Abstract
Background
Probiotics have a beneficial effect on inflammatory responses and immune regulation, via Janus kinase/signal transduction and activator of transcription (JAK/STAT) and NF‐κB signaling pathways. To evaluate the precise effects of Lactobacillus spp. as a protective and therapeutic agent, we aimed to investigate the efficacy of Lactobacillus spp. in modulating JAK/STAT and nuclear factor kappa B (NF‐κB) inflammatory signaling pathways.
Methods
A quantitative real‐time polymerase chain reaction (qPCR) assay was used to analyze the expression of JAK/STAT and inflammatory genes (TIR‑associated Protein [TIRAP], Interleukin 1 Receptor Associated Kinase[IRAK4], Nuclear factor‐kappa B Essential Modulator [NEMO], and receptor interacting protein [RIP]) followed by treatment of the HT‐29 cell line with sonicated pathogens before, after, and simultaneously with Lactobacillus spp. A cytokine assay was also used to evaluate interleukin (IL)‐6 and IL‐1β production after treatment with Lactobacillus spp.
Results
Lactobacillus spp. downregulated JAK and TIRAP, IRAK4, NEMO, and RIP genes in the NF‐κB pathway compared to sonicate‐treated cells. The expression of STAT genes was different after treatment with probiotics. The production of IL‐6 and IL‐1β decreased after probiotic treatment.
Conclusions
Our Lactobacillus spp. cocktail showed anti‐inflammatory effects on HT‐29 cells by modulating JAK/STAT and NF‐κB signaling pathways in all three treatment variants. Therefore, Lactobacillus spp. as a dietary supplement can both prevent and reduce inflammation‐related diseases such as inflammatory bowel disease.
Keywords: IBD, JAK/STAT, Lactobacillus spp., NF‐κB

1. INTRODUCTION
Probiotics play several important roles in improving health. Modulating the gut microbiota, regulating the immune system, showing anti‐inflammatory effects, and having activities against pathogens by regulating mucus secretion are some of the important functions of probiotics. 1 , 2 Lactic acid bacteria, including Lactobacillus spp., are the most important and well‐known probiotics. Lactobacillus plantarum was first isolated from saliva. Later, it was demonstrated that L. plantarum produces hydrogen peroxide and therefore has remarkable antimicrobial activity. 3 , 4 Lactobacillus. rhamnosus has significant beneficial effects, such as a positive role in obesity and activities against resistant bacteria (vancomycin‐resistant enterococci). Lactobacillus. reuteri naturally colonizes the digestive tract, especially after consumption of dairy products. It is one of the Lactobacillus strains that can be transmitted to infants via breast milk. 3 , 5 The antimicrobial activity through the production of reuterin, an antibiotic‐like agent, is absolutely remarkable in this strain. 3 Lactobacillus brevis is another Lactobacillus strain with remarkable effects on intestinal homeostasis and inhibitory effects on intestinal inflammation. 6
As mentioned earlier, modulation of the immune system and anti‐inflammatory effects are among the beneficial effects of probiotics. These processes are critical for the management and control of inflammatory diseases, including inflammatory bowel disease (IBD). Both Th‐1 and Th‐2 activities have been observed in Crohn's disease (CD) and ulcerative colitis (UC), the two subtypes of IBD. Therefore, in IBD, there is often an overproduction of inflammatory cytokines leading to inflammation. 7 IBD is considered a chronic relapsing and remission disease. The use of agents with anti‐inflammatory activity to relieve the symptoms that occur in the relapsing phase could be helpful in controlling IBD. In addition, the use of a long‐lasting therapeutic agent that could influence the duration of the remission phase is also crucial. 8 Probiotics not only have an anti‐inflammatory effect but often continue to act for up to 3 weeks after the end of treatment and therefore appear to be a suitable means of prolonging the duration of remission and controlling symptoms in patients with IBD. 9
Several signaling pathways, such as Janus kinase/signal transducer and activator of transcription (JAK/STAT) and nuclear factor kappa‐light‐chain‐enhancer of activated B cells NF‐κB, are involved in the production and function of cytokines and therefore play roles in the inhibition or progression of IBD. 10 Probiotics, as anti‐inflammatory agents, could have beneficial effects on modulating these signaling pathways and thus improve the inflammatory status in patients with IBD. Although our previous studies have shown phenotypic anti‐inflammatory effects of probiotics, 11 evaluation of the exact molecular mechanisms of probiotics could elucidate the ameliorative process more precisely. On the other hand, it would be important to find out whether probiotics could have beneficial effects in both phases of IBD, that is, relapse and remission. In other words, if probiotics have positive modulatory effects on both phases, it could be said that these live agents could be consumed as preservatives and also as complementary treatments. Here, we aimed to investigate the efficacy of Lactobacillus spp. in modulating JAK/STAT and NF‐κB signaling pathways to understand how probiotics might play an effective role in reducing inflammation before, during, and after the presence of an inflammatory state.
2. MATERIALS AND METHODS
2.1. Preparation of bacterial strain
In the current study, the in vitro assay was conducted to evaluate the effects of probiotics on the NF‐κB and JAK/STAT signaling pathways. Four Lactobacillus spp. including L. plantarum, L. rhamnosus, L. brevis, and L. reuteri were isolated from the natural gut microbiota of fecal samples from 53 healthy volunteers aged 1−36 years, and the probiotic and phenotypic characteristics of these strains were previously investigated. 11 Bacteria were inoculated into De Man, Rogosa and Sharpe agar (MRS) broth with 0.05% l‐cysteine and incubated at 37°C for 20 h. After centrifugation at 8000 rpm for 5 min, the pellets were diluted with the antibiotic‐free MRS medium containing 10% fetal bovine serum (FBS), and the optical density (OD) was adjusted to 0.08 (0.5 McFarland). To make the probiotic cocktail, an equal amount of Lactobacillus spp. was mixed and the final concentration was adjusted to 0.08 OD using a spectrophotometer at 600 nm. For treatments, the culture pellet was collected and diluted in RPMI‐1640 with 10% FBS without antibiotics to obtain the final OD concentration of 0.08 at 600 nm.
For induction of inflammation sonicated pathogen (SP) was used. For preparation, Enterotoxin‐producing Escherichia coli (ETEC) and Salmonella typhimurium (ST) were cultured in Luria−Bertani (LB) broth (Thermo Fisher Scientific). After that, heat‐killed cultures (100°C for 10 min) were sonicated (10 rounds, 1 min/round), and cell debris was centrifuged (1700g, 15 min, 4°C). All methods were performed according to the relevant guidelines and regulations, and ethical approval for the previous study was obtained from the Pasteur Institute of Iran Committee (IR.PII. REC.1398.060). Signed informed consent was obtained from all participants.
3. PROBIOTIC TREATMENT OF HT‐29 CELL LINE
3.1. Cell culture procedure
The human colon adenocarcinoma cell line HT‐29 was purchased from the Cell Bank of the Pasteur Institute of Iran. For HT‐29 cell line, RPMI‐1640 (Thermo‐Gibco) supplemented with 10% fetal bovine serum (Biochrom) and 1% penicillin−streptomycin (Sigma‐Aldrich) was used. Cells were then separated with 0.25% trypsin‐EDTA (Gibco), washed twice with PBS, and counted. The cell suspension was centrifuged and the precipitate was diluted with RPMI‐1640 and 2 × 105 cells per well were seeded.
3.2. SP and Lactobacillus spp. treatments
HT‐29 cells were exposed to Lactobacillus spp. (all four species in a cocktail form) and SP. The components are as follows: sonicated enterotoxigenic E. coli (SP‐ETEC), sonicated Salmonella typhi (SP‐ST), and Lactobacillus spp. To study the effect of probiotics before, during, and after the inflammatory state, Lactobacillus spp. were added as follows: (a) first, Lactobacillus spp. was added to the HT‐29 cell line and, after 6 h, SP‐ETEC and SP‐ST were added to cause inflammation (LP). This treatment was used to observe the effect of Lactobacillus spp. before the inflammatory condition was triggered. (b) First, SP‐ETEC and SP‐ST were added to the HT‐29 cell line and, after 6 h, Lactobacillus spp. was added to determine the supposed effects (PL). This treatment was used to see the effect of Lactobacillus spp. after triggering the inflammation. (c) Lactobacillus spp. and SP (SP‐ETEC and SP‐ST) were simultaneously added to the HT‐29 cell line (P + L). This treatment was used to show the effect of Lactobacillus spp. while the inflammatory condition was induced. In the next step, each well was washed twice with PBS to remove the nonadherent bacteria. These treatments were performed in duplicate and the cell culture was maintained at 37°C and 5% CO2 for up to 48 h. Determination of MOI was performed as previously indicated. 12
3.3. RT‐PCR of inflammatory signaling pathway genes
An RNA extraction kit (Roche) was used to extract total RNA according to the manufacturer's instructions. The amount and quality of purified RNA were determined using a NanoDrop1000 UV‐Vis spectrophotometer (measuring absorbance at 260/280 nm). The cDNA template was synthesized using the cDNA synthesis kit (Yekta Tajhiz) according to the manufacturer's instructions. The online website Primer Bank (http://pga.mgh.harvard.edu/primerbank) was used to select quantitative real‐time polymerase chain reaction (qPCR) primers (Table 1). All reactions were performed in duplicate. The formula RQ = 2‐ΔΔ C t was used to obtain the relative gene expression in the comparative CT method. 13 The appropriate internal control gene, glyceraldehyde‐3‐phosphate dehydrogenase (gapdh), was selected as the housekeeping gene to normalize the data. To evaluate the mRNA quantification of the studied genes, the ABI step one plus detection system (Applied Biosystems Corp.) and SYBR Green Master Mix (Amplicon Bio) were used.
Table 1.
Primer sequences used in this study.
| Gene | Primer sequence (5′ > 3′) | Primer bank ID | Product size (bp) |
|---|---|---|---|
| STAT1 F | CGGCTGAATTTCGGCACCT | 189458859c3 | 81 |
| STAT1 R | CAGTAACGATGAGAGGACCCT | ||
| STAT2 F | CTGCTAGGCCGATTAACTACCC | 291219923c3 | 87 |
| STAT2 R | TCTGATGCAGGCTTTTTGCTG | ||
| STAT3 F | ACCAGCAGTATAGCCGCTTC | 47080104c2 | 124 |
| STAT3 R | GCCACAATCCGGGCAATCT | ||
| STAT4 F | GCTTAACAGCCTCGATTTCAAGA | 345110659c2 | 91 |
| STAT4 R | GAGCATGGTGTTCATTAACAGGT | ||
| STAT5 F | CGACGGGACCTTCTTGTTG | 221316717c3 | 80 |
| STAT5 R | GTTCCGGGGAGTCAAACTTCC | ||
| STAT6 F | CGAGTAGGGGAGATCCACCTT | 296010867c2 | 92 |
| STAT6 R | GCAGGAGTTTCTATCAAGCTGTG | ||
| JAK1 F | CTTTGCCCTGTATGACGAGAAC | 102469033c1 | 101 |
| JAK1 R | ACCTCATCCGGTAGTGGAGC | ||
| JAK2 F | ATCCACCCAACCATGTCTTCC | 223671934c2 | 121 |
| JAK2 R | ATTCCATGCCGATAGGCTCTG | ||
| JAK3 F | CTGCACGTAGATGGGGTGG | 189095272c2 | 78 |
| JAK3 R | CACGATCAGGTTGGACTTTTCT | ||
| TYK2 F | GAGATGCAAGCCTGATGCTAT | 187608614c1 | 76 |
| TYK2 R | GGTTCCCGAGGATTCATGCC | ||
| RIP2 F | GCCCTTGGTGTAAATTACCTGC | 93141034c2 | 138 |
| RIP2 R | GGACATCATGCGCCACTTT | ||
| NEMO F | AAGAGCCAACTGTGTGAGATG | 142381344c1 | 69 |
| NEMO R | TTCGCCCAGTACGTCCTGA | ||
| TIRAP F | GACCCCTGGTGCAAGTACC | 89111123c2 | 133 |
| TIRAP R | CGACGTAGTACATGAATCGGAG | ||
| IRAK4 F | CTTGGATGGTACTCCACCACT | 223671887c3 | 76 |
| IRAK4 R | AAAATTGATGCCATTAGCTGCAC |
Abbreviations: IRAK, Interleukin 1 Receptor Associated Kinase; JAK, Janus kinase; NEMO: Nuclear factor‐kappa B Essential Modulator; RIP, receptor interacting protein; STAT, signal transducer and activator of transcription; TIR‑associated Protein; TYK, tyrosine kinase.
3.4. Cytokine assays
To determine the phenotypic effects of probiotic treatment on inflammation reduction, cytokine production was assessed by ELISA assay. After SP and Lactobacillus spp. treatments, the supernatant of the cell culture was centrifuged at 6000 rpm, and the supernatant was collected to evaluate the production of proinflammatory cytokines, including interleukin (IL)‐6 and IL‐1β.
3.5. Statistical analysis
Graphs and statistical analysis of the data were performed using SPSS (ver. 25) and GraphPad Prism software to compare variables of different groups. Statistical differences between multiple groups were determined using ordinary one‐way analysis of variance (ANOVA). p < .05 were considered statistically significant. The results were presented as mean ± SD.
4. RESULTS
In the present study, we investigated the anti‐inflammatory effect of live Lactobacillus spp. The cocktail form with four different species was used to enhance the anti‐inflammatory effect of the probiotic strains. In addition, the SP was used to induce the inflammatory state because bacterial components, including lipopolysaccharide (LPS) and flagellin of gram‐negative bacteria, are released during the sonication process and these components could trigger inflammation via triggering inflammatory signaling pathways. Lactobacillus spp.‐treated HT‐29 cells were compared with C24 and C48 (negative controls) and SP24 and SP48 (positive controls) to evaluate the efficacy of Lactobacillus spp. in up or downregulating the studied genes. It should be noted that the concept of treatment stages (phases) refers to taking probiotics before, after, and during the induction of inflammation.
4.1. The results of STAT genes expression
Data on STAT gene expression are shown in Figure 1. Compared to negative controls, the expression level was increased by SP (p < .05). However, both up and downregulation was observed for STAT genes after probiotic treatments compared to positive controls in a different state of inflammation.
Figure 1.

Relative gene expression (mean fold change) of STAT genes in the different groups of treatments (A‐F for STAT 1‐6). Data were represented as mean ± SD. Data were considered as statistically significant when p < .05 ('p < .05, "p < .001). Letter a indicates the relatedness between C24 and C48 with other treatments, letter b shows the relatedness between sp24 and other treatments, and letter c shows the relatedness between sp48 with other treatments. The relatedness between other treatments is shown with bracket.
Comparative analysis of STAT1, STAT2, and STAT4 gene expressions showed that Lactobacillus spp. treatment upregulated gene expression at most treatment stages. However, LP24 and PL24 downregulated the expression level in STAT1, STAT2, and STAT4, respectively (p < .001). In STAT5, again LP24 could significantly decrease the expression level (p < .05), while LP48 was able to significantly increase the expression level (p < .0001).
For STAT3 and STAT6, the general trend was downward in most treatment phases. In particular, P + L24 in both genes and PL48 in STAT3 had the greatest effect on reducing expression levels (p < .05).
4.2. The results of JAK genes expression
Data on JAK expressions are shown in Figure 2. Comparative analysis of JAK gene expression between SP and negative controls showed that SP‐ETEC and SP‐ST could significantly increase gene expression.
Figure 2.

Relative gene expression (mean fold change) of JAK genes in the different groups of treatments (A‐D for JAK 1, JAK 2, JAK 3 and TYK 2 genes). Data were represented as mean ± SD. Data were considered as statistically significant when p < .05 ('p < .05, "p < .001). Letter a indicates the relatedness between C24 and C48 with other treatments, letter b shows the relatedness between sp24 and other treatments, and letter c shows the relatedness between sp48 with other treatments. The relatedness between other treatments is shown with bracket. TYK, tyrosine kinase
Comparative analysis of JAK1 showed that Lactobacillus spp. could downregulate the expression level both before and after causing inflammation (p < .0001). However, when Lactobacillus spp. were added simultaneously with the SP, the expression level was significantly increased (p < .0001).
For JAK2, Lactobacillus spp. was able to downregulate the expression level before and after triggering inflammation compared to SP48 (p < .0001). When Lactobacillus spp. was added simultaneously with the sonicated pathogen, the result was not homogeneous. Lactobacillus spp. downregulated the expression level in the first 24 h of treatment, but gene expression was increased after 48 h. In JAK3, the general trend was downward in all treatment phases, except for PL24.
Comparative analysis of tyrosine kinase (TYK)2 gene expression showed that Lactobacillus spp. treatment upregulated gene expression at most treatment stages. However, when Lactobacillus spp. was added to the HT‐29 cell line before inflammation induction, the expression level was decreased after 24 h of treatment (LP24) (p < .0001). Adding Lactobacillus spp. together with SP (during inflammation state) had the most effects on increasing the expression level of the TYK2 gene (P + L24) (p < .05).
4.3. The results of inflammatory genes expression
Inflammatory gene expression data are shown in Figure 3. Comparative analysis of inflammatory gene expression, including Nuclear factor‐kappa B Essential Modulator (NEMO), TIR‑associated Protein (TIRAP), Interleukin 1 Receptor Associated Kinase (IRAK), and receptor interacting protein (RIP) between SP and negative controls showed that SP‐ETEC and SP‐ST could significantly increase gene expression, especially after 48 h. Lactobacillus spp. treatment had significant reducing effects at all treatment stages. In other words, it could reduce expression before, after, and during inflammation induction. It should be noted that Lactobacillus spp. treatments reduced the expression of TIRAP and RIP to zero.
Figure 3.

Relative gene expression (mean fold change) of inflammatory genes in the different groups of treatments (A‐ D for NEMO, TIRAP, IRAK 4 and RIP genes). Data were represented as mean ± SD. Data were considered as statistically significant when p < .05 ('p < .05, "p < .001). Letter a indicates the relatedness between C24 and C48 with other treatments, letter b shows the relatedness between sp24 and other treatments, and letter c shows the relatedness between sp48 with other treatments. The relatedness between other treatments is shown with bracket. IRAK, Interleukin 1 Receptor Associated Kinase; NEMO, Nuclear factor‐kappa B Essential Modulator; TIRAP, TIR‑associated Protein.
4.4. The result of proinflammatory cytokines production
The result of proinflammatory cytokines production are shown in Figure 4. Cytokine production was significantly higher after SP treatments. However, treatment with Lactobacillus spp. significantly decreased cytokine production before, after, and during inflammation. It appears that the addition of Lactobacillus spp. along with the SP (during inflammation) had the greatest effect on reducing inflammatory cytokines.
Figure 4.

Different levels of concentrations of proinflammatory cytokines (A and B for IL‐6 and IL‐1 B). Data were represented as mean ± SD. Data were considered as statistically significant when p < .05 ('p < .05, "p < .001). Letter a indicates the relatedness between C24 and C48 with other treatments, letter b shows the relatedness between sp24 and other treatments, and letter c shows the relatedness between sp48 with other treatments. The relatedness between other treatments is shown with bracket.
5. DISCUSSION
IBD as a chronic recurrent disease affects various aspects of the patient. The exact cause or pathogenesis of IBD is not yet fully understood, but dysbiosis of the gut microbiome along with dysregulation of the immune system could lead to inflammation, which is usually observed in patients with IBD. One of the biggest challenges in IBD patients is the fact that the probability of relapse within the next year is 70%−80% in patients with active disease. Thus, if therapeutic choices could prolong the period of remission in the patient, this inactive phase could persist for the next few years. Patients with CD usually suffer more severe symptoms than patients with UC, including hypovolemia, protein‐calorie malnutrition, and anemia. However, it takes 2 years after the initial diagnosis for the first relapse and surgical therapies are usually not used until 10 years after the initial diagnosis 14 thus, these time periods appear to be long enough that anti‐inflammatory agents could reduce inflammation and improve symptoms. The severity of IBD may progress to affect other organs such as joints, skin, eyes, and to a lesser extent lung, liver, and pancreas. 15 Therefore, patients with IBD are strongly recommended to use therapeutic agents, especially those with the least side effects, including probiotics, to reduce the risk of surgical intervention, limit the symptoms of IBD, and prolong the time of remission. 16 Signaling pathways as the messenger system in cell function could show the effects of environmental stimulators in the improvement of cell hemostasis and as mentioned earlier, we have seen the phenotypic anti‐inflammatory effects of our probiotic strains in an in vivo study. 11 Therefore, we wanted to find out the effects of probiotics on gene expression of signaling pathways that could affect the inflammatory response in the gut including NF‐κB and JAK/STAT pathways.
The results of the cytokine assay (reduction of anti‐inflammatory cytokines) in the present study are consistent with the results of our previous study that showed the anti‐inflammatory effect of Lactobacillus in an in vivo model. 11 In the present study, Lactobacillus spp. treatments in all versions of inflammation induction had significant reduction effects, especially when probiotics and sonicated pathogens were added simultaneously. These phenotypic results were confirmed by the molecular investigation. The results of NF‐κB expression levels were homogeneous. The addition of sonicated pathogens could significantly increase the expression level. This evidence could show the probable role of pathogenic components to cause inflammation. However, treatment with Lactobacillus spp. had a significant reducing effect. Lactobacillus spp. had a reducing effect on the expression of inflammatory genes before, after, and during the initiation of inflammation. NF‐κB is considered one of the main mediators of inflammatory responses and can induce the expression of several proinflammatory genes. 17 Reducing the expression of these genes could therefore have a beneficial effect on reducing inflammation.
The results of the JAK/STAT pathway in the current study were different. In other words, Lactobacillus spp. had both decreasing and increasing effects on expression levels. However, these results are also consistent with the phenotypic results and the anti‐inflammatory properties of the probiotics. In the current study, the overall trend of expression of some STATs, including STAT3 and STAT6, was downward. In general, downregulation of this pathway has remarkable effects on reducing inflammation. Several studies have reported that reducing the expression of STAT3, for example, can lead to a reduction in IL‐6 and thus contribute to the reduction of the inflammatory state. 18 , 19 STAT6 is another STAT with increased phosphorylation in patients with UC. Studies have reported that colitis is limited in STAT 6−/− mice and that deficiency of STAT6 may be helpful in improving IBD. 20 On the contrary, the expression of other STATs, including STAT1, STAT2, STAT4, and STAT5, was approximately increased. These data could be confirmed by other reports. The overall function of JAK/STAT in controlling IBD is complicated. For example, Rauch et al. 21 reported that a microarray study of biopsies revealed that STAT1 expression might be elevated in CD, but this condition could not usually be observed in patients with UC. The association between STATs, including STAT1, and anti‐inflammatory cytokines, including the IL‐10 superfamily, may be one of the reasons supporting the beneficial effects of upregulating STAT1 in the treatment of inflammatory diseases such as IBD. 22 The same condition could be observed for STAT5. IL‐22 as one of the anti‐inflammatory cytokines could activate STAT1, STAT5, JAK1, and TYK2 and mediate its function. 23 Several studies also addressed the different roles of other STATs, including STAT2 and STAT4. Yang et al. 24 reported that STAT4 may have beneficial effects on the control of IBD by inhibiting Th17 accumulation and promoting repair of the damaged intestinal epithelium by inhibiting activation of the IL17α/IL17 promoter. STAT2 also plays different roles in the immune system. Because it can be activated by type I interferons (IFNs), it plays an important role in immunomodulation, which is usually impaired in patients with IBD. 25 All of these data may support the beneficial effects of upregulation of STATs genes.
The results of JAKs also showed remarkable data on the control of inflammation. The overall trend for JAK1, JAK2, and JAK3 was downward. Targeting JAKs to control IBD has been discussed in several studies. In other words, any agent that has an inhibitory effect on the activities of JAK could control the inflammatory state in patients with IBD. 26 However, the results of TYK2 seem to be the opposite. The general trend in the expression of TYK2 was increasing. TYK2, together with the STATs component, might be associated with several cytokines. IL‐10 and IFN‐λ are two of the cytokines with anti‐inflammatory properties associated with TYK2. 27 Therefore, upregulation might be helpful for the activity of anti‐inflammatory status.
In conclusion, evaluating the precise molecular effects of Lactobacillus spp. on signaling pathways could provide clear insight into how probiotics modulate and reduce inflammation. One of the most important issues is understanding the anti‐inflammatory properties of probiotics and clarifying whether probiotics could be used as a preservative or as a therapeutic. Finding the easiest way to both prevent and relieve the symptoms of IBD could be of great importance to IBD patients. Since we use Lactobacillus spp. as pre, post, and cotreatment, and observation of its beneficial effects on all three variants, the results may suggest that these probiotic strains, in turn, could prevent and treat the severity of IBD.
AUTHOR CONTRIBUTIONS
Performed the experiments: Shadi Aghamohammad, Seyedeh Tina Miri, and Saeideh Najafi. Data analysis: Amin Sepehr, Mahdi Rohani, and Shadi Aghamohammad. Writing of the manuscript: Shadi Aghamohammad and Amin Sepehr. Revised manuscript: Mohammad R. Pourshafie and Mahdi Rohani. Conceived and designed the experiments: Mohammad R. Pourshafie and Mahdi Rohani.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
ETHICS STATEMENT
The experimental protocols were established following the Declaration of Helsinki and approved by the ethics committee of Pasteur Institute of Iran (IR.PII.REC.1398.060). Signed informed consent was obtained from all participants.
ACKNOWLEDGMENTS
The authors would like to thank Pasteur Institute of Iran as funding agency (with grant number 1694) and Dr. Sana Eybpoosh in the Department of Epidemiology and Biostatistics Research Center for Emerging and Reemerging Infectious Diseases, Pasteur Institute of Iran, Tehran, for her help and support. The current research was done in support of Pasteur Institute of Iran supported as a funding agency (with grant number 1694).
Aghamohammad S, Sepehr A, Miri ST, Najafi S, Pourshafie MR, Rohani M. Anti‐inflammatory and immunomodulatory effects of Lactobacillus spp. as a preservative and therapeutic agent for IBD control. Immun Inflamm Dis. 2022;10:e635. 10.1002/iid3.635
Contributor Information
Mohammad R. Pourshafie, Email: m_pour@pasteur.ac.ir, Email: pour62@yahoo.com.
Mahdi Rohani, Email: kia.rohani@gmail.com.
DATA AVAILABILITY STATEMENT
The data sets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
REFERENCES
- 1. Azad M, Kalam A, Sarker M, Li T, Yin J. Probiotic species in the modulation of gut microbiota: an overview. BioMed Res Int. 2018;2018:1‐8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Yousefi B, Eslami M, Ghasemian A, Kokhaei P, Salek Farrokhi A, Darabi N. Probiotics importance and their immunomodulatory properties. J Cell Physiol. 2019;234(6):8008‐8018. [DOI] [PubMed] [Google Scholar]
- 3. Chalas R, Janczarek M, Bachanek T, Mazur E, Cieszko‐Buk M, Szymanska J. Characteristics of oral probiotics—a review. Curr Issues Pharma Med Sci. 2016;29(1):8‐10. [Google Scholar]
- 4. Hu CH, Ren LQ, Zhou Y, Ye BC. Characterization of antimicrobial activity of three Lactobacillus plantarum strains isolated from Chinese traditional dairy food. Food Sci Nutr. 2019;7(6):1997‐2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Sung V, D'amico F, Cabana MD, et al. Lactobacillus reuteri to treat infant colic: a meta‐analysis. Pediatrics. 2018;141:1. [DOI] [PubMed] [Google Scholar]
- 6. Kashima S, Fujiya M, Konishi H, et al. Polyphosphate, an active molecule derived from probiotic Lactobacillus brevis, improves the fibrosis in murine colitis. Transl Res. 2015;166(2):163‐175. [DOI] [PubMed] [Google Scholar]
- 7. Davies JM, Abreu MT. The innate immune system and inflammatory bowel disease. Scand J Gastroenterol. 2015;50(1):24‐33. [DOI] [PubMed] [Google Scholar]
- 8. Molnár T, Lakatos PL, Farkas K, et al. Predictors of relapse in patients with Crohn's disease in remission after 1 year of biological therapy. Aliment Pharmacol Ther. 2013;37(2):225‐233. [DOI] [PubMed] [Google Scholar]
- 9. Morelli L, Pellegrino P. A critical evaluation of the factors affecting the survival and persistence of beneficial bacteria in healthy adults. Benef Microbes. 2021;12(4):15‐25. [DOI] [PubMed] [Google Scholar]
- 10. Farzaei MH, El‐Senduny FF, Momtaz S, et al. An update on dietary consideration in inflammatory bowel disease: anthocyanins and more. Expert Rev Gastroenterol Hepatol. 2018;12(10):1007‐1024. [DOI] [PubMed] [Google Scholar]
- 11. Rohani M, Noohi N, Talebi M, Katouli M, Pourshafie MR. Highly heterogeneous probiotic Lactobacillus species in healthy Iranians with low functional activities. PLoS One. 2015;10(12):e0144467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Ghanavati R, Asadollahi P, Shapourabadi MB, Razavi S, Talebi M, Rohani M. Inhibitory effects of Lactobacilli cocktail on HT‐29 colon carcinoma cells growth and modulation of the Notch and Wnt/β‐catenin signaling pathways. Microb Pathog. 2020;139:103829. [DOI] [PubMed] [Google Scholar]
- 13. Schmittgen TD, Livak KJ. Analyzing real‐time PCR data by the comparative CT method. Nat Protoc. 2008;3(6):1101‐1108. [DOI] [PubMed] [Google Scholar]
- 14. Sairenji T, Collins KL, Evans DV. An update on inflammatory bowel disease. Prim Care: Clin in Off Pract. 2017;44(4):673‐692. [DOI] [PubMed] [Google Scholar]
- 15. Vavricka SR, Schoepfer A, Scharl M, Lakatos PL, Navarini A, Rogler G. Extraintestinal manifestations of inflammatory bowel disease. Inflamm Bowel Dis. 2015;21(8):1982‐1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Kaplan GG, Ng SC. Understanding and preventing the global increase of inflammatory bowel disease. Gastroenterology. 2017;152(2):313‐321.e2. [DOI] [PubMed] [Google Scholar]
- 17. Liu T, Zhang L, Joo D, Sun S‐C. NF‐κB signaling in inflammation. Signal Transduct Target Ther. 2017;2(1):1‐9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Chen L, Zou Y, Peng J, et al. Lactobacillus acidophilus suppresses colitis‐associated activation of the IL‐23/Th17 axis. J Immunol Res. 2015:2015: 909514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Li Y, Yu C, Zhu WM, et al. Triptolide ameliorates IL‐10‐deficient mice colitis by mechanisms involving suppression of IL‐6/STAT3 signaling pathway and down‐regulation of IL‐17. Mol Immunol. 2010;47(15):2467‐2474. [DOI] [PubMed] [Google Scholar]
- 20. Rosen MJ, Chaturvedi R, Washington MK, et al. STAT6 deficiency ameliorates severity of oxazolone colitis by decreasing expression of claudin‐2 and Th2‐inducing cytokines. J Immunol. 2013;190(4):1849‐1858. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Rauch I, Müller M, Decker T. The regulation of inflammation by interferons and their STATs. JAKSTAT. 2013;2(1):e23820. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Commins S, Steinke JW, Borish L. The extended IL‐10 superfamily: IL‐10, IL‐19, IL‐20, IL‐22, IL‐24, IL‐26, IL‐28, and IL‐29. J Allergy Clin Immunol. 2008;121(5):1108‐1111. [DOI] [PubMed] [Google Scholar]
- 23. Ouyang W. Distinct roles of IL‐22 in human psoriasis and inflammatory bowel disease. Cytokine Growth Factor Rev. 2010;21(6):435‐441. [DOI] [PubMed] [Google Scholar]
- 24. Yang C, Mai H, Peng J, Zhou B, Hou J, Jiang D. STAT4: an immunoregulator contributing to diverse human diseases. Int J Biol Sci. 2020;16(9):1575‐1585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Hu X, Li J, Fu M, Zhao X, Wang W. The JAK/STAT signaling pathway: from bench to clinic. Signal Transduct Target Ther. 2021;6(1):402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Agrawal M, Kim ES, Colombel J‐F. JAK inhibitors safety in ulcerative colitis: practical implications. J Crohn's Colitis. 2020;14(suppl_2):S755‐S760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Borcherding DC, He K, Amin NV, Hirbe AC. TYK2 in cancer metastases: genomic and proteomic discovery. Cancers. 2021;13(16):4171. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data sets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
