Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 May 19.
Published in final edited form as: Methods Mol Biol. 2018;1715:191–205. doi: 10.1007/978-1-4939-7522-8_13

CRISPR Repair Reveals Causative Mutation in a Preclinical Model of Retinitis Pigmentosa: A Brief Methodology

Wen-Hsuan Wu 1,2,3, Yi-Ting Tsai 1,2,3, Sally Justus 1,2,3, Galaxy Y Cho 1,2,3, Jesse D Sengillo 1,2,3,4, Yu Xu 1,2,3,5, Thiago Cabral 1,2,3,7,7, Chyuan-Sheng Lin 8, Alexander G Bassuk 9, Vinit B Mahajan 10,11, Stephen H Tsang 12,13,14,15,16
PMCID: PMC9119419  NIHMSID: NIHMS1632221  PMID: 29188514

Abstract

CRISPR/Cas9 genome engineering is currently the leading genome surgery technology in most genetics laboratories. Combined with other complementary techniques, it serves as a powerful tool for uncovering genotype–phenotype correlations. Here, we describe a simplified protocol that was used in our publication, CRISPR Repair Reveals Causative Mutation in a Preclinical Model of Retinitis Pigmentosa, providing an overview of each section of the experimental process.

Keywords: CRISPR, Genome engineering, sgRNA construct design, Retinitis pigmentosa, Electroretinogram, Fundoscopy, Optical-coherence tomography

1. Introduction

In our publication, CRISPR Repair Reveals Causative Mutation in a Preclinical Model of Retinitis Pigmentosa [1], we identified which of two potentially pathogenic variants in a retinitis pigmentosa (RP) mouse model is responsible for the phenotype, namely, a rapid dysgenesis of the retina postnatally, eventually leading to blindness. This publication resolved a century-long debate on whether a mutation in the phosphodiesterase 6 beta (Pde6b) gene or a viral insertion (Xmv-28) was responsible for the retinal degeneration, both of which are present in the mouse model. This discovery was only made possible by CRISPR genome engineering technologies. Here, we provide a brief description of the methods we used to conduct these experiments. While this protocol is specific to the aims of our previous paper, we hope that its overarching themes, tips, and techniques can be repurposed for readers and inform or inspire their own CRISPR-based discoveries (see Note 1).

2. Materials

2.1. sgRNA Construction

  1. sgRNA Oligos (Integrated DNA Technologies Custom DNA oligos, see Table 1).

  2. T4 DNA ligase reaction buffer, 10×.

  3. T4 polynucleotide kinase.

  4. pSpCas9(BB) (we used pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) in this paper, Addgene plasmid ID: 42,335).

  5. Tango buffer (Fermentas/Thermo Scientific) or FastDigest buffer.

  6. FastDigest BbsI (BpiI) (Fermentas/Thermo Scientific).

  7. DTT, 10 mM.

  8. ATP, 10 mM.

  9. T7 DNA ligase (New England BioLabs).

  10. PlasmidSafe ATP-dependent DNase (Epicentre).

  11. 10× PlasmidSafe buffer.

  12. One Shot Stbl3 chemically competent E. coli (Life Technologies).

  13. Lysogeny Broth (LB) medium supplemented with 100 μg/ml ampicillin. Prepare from a 100 mg/mL ampicillin stock.

  14. LB agar plates supplemented with 100 μg/ml ampicillin.

  15. ddH2O.

Table 1.

Donor template sequence for CRISPR-mediated correction of the Y347X mutation

ssODN Sequence (5′ → 3′)
NdeI-Pde6b ssODN AACAATGCAAGCATTCATTCCTTCGACCTCTGTTCTTTTCCCACAGC
ACACCCCCGGCTGATCACTGGGCCCTGGCCAGTGGCCTTCCAACAT
ATGTAGCTGAGAGTGGCTTTGTGAGTGTCCCTCTCCAGGCCTTGGC
CTCTACTGGCCAGTGCTATGATATGTGCTAGCCTGCTACCTCCTATT
AGCACATCCTGCTA
Open in a new tab

2.2. sgRNA In Vitro Validation

  1. pSpCas9(BB)-sgRNA constructs.

  2. DMSO.

  3. Primers (see Tables 2 and 3).

  4. Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific).

  5. dNTP.

  6. ddH2O.

  7. AccuGENE™ 10× TBE Buffer.

  8. UltraPure Agarose.

  9. UltraPure DNase/RNase-free distilled water.

  10. Cas9 protein (PNA Bio).

  11. 10× Cas9 nuclease buffer (NEB).

  12. RNasin Plus RNase Inhibitor.

Table 2.

Oligo sequences for Pde6b sgRNA construction

sgRNA oligos Sequence (5′ → 3′)
sgRNA1-foward CACCGCCACTTTCTGCTACTTAGGT
sgRNA1-reverse AAACACCTAAGTAGCAGAAAGTGGC
sgRNA2-foward CACCGCTCCAGGCCTTGGCCTGTAC
sgRNA2-reverse AAACGTACAGGCCAAGGCCTGGAGC
sgRNA3-foward CACCGAGGGCCCAGTGATCAGCCGG
sgRNA3-reverse AAACCCGGCTGATCACTGGGCCCTC
sgRNA4-foward CACCGCCAACCTAAGTAGCAGAAAG
sgRNA4 reverse AAACCTTTCTGCTACTTAGGTTGGC
Open in a new tab

Table 3.

Primer sequences for PCR

Primers Sequence (5′ → 3′)
T7-sgRNA1-foward TTAATACGACTCACTATAGGGCCACTTTCTGCTACTTAGGT
T7-sgRNA2-foward TTAATACGACTCACTATAGGGCTCCAGGCCTTGGCCTGTAC
T7-sgRNA3-foward TTAATACGACTCACTATAGGGAGGGCCCAGTGATCAGCCGG
T7-sgRNA4-foward TTAATACGACTCACTATAGGGCCAACCTAAGTAGCAGAAAG
sgRNA-reverse AAAAGCACCGACTCGGTG
RD1-check-F CAAGAAGGCAGTAGGATTCCG
RD1-check-R TTGTCTTGCCTGCTTCTCATC
#10 ATGTACCGCCAGCGCAATGG
#JS610 CCCCGCCTTCTCAACAACCTGGGACGGGAG
#80 CTCTGTTTCTCTCCTGATACG
#81 ACCTGCATGTGAACCCAGTATT
Open in a new tab

2.3. Zygote Injection

  1. FVB/N male and superovulated female mice.

  2. M16 medium (Specialty Media).

2.4. Detection of Gene Correction or Disruption

  1. Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific).

  2. Primers (see Tables 2 and 3).

  3. dNTP.

  4. ddH2O.

  5. NdeI restriction enzyme.

2.5. Kits

  1. QIAprep or other spin miniprep kit.

  2. QIAQuick or other PCR purification kit.

  3. MEGAshortscript or other shortscript T7 Transcription kit.

  4. MEGAclear or other transcription cleanup kit.

  5. DNeasy or other blood and tissue kit.

  6. Surveyor Mutation Detection Kit (Integrated DNA Technologies).

  7. Zero Blunt TOPO PCR Cloning Kit (Life Technologies).

2.6. Electroretinogram Recordings

  1. 100 mg/mL Ketamine.

  2. 20 mg/mL Xylazine.

  3. PBS.

  4. Heating pad.

  5. 1% Tropicamide ophthalmic solution.

  6. 2.5% Phenylephrine ophthalmic solution.

  7. 0.5% Proparacaine hydrochloride ophthalmic solution.

  8. 2.5% Goniosol hypromellose ophthalmic demulcent solution.

2.7. Fundoscopy Imaging

  1. 100 mg/mL Ketamine.

  2. 20 mg/mL Xylazine.

  3. PBS.

  4. 1% Tropicamide ophthalmic solution.

  5. 2.5% Phenylephrine ophthalmic solution.

  6. 0.5% Proparacaine hydrochloride ophthalmic solution.

  7. Systane Gel (Lubricant Eye Gel, Alcon).

  8. 100 mg/mL AK-Fluor sodium fluorescein (Akorn Inc.).

2.8. Equipment

  1. Burian-Allen bipolar mouse contact lens electrodes (Hansen Lab, La Jolla, California).

  2. Espion Electroretinogram (ERG) Diagnosys equipment (Diagnosys LLC).

  3. Ganzfeld dome (Diagnosys LLC).

  4. Spectralis scanning laser confocal ophthalmoscope (OCT-SLO Spectralis 2; Heidelberg Engineering).

  5. Red LED headlight (Rayovac SPHLTLED-BB Sportsman 22 Lumen 3 in 1 Headlight).

3. Methods

3.1. Single-Stranded Oligodeoxynucleotide (ssODN) Donor Template Design

  1. Design and order custom ssODN donor templates that do not harbor disease-causing mutations in the gene of interest (Table 1). Instead, the sequences may contain silent mutations that can dually serve as sites for restriction enzyme cleavage during tests like RFLP assays, for example.

  2. Dilute the ssODN with nuclease-free water to 10 μM. Store at −20 °C.

3.2. Single Guide RNA (sgRNA) Design

  1. Use a CRISPR guide design software to develop the sequence. There are many software options and websites available for this purpose. We use Benchling (www.benchling.com), but other options include http://tools.genome-engineering.org, https://www.atum.bio/eCommerce/cas9/input,etc.

  2. Each site should offer detailed instructions for designing the guide using the software, but generally:
    1. Input the target genomic DNA sequence.
    2. Aim to find a guide sequence as close to the target site as possible.
    3. Enhance sgRNA specificity by targeting the mutation site itself and by placing the mutation within 12 bps of the 3′ end of the sgRNA sequence.

  3. Order oligos as specified by the Benchling website (Table 2). See Note 2

3.3. sgRNA Construction

3.3.1. Prepare the Inserts

  1. Resuspend sgRNA oligos with ddH2O to 100 μM and prepare the following mixture in order to phosphorylate and anneal the sgRNA oligos:
    Ingredients Quantity (μL)
    ddH2O 6.5
    T4 PNK 0.5
    10× T4 PNK buffer 1
    sgRNA top (100 μM) 1
    sgRNA bottom (100 μM) 1
    Total 10
    Open in a new tab

  2. Anneal oligos with the following thermocycling parameters: 37 °C for 30 min, then 95 °C for 5 min, and finally ramp down to 25 °C at 5 °C per min.

  3. Dilute to 1:200 (i.e., 1 μl of oligo to 199 μl RT ddH2O).

3.3.2. Cloning the sgRNAs into Plasmid

  1. Prepare the ligation reaction based on the parameters below, then incubate for 1 h while cycling 6 times, with alternating periods of 37 °C for 5 min and 23 °C for 5 min.
    Ingredients Quantity (μL)
    ddH2O to 20
    T7 ligase 0.5
    Tango buffer or FastDigest buffer, 10× 2
    DTT, 10 mM 1
    ATP, 10 mM 1
    FastDigest BbsI 1
    Diluted oligo duplex 2
    pSpCas9(BB), 100 ng ×
    Total 20
    Open in a new tab
  2. Use PlasmidSafe exonuclease to remove any lingering linearized DNA (optional, see below for mixture parameters).
    Ingredients Quantity (μL)
    Ligation reaction 11
    ATP, 10 mM 1.5
    PlasmidSafe buffer, 10× 1.5
    PlasmidSafe exonuclease 1
    Total 15
    Open in a new tab

  3. Incubate at 37 °C for 30 min followed by 70 °C for 30 min.

3.3.3. Transforming Plasmid into Competent Cells

  1. Transform the plasmid into E. coli according to the protocol accompanying the cells.

  2. The next day, pick 2–3 colonies and inoculate into 3 mL of LB medium with 100 μg/mL of ampicillin. Incubate at 37 °C and shake overnight.

  3. Following the manufacturer’s instructions, isolate the plasmid using the QIAprep spin miniprep kit.

  4. Use the U6-Fwd primer to sequence from the U6 promoter and verify the sequence.

3.4. In Vitro Validation of sgRNA Targeting

  1. To prepare the T7-sgRNA template, use PCR amplification with the appropriate primer pair (Table 3) following the parameters below to add the T7 promoter sequence to the sgRNA template.
    Ingredients Quantity (per reaction, μL) Final
    pSpCas9-sgRNA (5 ng/μL) 2 10 ng
    Forward primer (10 μM) 1 0.2 μM
    Reverse primer (10 μM) 1 0.2 μM
    5× HF buffer 10 1×
    DMSO 1.5
    Phusion high-fidelity DNA polymerase 0.5 –
    dNTP (2.5 mM) 4 200 μM
    ddH2O 30 –
    Total 50
    Open in a new tab
  2. Perform the PCR cycles as follows:
    Cycle number Denature Anneal Extend
    1 98 °C, 2 min
    2–36 98 °C, 5 s 65 °C, 5 s 72 °C, 7 s
    37 72 °C, 2 min
    Open in a new tab

  3. Use a TBE buffer and 2% weight/volume (wt/vol) agarose gel to run the PCR product. The product size should be roughly 120 bp.

  4. Following the manufacturer’s instructions, use the PCR purification kit to purify the T7-sgRNA PCR product.

  5. Following the manufacturer’s instructions, use the MEGAshortscript T7 kit for in vitro transcription of sgRNA, using the purified PCR product as the template.

  6. Following the manufacturer’s instructions, use the MEGAclear kit to purify the sgRNA. Elute the sgRNA with nuclease-free water.

  7. Verify its quality by running on a gel (2% wt/vol agarose gel with TBE buffer) and assessing bands for possible sgRNA degradation.

  8. Using RNase-free water, dilute the sgRNA to 500 ng/μL.

  9. Prepare the target template: Using the appropriate primer pair (Table 3), perform a PCR-amplification using the following parameters:
    Ingredients Quantity (per reaction, μL) Final
    Genomic DNA template from FVB/N mice (5 ng/μL) 2 10 ng
    Forward primer (10 μM) 1 0.2 μM
    Reverse primer (10 μM) 1 0.2 μM
    5× HF buffer 10 1×
    DMSO 1.5
    Phusion high-fidelity DNA polymerase 0.5 –
    dNTP (2.5 mM) 4 200 μM
    ddH2O 30 –
    Total 50
    Open in a new tab
  10. Perform the PCR cycles as follows:
    Cycle number Denature Anneal Extend
    1 98 °C, 5 min
    2–36 98 °C, 5 s 63 °C, 8 s 72 °C, 20 s
    37 72 °C, 3 min
    Open in a new tab

  11. Run the PCR product on a gel (1.5% wt/vol agarose gel in TBE buffer). Verify its concentration and size (∼845 bp is expected).

  12. Following the manufacturer’s instructions, use the PCR purification kit to purify the PCR product.

  13. Complex the Cas9 protein, sgRNA, and target template together under the following conditions:
    Ingredients Quantity (per reaction, μL) Final
    Cas9 protein, 1 mg/mL 0.6 600 ng
    sgRNA, 500 ng/μL 1 500 ng
    Cas9 buffer (NEB), 10× 2 1×
    Target template x 400 ng
    RNAsin, 40 U/μL 0.1 0.2 U/μl
    ddH2O to 20
    Total 20
    Open in a new tab

  14. Incubate at 37 °C for 2 h, then at 70 °C for 30 min.

  15. Run on a gel (2% wt/vol agarose gel with TBE buffer) to estimate sgRNA efficiency.

3.5. Zygote Injection and Generation of Mice

This involves pronuclear injection and oviduct transfer, which are standard procedures that are beyond the scope of this chapter. Briefly:

  1. Superovulate FVB/N females by mating with FVB/N males and obtain oocytes.

  2. Inject 3 ng/μL of sgRNA plasmid, 3 ng/μL of Cas9 protein, and 1 μM of ssODN into the FVB/N inbred zygotes under a depression slide chamber.

  3. Culture zygotes in M16 (Specialty Media) overnight and transfer surviving zygotes into oviducts of 0.5-day postcoitum, pseudopregnant B6×CBA F1 females.

  4. Separate male and female offspring into individual cages at 3 weeks after birth.

  5. Backcross offspring into the FVB/N background to assess the percentage/efficiency of the repair through germline transmission. See Note 3

3.6. Detection of Gene Correction or Disruption

3.6.1. Purification of the Gene-Edited PCR Fragments

  1. To identify CRISPR/Cas9-mediated gene correction or disruption in the Pde6brd1 locus, isolate DNA by performing tail clipping per institutional guidelines.

  2. Following the manufacturer’s instructions, use the blood and tissue kit to isolate genomic DNA from the samples.

  3. Amplify extracted DNA by PCR under the following conditions using gene-specific primers (Table 3):
    Ingredients Quantity (per reaction, μL) Final
    Tail DNA x 10 ng
    Forward primer (10 μM) 1 0.2 μM
    Reverse primer (10 μM) 1 0.2 μM
    5× HF buffer 10 1×
    dNTP (2.5 mM) 4 200 μM
    Phusion high-fidelity DNA polymerase 0.5
    DMSO 1.5
    ddH2O To 50
    Total 50
    Open in a new tab
  4. Perform the PCR cycles as follows:
    Cycle Number Denature Anneal Extend
    1 98 °C, 5 min
    2–36 98 °C, 5 s 63 °C, 8 s 72 °C, 20 s
    37 72 °C, 3 min
    Open in a new tab

  5. Following the manufacturer’s instructions, use the PCR purification kit to purify the PCR products.

3.6.2. (Option A)

To identify homology-directed repair (HDR) events with additional restriction enzyme sites (RFLP assay):

  1. Digest the PCR products with the corresponding enzyme (in this case, we used NdeI). Incubate at 37 °C, 1 h.

  2. Run the digested samples on a gel (1.5% wt/vol agarose gel with TBE buffer).

  3. Verify the donor-targeted allele. There should be two smaller fragments cleaved upon enzyme treatment. In our example, the targeted one would be cleaved into ∼340 and 500 bp fragments, while the untargeted one would be intact, with a size of 845 bp.

3.6.3. (Option B)

To identify nonhomologous end joining (NHEJ) events, analyze PCR products using the Surveyor® Mutation Detection Kit according to the manufacturer’s instructions, here briefly:

  1. Denature and reanneal the PCR products by using the following conditions: 95 °C for 10 min, then 95 °C ramp down to 25 °C at 5 °C per min.

  2. Create the SURVEYOR nuclease S digestion mixture:
    Ingredients Quantity (per reaction, μL) Final
    Annealed heteroduplex X 200–400 ng
    SURVEYOR nuclease S 1
    SURVEYOR enhancer S 1
    MgCl2 solution supplied with kit, 0.15 M 0.1×
    Total Y (10–40)
    Open in a new tab

  3. Mix thoroughly and incubate at 42 °C for 1 h.

  4. Add 0.1Y μL of Stop solution from the kit.

  5. Run the digested samples on a gel (1.5% wt/vol agarose gel with TBE buffer).

  6. Verify the NHEJ events by detecting two smaller fragments cleaved upon enzyme treatment.

3.6.4. (Option C)

To identify the detailed sequence change and calculate the percentage of HDR/NHEJ events after Cas9/sgRNA treatment, subclone PCR products by using the Zero Blunt® TOPO® PCR Cloning Kit:

  1. Prepare TOPO cloning reaction:
    Ingredients Quantity (per reaction, μL)
    PCR product 0.5–4
    Salt solution 1
    H2O 0–3.5
    TOPO vector 1
    Total 6
    Open in a new tab

  2. Mix gently and incubate at room temperature for 5 min.

  3. Transform into competent E. coli according to the protocol accompanying the cells.

  4. Spread each transformation on a LB agar plate with ampicillin (100 μg/mL). Incubate at 37 °C overnight.

  5. Pick >16 colonies from each plate and inoculate into 3 mL of LB medium with 100 μg/mL of ampicillin. Incubate at 37 °C and shake overnight.

  6. Following the manufacturer’s instructions, purify the plasmids by using the spin miniprep kit.

  7. Usethe M13forwardprimer(5′-GTAAAACGACGGCCAG-3′) or M13 reverse primer (5′-CAGGAAACAGCTATGAC-3′) for Sanger sequencing.

  8. Calculate the editing efficiency as (no. of modified clones)/ (no. of total clones).

3.7. Electroretinogram Recordings

  1. Dark-adapt mice overnight.

  2. Administer one drop of 1% Tropicamide ophthalmic solution and 2.5% Phenylephrine ophthalmic solution in each eye to dilate. Apply 0.5% Proparacaine hydrochloride ophthalmic solution to numb the cornea. Allow ten minutes to pass.

  3. Use an anesthetic solution (1 mL of 100 mg/mL ketamine and 0.1 mL of 20 mg/mL xylazine in 8.9 mL PBS) at a concentration of 0.1 mL/10 g BW to anesthetize mice via intraperitoneal injection.

  4. Place mouse on a heating pad to maintain body temperature at 37 °C.

  5. Place Burian-Allen bipolar mouse contact lens electrodes on each cornea and apply 2.5% Goniosol Hypromellose Ophthalmic Demulcent Solution.

  6. Place reference electrodes subcutaneously in the anterior scalp between the eyes. Place ground electrodes on the mouse’s back.

  7. Use the Espion ERG Diagnosys equipment to simultaneously obtain recordings from both eyes. For rod and maximal rod and cone responses, use white light pulses of 0.00130 and 3 cd × s/m2 (White-6500K). Be sure to obtain recordings under dim red light illumination, which allows the investigator to observe the experiment while not affecting the test and light stimuli.

  8. Light-adapt mice in the Ganzfeld dome for 10 min.

  9. Use flashes of 30 cd × s/m2 (Xenon) to obtain cone cell recordings and suppress rod responses by using a background illumination of 30 cd/m2 (White-6500K).

3.8. Fundoscopy Imaging

  1. Administer one drop of 1% Tropicamide ophthalmic solution and 2.5% Phenylephrine ophthalmic solution in each eye to dilate. Apply 0.5% Proparacaine Hydrochloride ophthalmic solution to numb the cornea. Allow ten minutes to pass.

  2. Anesthetize mice by intraperitoneal injection of ketamine/xylazine as described above (Subheading 3.7, step 3).

  3. Place mouse on a heating pad to maintain body temperature at 37 °C.

  4. Apply a lubricating ophthalmic gel on the eye not being tested to protect against drying.

  5. Perform fundoscopy imaging procedures using the Spectralis scanning laser confocal ophthalmoscope using a 30° lens.

  6. Perform OCT imaging procedures using Spectralis and the 55° lens.

3.9. Xmv-28 Insertion Verification

  1. Order primers that span the Pde6b and Xmv-28 sequences: primer pair 1 = #10 and #JS610 for the 5′ junction, and primer pair 2 = #80 and #81 for the 3′ junction (Table 3) [2].

  2. Amplify FVB/N genomic DNA with/without CRISPR-editing by PCR under the following conditions using junction-specific primers (Table 3):
    Ingredients Quantity (per reaction, μL) Final
    Genomic DNA template from FVB/N mice (5 ng/μL) 2 10 ng
    Forward primer (10 μM) 1 0.2 μM
    Reverse primer (10 μM) 1 0.2 μM
    5× HF buffer 10 1×
    DMSO 1.5
    Phusion high-fidelity DNA polymerase 0.5 –
    dNTP (2.5 mM) 4 200 μM
    ddH2O 30 –
    Total 50
    Open in a new tab
  3. Perform the PCR cycles as follows:
    Cycle number Denature Anneal Extend
    1 98 °C, 5 min
    2–36 98 °C, 5 s 60 °C, 5 s 72 °C, 90 s
    37 72 °C, 10 min
    Open in a new tab

  4. Confirm presence of insertion by running the PCR product on a gel (0.8% wt/vol agarose gel in TBE buffer). Verify the product size (3.3 kb for 5′ junction and 2.4 kb for 3′ junction, respectively).

4. Notes

  1. Our protocols for CRISPR, sgRNA/template design, ERG acquisition, histology, etc. closely follow that set forth in the following publications, which we highly recommend readers to review [3–6].

  2. When designing the gRNA, a mutation that creates a novel PAM sequence is ideal. This is because if a mutation can create a PAM (ex: AGG), then the wild type form (ex: AGT) is unlikely to be recognized by Cas9 because of the lack of a PAM. In this way, Cas9 is more likely to be specific and only edit the allele with the mutation.

  3. Regarding Subheading 3.5: Zygote injection and generation of mice, the method we have described has been reported by several others to be an effective strategy. Yet, for our experiments, injection of the sgRNA and Cas9 protein did not work efficaciously. We therefore altered our method by injecting 5 ng/μL of plasmid and 1 μM of ssODN in a pronuclear fashion, an alternative that worked well for us and may be considered if the traditional sgRNA + Cas9 injection strategy does not work.

Acknowledgments

The Jonas Children’s Vision Care and Bernard & Shirlee Brown Glaucoma Laboratory are supported by the National Institutes of Health [5P30EY019007, R01EY018213, R01EY024698, R01EY026682, R21AG050437], National Cancer Institute Core [5P30CA013696], the Research to Prevent Blindness (RPB) Physician-Scientist Award, unrestricted funds from RPB, New York, NY, USA. J.D.S. is supported by the RPB medical student fellowship. T.C. is supported by the International Council of Ophthalmology—Retina Research Foundation Helmerich Fellowship, honoring Mr. W.H. Helmerich III. A.G.B. is supported by NIH grants [R01EY026682, R01EY024698, R01NS098590, R01AR059703, and R21AG050437]. V.B.M. is supported by NIH grants [K08EY020530, R01EY024665, R01EY025225, R01EY024698 and R21AG050437] and RPB. S.H.T. is a member of the RD-CURE Consortium and is supported by the Tistou and Charlotte Kerstan Foundation, the Schneeweiss Stem Cell Fund, New York State [C029572], the Foundation Fighting Blindness New York Regional Research Center Grant [C-NY05-0705-0312], the Crowley Family Fund, and the Gebroe Family Foundation.

Footnotes

Disclaimer

While we may reference specific companies, products, and/or brands in this manuscript, these suggestions should serve only as examples. We are not endorsed by, nor do we endorse, any particular company, product, or brand, and there are a variety of options than can be used to achieve the same experimental ends.

References

  • 1.Wu WH, Tsai YT, Justus S et al. (2016) CRISPR repair reveals causative mutation in a preclinical model of retinitis pigmentosa. Mol Ther 24:1388–1394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bowes C, Li T, Frankel WN et al. (1993) Localization of a retroviral element within the rd gene coding for the beta subunit of cGMP phosphodiesterase. Proc Natl Acad Sci U S A 90:2955–2959 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Yang H, Wang H, Jaenisch R (2014) Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc 9:1956–1968 [DOI] [PubMed] [Google Scholar]
  • 4.Ran FA, Hsu PD, Wright J et al. (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8:2281–2308 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Koch SF, Tsai YT, Duong JK et al. (2015) Halting progressive neurodegeneration in advanced retinitis pigmentosa. J Clin Invest 125:3704–3713 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhang L, Du J, Justus S et al. (2016) Reprogramming metabolism by targeting sirtuin 6 attenuates retinal degeneration. J Clin Invest 126:4659–4673 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES