elevated transcript levels in senescing leaves, supporting the idea that sensitivity of a leaf to ethylene might account for the age-dependent leaf senescence [16, 18]. Here, we show that AHL9 is involved in the control of leaf senescence through ethylene synthesis or signalling since pre-treatment with the ethylene biosynthesis inhibitor AOA, can effectively repress the increased senescence observed in AHL9 overexpressing transgenic lines. Consistent with this data, some ethylene synthesis and signalling genes are induced in the RNA-seq data, although the genes with altered expression may not be the direct targets of AHL9 (Fig. 4D). Intriguingly, we also find some of these TFs that show DEGs are significantly enriched in GO terms that may associated with stress response such as response to abiotic stimulus, ethylene-activated signaling pathway and hormone-mediated signaling pathway. Ethylene is sensed by a five-member family of ethylene receptors on the endoplasmic reticulum [39], then this binding inactivates a Raf-like Ser/Thr kinase, CTR1 (CONSTITUTIVE TRIPLE RESPONSE1), thereby releases the C-terminal end of the positive regulator, EIN2, to the nucleus and stabilizes EIN3 and ETHYLENE INSENSITIVE3-LIKE1 (EIL1), which in turn, activate the expression of ethylene target genes to promote premature senescence in leaves [4043]. Identifying specific target genes and interaction proteins of AHL9 in vivo will be the next step required to gain a more in-depth knowledge of its role in regulating leaf senescence.

Conclusions

The current study demonstrates that one AT-hook protein, AHL9, may regulate leaf senescence via the fine-tuning of ethylene biosynthesis or signalling.

Methods

Plant materials and growth conditions

The Arabidopsis thaliana ecotype Columbia (Col-0) was used in this study [44]. The transfer DNA (T-DNA) insertional mutant ahl9 (GK_735D06) was obtained from the Nottingham Arabidopsis Stock Centre (NASC). Seeds were surface sterilized in 10% (v/v) sodium hypochlorite for 10 min, washed 3 times with sterilized water, and then grown on Murashige and Skoog medium plus 3% sucrose and 0.6% agar (pH 5.8) after 2 d vernalization in darkness at 4℃. The 7-d-old seedlings were transferred into soil and were grown at 22℃ in a 16-h-light/8-h-dark cycle for additional experiments and seed production. Yusen Zhou and Jing Chen undertook the formal identification of the plant materials (T-DNA mutants, CRISPR-Cas9 mutants and transgenic plants) used in this study.

Plasmid construction and plant transformation

AHL9 cDNAs were obtained by RT-PCR of RNA isolated from Col-0 seedlings, the full length of AHL9 CDS was amplified by PCR method using primers. According to the instructions of the invitrogen gateway kit (kit No.11789 (BP Clonase); No.117910 (LR Clonase)), the PCR products were cloned into pDNOR221 vector using the Gateway™ BP Clonase™ II Enzyme mix. Subsequently, AHL9 CDS was sub-cloned into the pDEST Gateway binary vector pGWB405 between the 35S promoter and GFP gene to produce the 35S::AHL9-GFP construct. The constructed plasmids were introduced into Agrobacterium tumefaciens strain GV3101 and transformed into plants using the floral dip method [45]. Transgenic plants in the T2 generation with T-DNA insertion at a single locus were selected by kanamycin resistance, and T3 homozygotes were used for all analyses. These primers were listed in Table S3.

Generation of ahl11 and ahl9 ahl11 CRISPR-Cas9 mutants

For AHL11 CRISPR-Cas9 mutant generation, first, the sgRNAs of AHL11 were designed using the CRISPOR online internet (http://crispor.tefor.net/), we selected two sgRNAs (T1sgRNA: GAGGAGGAGGACCAGAACCG, T2sgRNA: ACAGACGTGTCACCTGAAGG). Second, two sgRNAs were constructed into pCAMBIA1300-pYAO-cas9 vector [46]. Finally, the constructed vectors were introduced into WT and ahl9 mutants using the Agrobacterium mediated floral dip method respectively. The stable inheritance CRISPR-Cas9 mutants were confirmed through PCR and Sanger sequencing.

Dark-induced senescence assay

For the dark-induced senescence assay, the fourth and fifth rosette leaves were carefully detached from 3-week-old soil-grown Arabidopsis. Detached rosette leaves were incubated on MES buffer (0.5 × MS, 3 mM MES, pH 5.8) in complete darkness for 3 d and sampled for analyzing leaf senescence and chlorophyll content.

Hormone induced leaf senescence assay

The fourth and fifth leaf of 3-week-old plants were detached and floated on 3 mL of MES buffer (0.5 × MS, 3 mM MES, pH 5.8) supplemented with or without ABA (10 μM, 50 μM, 100 μM, and 200 μM), 1-aminocyclopropane-1-carboxylic acid (ACC, 100 μM) and 100 μM ACC plus ethylene biosynthesis inhibitor (AOA, 500 μM). The petri dishes were sealed with parafilm tape and wrapped with double-layer aluminum foil, then the petri dishes were put in a black box to avoid light. All hormone treatments were performed at 22℃ under the dark conditions. Three biological replicates were performed.

Determination of chlorophyll content

Chlorophyll was measured according to the method described by Li et al. [47]. Briefly, Arabidopsis seedlings were weighed (W), placed into Eppendorf tubes with acetone (95%, 1 mL, V) and kept overnight under dark conditions. Samples were then centrifuged at 13,000 g for 10 min and absorbance values at 665 nm and 649 nm were obtained from the supernatant. Chlorophyll content (including chlorophyll a and b) was calculated according to the following formula: chlorophyll a = 13.95A665 – 6.88A649; chlorophyll b = 24.96A645 – 7.32A665; and total chlorophyll = (chlorophyll a + chlorophyll b) × V/W. At least three independent samples were examined, all of which produced the typical results reported in this article.

Subcellular localization

The 35S::AHL9-GFP and 35S::GFP plasmids were transformed into Arabidopsis mesophyll protoplasts as described previously [48]. Transformed protoplasts were observed using a fluorescence microscope (Ziess confocal LSM710). H2B-mCherry were used as controls for nuclear localization [38].

qRT-PCR analysis

Total RNA was isolated from the seedlings with Trizol reagent and DNA was digested by RNase-free DNase I. Two µg of total RNA was used for reverse transcription with M-MLV reverse transcriptase according to the supplier’s instructions (Promega). qRT-PCR analyses were performed with Roche Light Cycler 480 real-time PCR system using the SYBR Green Master Mix (Vazyme Biotech Co., Ltd.) and specific primers for PCR amplification. UBQ10 was used as an internal control for data normalization. These primers were listed in Table S3.

RNA-seq analysis

The sixth, seventh and eighth rosette leaves were individually collected from 30-d-old WT, AHL9-OE10 and AHL9-OE11, pooled, and frozen in liquid nitrogen. The samples were stored at − 80℃ prior to RNA extraction. The RNA-seq analysis was performed at the Berry Genomics Corporation (Beijing) with three biological replicates. Briefly, The cDNA library were constructed and sequenced on HiSeq 2000 sequencing system. The clean data was produced by discarding the paired reads that one read’s number of N base is more than 5 or has more than 30% bases with a low quality value below 15. The clean reads were aligned to the reference genome of Vigna angularis using Hisat2 [49]. Then samtools and HTSeq-count were used to count the reads number of each gene and gene’s expression level was normallized as Fragments Per Kilobase Million (FPKM) [50]. DESeq2 was used to analyze differential gene expression, based on the negative binomial distribution, of the replicate samples between the treatment group and control group [51]. A threshold value of p-adjusted value (qvalue) < 0.01 (|log2foldchange|> 1) was used to obtain differentially expressed genes (DEGs). The gene ontology (GO) enrichment, with p-adjusted value cut-off 0.05, were performed using custom R scripts based on Bioconductor packages goseq and GO.db in order to classify DEGs into terms.

Phylogenetic tree

Phylogenetic tree was generated using MEGA-X software. The AHL clade B family from Arabidopsis thaliana, some orthologs of rice and maize protein sequences were downloaded from NCBI.

Statistical analysis

All experiments were repeated with at least three times. The presented data were expressed as the means ± SD. Statistical analyses were performed using one-way ANOVA or Student’s t-test.

Accession numbers

The Arabidopsis Genome Initiative identifiers for the genes described in this article are as follows: AHL9 (At2g45850), AHL11 (At3g61310), LOX1 (AT1G55020), IAA1 (AT4G14560), UBQ10 (AT4G05320), ACO2 (AT1G62380), NAC079 (AT5G07680), anac048 (AT3G04420), ERF039 (AT4G16750), PCAP2 (AT5G44610), SAUR72 (AT3G12830), LTP4 (AT5G59310), UGT85A1 (AT1G22400), PAO4 (AT1G65840), WRKY63 (AT1G66600), EBF2 (AT5G25350), NAC003 (AT1G02220), NAC100 (AT5G61430), AP2 (AT4G36920), ERS1 (AT2G40940), AHL2 (AT4G22770), SAUR41 (AT1G16510), IAA7 (AT3G23050), IAA29 (AT4G32280), IAA14 (AT4G14550), IPT3 (AT3G63110).

Supplementary information

12870_2022_3622_MOESM1_ESM.pptx (124.4MB, pptx)

Additional file 1 Fig. S1 Phylogenic analysis of AHLs clade B family proteins in Arabidopsis thanalia and orthologs in Oryza sativa L. and Zea mays L.. The protein sequences were downloaded from NCBI database (https://www.ncbi.nlm.nih.gov/). And then the phylogenetic tree was generated using MEGA-X software. The numbers of the branches are the bootstrap values from 1,000 replicates. Fig. S2 Schematic diagrams of AHL9 genomic and protein structure. A Genomic structures of AHL9. Arrows represent start codon. Black boxes represent exons. Crease lines represent introns. White boxes represent 5’ and 3’ untranslation regions. Scale bar, 100 bp. B Protein structures of AHL9. Red boxes represent AT-hook motif. Gray boxes represent DUF296 domain. Fig. S3 Protein sequences alignment of AHL9 and AHL11. The AHL9 and AHL11 sequences were downloaded from NCBI database (https://www.ncbi.nlm.nih.gov/). The fasta format was generated using CLUSTALW software, and then the alignment was produced with GENEDOC software. Fig. S4 qRT-PCR analysis of AHL9 transcript levels in roots, leaves, stems, inflorescences, and siliques in six-week-old plants. The roots, leaves, stems, inflorescences, and siliques were sampled from three individual plants at different development stages, respectively. The fourth and fifth rosettes were used to determine the gene expression in the leaves. Actin was used for normalization purposes. Data indicate mean ± SD (n = 3). Three biological repeats were performed. Fig. S5 Phenotypic observation of  WT and ahl9 plants. A Schematic structure of AHL9 and the positions of the T-DNA  insertion in ahl9. Black boxes indicate exons, lines indicate introns, empty boxes indicate upstream and downstream regions of AHL9. Triangles represent  the T-DNA insertion. B Amplification of AHL9 in genomic DNA from the WT and ahl9. LP and RP primers were used for AHL9 genomic sequence amplification. LB and RP primers were used for specific amplification of the T-DNA  insertion. C qRT-PCR detection of AHL9 transcript in 28-d-old WT and ahl9. UBQ10 was as an internal control. Three biological repeats were done. **P ˂ 0.01, Student's t-test. D-E Phenotypic observation of 28-d (D) and 36-d (E) old WT and ahl9 plants. Scale bars, 1 cm. Fig. S6 Generation and phenotypic analysis of ahl11 and ahl9 ahl11 double mutants. A Schematic genomic structure of AHL11 and the sgRNA target sites. Black boxes indicate exons, lines indicate introns, empty boxes indicate 5’UTR and 3’UTR of AHL11. UTR, untranslated region. B Sanger sequencing of the ahl11, ahl9 ahl11-1 and ahl9 ahl11-2 mutants in WT and ahl9 backgrounds. C Amino acids of AHL11, ahl11, ahl11-1, and ahl11-2. D Phenotypic analysis of WT, ahl9, ahl11, ahl9ahl11-1 and ahl9ahl11-2 plants grown for 15-d, 21-d, 28-d and 34-d. Scale bars = 2 cm. Fig. S7 The senescence phenotypes of detached leaves from AHL9 overexpressing plants treated with ABA. Detached leaves were treated with MES buffer (Mock), 10 μM, 50 μ M or 100 μM and 200 μM ABA for 3 d under dark conditions. Fig. S8 PCA analysis of RNA-seq of AHL9-OE10 vs WT, AHL9-OE11 vs WT. PCA results for the transcript-level (FPKM) dataset of all samples. The sample with same color means samples from the same group. Fig. S9 Correlation analysis of the samples from the same group. R2 represents correlation coefficient. Fig. S10 Gene ontology analysis of different expression transcription factors.

12870_2022_3622_MOESM2_ESM.xlsx (16.5KB, xlsx)

Additional file 2 Table S1 RNA-seq maped reads of WT, AHL9-OE10, and AHL9-OE11 leaf samples.

12870_2022_3622_MOESM3_ESM.xlsx (268.4KB, xlsx)

Additional file 3 Table S2 Differentially expressed genes of WT, AHL9-OE10, and AHL9-OE11.

12870_2022_3622_MOESM4_ESM.docx (19.2KB, docx)

Additional file 4 Table S3 Primers used in this study.

Acknowledgements

We appreciate members of Prof. Chun-Peng Song’s group in Henan University for participating in helpful discussions. No conflicts of interest declared.

Abbreviations

AHL

At-Hook motif containing nuclear Localized

SAG

Senescence-Associated Gene

CUC

Cup-shaped Cotyledon

NAC

Nam, Ataf2 and Cuc2

ACC

1-Aminocyclopropane-1-Carboxylic acid

ACS

ACC synthase

ACO

ACC oxidase

AOA

ACC plus aminooxyacetic acid

ETR1

Ethylene Resistant 1

EIN2

Ethylene Insensitive 2

PPC

Plant and Prokaryote Conserved

DUF296

Domain of Unknown Function #296 domain

DEGs

Differentially Expressed Genes

PCA

Principal Component Analysis

TF

Transcription Factor

EIL1

Ethylene Insensitive3-Like1

GO

The Gene Ontology

Authors’ contributions

S.G. designed the study. Y.Z. and J.C. undertook the formal identification of the plant material (T-DNA mutants, CRISPR-Cas9 mutants and transgenic plants) used in this study. Y.Z., J.C., X.G., H.W., and J.Z. performed the experiments. W.Z., Z.H., and Xue.Z. carried out the re-annotation and comparative analyses. Xiao.Z., J.R.B., T.I., and S.G. analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by grants from the Natural Science Foundation of China (31671517 and 31970808), and the Program for Innovative Research Team (in Science and Technology) in University of Henan Province (21IRTSTHN019) to S.G., the 111 Project#D16014 to J.R.B., and a JSPS KAKENHI Grant-in-Aid for Scientific Research A (20H00470), and a Grant-in-Aid for challenging Exploratory Research (No. 21K19266) to T.I.. The funding bodies had no role in the design of the study, data analysis, interpretation and writing the manuscript.

Availability of data and materials

The RNA-seq data have been deposited into sequence read archive (SRA) database under the Bioproject PRJNA780875. The BioProject's metadata is available at https://dataview.ncbi.nlm.nih.gov/object/PRJNA780875?reviewer=sjfjtgdgtd4alusr7nf9l5has3 in read-only format. All relevant data and plant materials are available from the corresponding authors upon request.

Declarations

Ethics approval and consent to participate

All methods were performed in accordance with the relevant guidelines and regulations.

Consent for publication

Not applicable.

Competing interests

The authors declare that there are no conflicts of interest.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yusen Zhou, Xiaomin Zhang and Jing Chen are contributed equally to this work.

Contributor Information

Toshiro Ito, Email: itot@bs.naist.jp.

Siyi Guo, Email: guosiyi@henu.edu.cn.

References

  • 1.Hörtensteiner S. Chlorophyll degradation during senescence. Annu Rev Plant Biol. 2006;57:55–77. doi: 10.1146/annurev.arplant.57.032905.105212. [DOI] [PubMed] [Google Scholar]
  • 2.Woo HR, Kim HJ, Nam HG, Lim PO. Plant leaf senescence and death - regulation by multiple layers of control and implications for aging in general. J Cell Sci. 2013;126(Pt 21):4823–4833. doi: 10.1242/jcs.109116. [DOI] [PubMed] [Google Scholar]
  • 3.Lim PO, Kim HJ, Nam HG. Leaf senescence. Annu Rev Plant Biol. 2007;58:115–136. doi: 10.1146/annurev.arplant.57.032905.105316. [DOI] [PubMed] [Google Scholar]
  • 4.Gan S, Amasino RM. Making sense of senescence (molecular genetic regulation and manipulation of leaf senescence) Plant Physiol. 1997;113(2):313–319. doi: 10.1104/pp.113.2.313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang H, Zhou C. Signal transduction in leaf senescence. Plant Mol Biol. 2013;82(6):539–545. doi: 10.1007/s11103-012-9980-4. [DOI] [PubMed] [Google Scholar]
  • 6.Yolcu S, Li X, Li S, Kim YJ. Beyond the genetic code in leaf senescence. J Exp Bot. 2018;69(4):801–810. doi: 10.1093/jxb/erx401. [DOI] [PubMed] [Google Scholar]
  • 7.Liu X, Li Z, Jiang Z, Zhao Y, Peng J, Jin J, Guo H, Luo J. LSD: a leaf senescence database. Nucleic Acids Res. 2011;39(Database issue):D1103–1107. [DOI] [PMC free article] [PubMed]
  • 8.Li Z, Peng J, Wen X, Guo H. Gene network analysis and functional studies of senescence-associated genes reveal novel regulators of Arabidopsis leaf senescence. J Integr Plant Biol. 2012;54(8):526–539. doi: 10.1111/j.1744-7909.2012.01136.x. [DOI] [PubMed] [Google Scholar]
  • 9.Yang SD, Seo PJ, Yoon HK, Park CM. The Arabidopsis NAC transcription factor VNI2 integrates abscisic acid signals into leaf senescence via the COR/RD genes. Plant Cell. 2011;23(6):2155–2168. doi: 10.1105/tpc.111.084913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Vainonen JP, Jaspers P, Wrzaczek M, Lamminmaki A, Reddy RA, Vaahtera L, Brosche M, Kangasjarvi J. RCD1-DREB2A interaction in leaf senescence and stress responses in Arabidopsis thaliana. Biochem J. 2012;442(3):573–581. doi: 10.1042/BJ20111739. [DOI] [PubMed] [Google Scholar]
  • 11.Liebsch D, Keech O: Dark-induced leaf senescence. new insights into a complex light-dependent regulatory pathway. New Phytol. 2016;212(3):563–570. [DOI] [PubMed]
  • 12.Schippers JH, Schmidt R, Wagstaff C, Jing HC. Living to die and dying to live: The survival strategy behind leaf senescence. Plant Physiol. 2015;169(2):914–930. doi: 10.1104/pp.15.00498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ueda H, Kusaba M. Strigolactone regulates leaf Senescence in concert with ethylene in Arabidopsis. Plant Physiol. 2015;169(1):138–147. doi: 10.1104/pp.15.00325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kim J, Park SJ, Lee IH, Chu H, Penfold CA, Kim JH, Buchanan-Wollaston V, Nam HG, Woo HR, Lim PO. Comparative transcriptome analysis in Arabidopsis ein2/ore3 and ahk3/ore12 mutants during dark-induced leaf senescence. J Exp Bot. 2018;69(12):3023–3036. doi: 10.1093/jxb/ery137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bleecker AB, Estelle MA, Somerville C, Kende H. Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana. Science. 1988;241(4869):1086–1089. doi: 10.1126/science.241.4869.1086. [DOI] [PubMed] [Google Scholar]
  • 16.van der Graaff E, Schwacke R, Schneider A, Desimone M, Flugge UI, Kunze R. Transcription analysis of arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence. Plant Physiol. 2006;141(2):776–792. doi: 10.1104/pp.106.079293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wang NN, Yang SF, Charng Y. Differential expression of 1-aminocyclopropane-1-carboxylate synthase genes during orchid flower senescence induced by the protein phosphatase inhibitor okadaic acid. Plant Physiol. 2001;126(1):253–260. doi: 10.1104/pp.126.1.253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Li Z, Peng J, Wen X, Guo H. Ethylene-insensitive3 is a senescence-associated gene that accelerates age-dependent leaf senescence by directly repressing miR164 transcription in Arabidopsis. Plant Cell. 2013;25(9):3311–3328. doi: 10.1105/tpc.113.113340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Oh SA, Park JH, Lee GI, Paek KH, Park SK, Nam HG. Identification of three genetic loci controlling leaf senescence in Arabidopsis thaliana. Plant J. 1997;12(3):527–535. doi: 10.1111/j.0960-7412.1997.00527.x. [DOI] [PubMed] [Google Scholar]
  • 20.Grbić V, Bleecker AB. Ethylene regulates the timing of leaf senescence in Arabidopsis. Plant J. 1995;8(4):595–602. doi: 10.1046/j.1365-313X.1995.8040595.x. [DOI] [Google Scholar]
  • 21.Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HG. Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science. 2009;323(5917):1053–1057. doi: 10.1126/science.1166386. [DOI] [PubMed] [Google Scholar]
  • 22.Qiu K, Li Z, Yang Z, Chen J, Wu S, Zhu X, Gao S, Gao J, Ren G, Kuai B, et al. EIN3 and ORE1 accelerate degreening during ethylene-mediated leaf senescence by directly activating chlorophyll catabolic genes in Arabidopsis. PLoS Genet. 2015;11(7):e1005399. doi: 10.1371/journal.pgen.1005399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Woo HR, Kim HJ, Lim PO, Nam HG. Leaf senescence: systems and dynamics aspects. Annu Rev Plant Biol. 2019;70:347–376. doi: 10.1146/annurev-arplant-050718-095859. [DOI] [PubMed] [Google Scholar]
  • 24.Zhao J, Favero DS, Peng H, Neff MM. Arabidopsis thaliana AHL family modulates hypocotyl growth redundantly by interacting with each other via the PPC/DUF296 domain. P Natl Acad Sci USA. 2013;110(48):E4688–4697. doi: 10.1073/pnas.1219277110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Xiao C, Chen F, Yu X, Lin C, Fu YF. Over-expression of an AT-hook gene, AHL22, delays flowering and inhibits the elongation of the hypocotyl in Arabidopsis thaliana. Plant Mol Biol. 2009;71(1–2):39–50. doi: 10.1007/s11103-009-9507-9. [DOI] [PubMed] [Google Scholar]
  • 26.Zhao J, Favero DS, Qiu J, Roalson EH, Neff MM. Insights into the evolution and diversification of the AT-hook Motif Nuclear Localized gene family in land plants. BMC Plant Biol. 2014;14:266. doi: 10.1186/s12870-014-0266-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Fujimoto S, Matsunaga S, Yonemura M, Uchiyama S, Azuma T, Fukui K. Identification of a novel plant MAR DNA binding protein localized on chromosomal surfaces. Plant Mol Biol. 2004;56(2):225–239. doi: 10.1007/s11103-004-3249-5. [DOI] [PubMed] [Google Scholar]
  • 28.Matsushita A, Furumoto T, Ishida S, Takahashi Y. AGF1, an AT-hook protein, is necessary for the negative feedback of AtGA3ox1 encoding GA 3-oxidase. Plant Physiol. 2007;143(3):1152–1162. doi: 10.1104/pp.106.093542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lim PO, Kim Y, Breeze E, Koo JC, Woo HR, Ryu JS, Park DH, Beynon J, Tabrett A, Buchanan-Wollaston V, et al. Overexpression of a chromatin architecture-controlling AT-hook protein extends leaf longevity and increases the post-harvest storage life of plants. Plant J. 2007;52(6):1140–1153. doi: 10.1111/j.1365-313X.2007.03317.x. [DOI] [PubMed] [Google Scholar]
  • 30.Lu H, Zou Y, Feng N. Overexpression of AHL20 negatively regulates defenses in Arabidopsis. J Integr Plant Biol. 2010;52(9):801–808. doi: 10.1111/j.1744-7909.2010.00969.x. [DOI] [PubMed] [Google Scholar]
  • 31.Yun J, Kim YS, Jung JH, Seo PJ, Park CM. The AT-hook motif-containing protein AHL22 regulates flowering initiation by modifying flowering locus t chromatin in Arabidopsis. J Biol Chem. 2012;287(19):15307–15316. doi: 10.1074/jbc.M111.318477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Vom Endt D, Soares e Silva M, Kijne JW, Pasquali G, Memelink J. Identification of a bipartite jasmonate-responsive promoter element in the Catharanthus roseus ORCA3 transcription factor gene that interacts specifically with AT-Hook DNA-binding proteins. Plant Physiol. 2007;144(3):1680–1689. [DOI] [PMC free article] [PubMed]
  • 33.Rashotte AM, Carson SD, To JP, Kieber JJ. Expression profiling of cytokinin action in Arabidopsis. Plant Physiol. 2003;132(4):1998–2011. doi: 10.1104/pp.103.021436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Street IH, Shah PK, Smith AM, Avery N, Neff MM. The AT-hook-containing proteins SOB3/AHL29 and ESC/AHL27 are negative modulators of hypocotyl growth in Arabidopsis. Plant J. 2008;54(1):1–14. doi: 10.1111/j.1365-313X.2007.03393.x. [DOI] [PubMed] [Google Scholar]
  • 35.Favero DS, Kawamura A, Shibata M, Takebayashi A, Jung JH, Suzuki T, Jaeger KE, Ishida T, Iwase A, Wigge PA, et al. AT-Hook transcription factors restrict petiole growth by antagonizing PIFs. Curr Biol. 2020;30(8):1454–1466 e1456. [DOI] [PubMed]
  • 36.Guo Y, Gan S. AtNAP, a NAC family transcription factor, has an important role in leaf senescence. Plant J. 2006;46(4):601–612. doi: 10.1111/j.1365-313X.2006.02723.x. [DOI] [PubMed] [Google Scholar]
  • 37.Kim HJ, Ryu H, Hong SH, Woo HR, Lim PO, Lee IC, Sheen J, Nam HG, Hwang I. Cytokinin-mediated control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis. P Natl Acad Sci USA. 2006;103(3):814–819. doi: 10.1073/pnas.0505150103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Guo S, Dai S, Singh PK, Wang H, Wang Y, Tan JLH, Wee W, Ito T. A membrane-bound NAC-like transcription factor OsNTL5 Represses the Flowering in Oryza sativa. Front Plant Sci. 2018;9:555. doi: 10.3389/fpls.2018.00555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ju C, Chang C. Advances in ethylene signalling: protein complexes at the endoplasmic reticulum membrane. AoB Plants. 2012;2012:pls031. [DOI] [PMC free article] [PubMed]
  • 40.Ju C, Yoon GM, Shemansky JM, Lin DY, Ying ZI, Chang J, Garrett WM, Kessenbrock M, Groth G, Tucker ML, et al. CTR1 phosphorylates the central regulator EIN2 to control ethylene hormone signaling from the ER membrane to the nucleus in Arabidopsis. P Natl Acad Sci USA. 2012;109(47):19486–19491. doi: 10.1073/pnas.1214848109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Qiao H, Shen Z, Huang SS, Schmitz RJ, Urich MA, Briggs SP, Ecker JR. Processing and subcellular trafficking of ER-tethered EIN2 control response to ethylene gas. Science. 2012;338(6105):390–393. doi: 10.1126/science.1225974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Wen X, Zhang C, Ji Y, Zhao Q, He W, An F, Jiang L, Guo H. Activation of ethylene signaling is mediated by nuclear translocation of the cleaved EIN2 carboxyl terminus. Cell Res. 2012;22(11):1613–1616. doi: 10.1038/cr.2012.145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Xu A, Zhang W, Wen CK. Enhancing ctr1-10 ethylene response2 is a novel allele involved in constitutive triple-response1-mediated ethylene receptor signaling in Arabidopsis. BMC Plant Biol. 2014;14:48. doi: 10.1186/1471-2229-14-48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Liu H, Guo S, Lu M, Zhang Y, Li J, Wang W, Wang P, Zhang J, Hu Z, Li L, et al. Biosynthesis of DHGA12 and its roles in Arabidopsis seedling establishment. Nat Commun. 2019;10(1):1768. doi: 10.1038/s41467-019-09467-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zhang X, Henriques R, Lin SS, Niu QW, Chua NH. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat Protoc. 2006;1(2):641–646. doi: 10.1038/nprot.2006.97. [DOI] [PubMed] [Google Scholar]
  • 46.Yan L, Wei S, Wu Y, Hu R, Li H, Yang W, Xie Q. High efficiency genome editing in Arabidopsis using Yao promoter-driven crispr/Cas9 system. Mol Plant. 2015;8(12):1820–1823. doi: 10.1016/j.molp.2015.10.004. [DOI] [PubMed] [Google Scholar]
  • 47.Li J, Liu J, Wang G, Cha JY, Li G, Chen S, Li Z, Guo J, Zhang C, Yang Y, et al. A chaperone function of no catalase activity1 is required to maintain catalase activity and for multiple stress responses in Arabidopsis. Plant Cell. 2015;27(3):908–925. doi: 10.1105/tpc.114.135095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Yoo SD, Cho YH, Sheen J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2007;2(7):1565–1572. doi: 10.1038/nprot.2007.199. [DOI] [PubMed] [Google Scholar]
  • 49.Kim D, Langmead B, Salzberg SL. hisat: a fast spliced aligner with low memory requirements. Nat Methods. 2015;12(4):357–360. doi: 10.1038/nmeth.3317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods. 2008;5(7):621–628. doi: 10.1038/nmeth.1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12870_2022_3622_MOESM1_ESM.pptx (124.4MB, pptx)

Additional file 1 Fig. S1 Phylogenic analysis of AHLs clade B family proteins in Arabidopsis thanalia and orthologs in Oryza sativa L. and Zea mays L.. The protein sequences were downloaded from NCBI database (https://www.ncbi.nlm.nih.gov/). And then the phylogenetic tree was generated using MEGA-X software. The numbers of the branches are the bootstrap values from 1,000 replicates. Fig. S2 Schematic diagrams of AHL9 genomic and protein structure. A Genomic structures of AHL9. Arrows represent start codon. Black boxes represent exons. Crease lines represent introns. White boxes represent 5’ and 3’ untranslation regions. Scale bar, 100 bp. B Protein structures of AHL9. Red boxes represent AT-hook motif. Gray boxes represent DUF296 domain. Fig. S3 Protein sequences alignment of AHL9 and AHL11. The AHL9 and AHL11 sequences were downloaded from NCBI database (https://www.ncbi.nlm.nih.gov/). The fasta format was generated using CLUSTALW software, and then the alignment was produced with GENEDOC software. Fig. S4 qRT-PCR analysis of AHL9 transcript levels in roots, leaves, stems, inflorescences, and siliques in six-week-old plants. The roots, leaves, stems, inflorescences, and siliques were sampled from three individual plants at different development stages, respectively. The fourth and fifth rosettes were used to determine the gene expression in the leaves. Actin was used for normalization purposes. Data indicate mean ± SD (n = 3). Three biological repeats were performed. Fig. S5 Phenotypic observation of  WT and ahl9 plants. A Schematic structure of AHL9 and the positions of the T-DNA  insertion in ahl9. Black boxes indicate exons, lines indicate introns, empty boxes indicate upstream and downstream regions of AHL9. Triangles represent  the T-DNA insertion. B Amplification of AHL9 in genomic DNA from the WT and ahl9. LP and RP primers were used for AHL9 genomic sequence amplification. LB and RP primers were used for specific amplification of the T-DNA  insertion. C qRT-PCR detection of AHL9 transcript in 28-d-old WT and ahl9. UBQ10 was as an internal control. Three biological repeats were done. **P ˂ 0.01, Student's t-test. D-E Phenotypic observation of 28-d (D) and 36-d (E) old WT and ahl9 plants. Scale bars, 1 cm. Fig. S6 Generation and phenotypic analysis of ahl11 and ahl9 ahl11 double mutants. A Schematic genomic structure of AHL11 and the sgRNA target sites. Black boxes indicate exons, lines indicate introns, empty boxes indicate 5’UTR and 3’UTR of AHL11. UTR, untranslated region. B Sanger sequencing of the ahl11, ahl9 ahl11-1 and ahl9 ahl11-2 mutants in WT and ahl9 backgrounds. C Amino acids of AHL11, ahl11, ahl11-1, and ahl11-2. D Phenotypic analysis of WT, ahl9, ahl11, ahl9ahl11-1 and ahl9ahl11-2 plants grown for 15-d, 21-d, 28-d and 34-d. Scale bars = 2 cm. Fig. S7 The senescence phenotypes of detached leaves from AHL9 overexpressing plants treated with ABA. Detached leaves were treated with MES buffer (Mock), 10 μM, 50 μ M or 100 μM and 200 μM ABA for 3 d under dark conditions. Fig. S8 PCA analysis of RNA-seq of AHL9-OE10 vs WT, AHL9-OE11 vs WT. PCA results for the transcript-level (FPKM) dataset of all samples. The sample with same color means samples from the same group. Fig. S9 Correlation analysis of the samples from the same group. R2 represents correlation coefficient. Fig. S10 Gene ontology analysis of different expression transcription factors.

12870_2022_3622_MOESM2_ESM.xlsx (16.5KB, xlsx)

Additional file 2 Table S1 RNA-seq maped reads of WT, AHL9-OE10, and AHL9-OE11 leaf samples.

12870_2022_3622_MOESM3_ESM.xlsx (268.4KB, xlsx)

Additional file 3 Table S2 Differentially expressed genes of WT, AHL9-OE10, and AHL9-OE11.

12870_2022_3622_MOESM4_ESM.docx (19.2KB, docx)

Additional file 4 Table S3 Primers used in this study.

Data Availability Statement

The RNA-seq data have been deposited into sequence read archive (SRA) database under the Bioproject PRJNA780875. The BioProject's metadata is available at https://dataview.ncbi.nlm.nih.gov/object/PRJNA780875?reviewer=sjfjtgdgtd4alusr7nf9l5has3 in read-only format. All relevant data and plant materials are available from the corresponding authors upon request.


Articles from BMC Plant Biology are provided here courtesy of BMC

RESOURCES