Skip to main content
PMC home page
Journal of Ginseng Research logoLink to Journal of Ginseng Research
. 2022 Feb 24;46(3):489–495. doi: 10.1016/j.jgr.2022.02.004

Korean Red Ginseng saponin fraction exerts anti-inflammatory effects by targeting the NF-κB and AP-1 pathways

Jeong-Oog Lee a, Yanyan Yang b, Yu Tao c,∗∗∗, Young-Su Yi d,∗∗, Jae Youl Cho e,∗
PMCID: PMC9120761  PMID: 35600780

Abstract

Background

Although ginsenosides and saponins in Korea red ginseng (KRG) shows various pharmacological roles, their roles in the inflammatory response are little known. This study investigated the anti-inflammatory role of ginsenosides identified from KRG saponin fraction (RGSF) and the potential mechanism in macrophages.

Methods

The ginsenoside composition of RGSF was identified by high-performance liquid chromatography (HPLC) analysis. An anti-inflammatory effect of RGSF and its mechanisms were studied using nitric oxide (NO) and prostaglandin E2 (PGE2) production assays, mRNA expression analyses of inflammatory genes and cytokines, luciferase reporter gene assays of transcription factors, and Western blot analyses of inflammatory signaling pathways using the lipopolysaccharide (LPS)-treated RAW264.7 cells.

Results

HPLC analysis identified the types and amounts of various panaxadiol ginsenosides in RGSF. RGSF reduced the generation of inflammatory molecules and mRNA levels of inflammatory enzymes and cytokines in LPS-treated RAW264.7 cells. Additionally, RGSF inhibited the signaling pathways of NF-κB and AP-1 by suppressing both transcriptional factors and signaling molecules in LPS-treated RAW264.7 cells.

Conclusion

RGSF contains ginsenosides that have anti-inflammatory action via restraining the NF-κB and AP-1 signaling pathways in macrophages during inflammatory responses.

Keywords: RGSF, Anti-Inflammatory, Macrophage, NF-κB, AP-1

Graphical abstract

Image 1

Open in a new tab

1. Introduction

Inflammation is a protective immune response from infection with harmful pathogens and is a response to danger signals derived from cellular stress [[1], [2], [3]]. However, chronic inflammation, which is repeated inflammation and lasts for months to even years, has been considered a major risk factor of numerous human diseases [[4], [5], [6]]. An inflammatory response is initiated by the interaction of pattern-recognition receptors (PRRs) with the various molecular patterns associated with pathogens and danger signals [[7], [8], [9]]. The initiation of inflammatory response activates signal transduction pathways, such as nuclear factor-kappa B (NF-κB), activated protein-1 (AP-1), and interferon regulatory factors (IRFs) by stimulating the signaling cascades of various intracellular inflammatory molecules. These events result in the generation of inflammatory molecules and transcriptional up-regulation of pro-inflammatory enzymes and cytokines [[10], [11], [12], [13]].

Korean ginseng (Panax ginseng Meyer), cultivated in far-east Asia, is traditional herbal medicine and has been reported to play an ameliorative role in numerous human diseases [[14], [15], [16], [17], [18]]. Fresh ginseng has high moisture content and decays easily; therefore, it is necessary to produce red ginseng by repeating steaming and drying several times. Interestingly, compared to fresh ginger, Korean red ginseng (KRG) shows higher chemical content and biological activity with fewer adverse effects [19]. KRG improves essential biological functions, such as immune response, energy induction, sexual functions, memory, cognitive functions, and offers antioxidant activity [[20], [21], [22], [23], [24], [25]]. KRG was also reported to have anti-inflammatory activities by alleviating the inflammatory response [16,[26], [27], [28], [29], [30], [31]]; however, the KRG components that show anti-inflammatory activities and the potential mechanism that manifests these activities are still unclear.

Therefore, this study prepared the ginsenoside composition of the KRG saponin fraction (RGSF) and investigated the anti-inflammatory role of RGSF as well as the potential mechanism in lipopolysaccharide (LPS)-activated macrophage, RAW264.7 cells.

2. Materials and methods

2.1. Materials

RGSF was kindly supplied from the Korea Ginseng Cooperation (Daejeon, Korea). RAW264.7 and HEK293 cells were purchased at the American Type Culture Collection (Manassas, VA, USA). Roswell Park Memorial Institute 1640 (RPMI 1640) medium, fetal bovine serum (FBS), phosphate-buffered saline (PBS), streptomycin, and penicillin were purchased at Gibco (Grand Island, NY, USA). Lipopolysaccharide (LPS), crystal violet, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), luciferin, and polyethyleneimine (PEI) were purchased at Sigma Aldrich (St Louis, MO, USA). PCR primers were synthesized at Bioneer Inc. (Daejeon, Korea). Real-time PCR dye was purchased at PCR Biosystems (London, United Kingdom). TRI reagent® was purchased at Molecular Research Center Inc. (Cincinnati, OH, USA). MuLV reverse transcriptase and Lipofectamine® 2000 reagent were purchased at Thermo Fisher Scientific (Waltham, MA, USA). NF-κB-Luc, AP-1-Luc, CREB-Luc, and TRIF-expressing constructs were purchased at Addgene (Cambridge, MA, USA). Antibodies for Western blot analysis were purchased at Cell Signaling Technology (Beverly, MA, USA) and Santa Cruz Biotechnology (Dallas, Texas, USA). An enhanced chemiluminescence system was purchased at AbFrontier (Seoul, Korea).

2.2. Cell culture

RAW264.7 and HEK293 cells were incubated in RPMI 1640 medium that contains 10% heat-inactivated FBS and penicillin/streptomycin at 37 °C in a 5% CO2 incubator. The cells were freshly maintained by splitting them three times per week.

2.3. Cell viability assay

The cytotoxicity of RGSF was quantified by an MTT method as previously described [32]. In brief, RAW264.7 cells were incubated with various doses of RGSF for 24 h, and the numbers of live cells were quantified and compared by an MTT assay.

2.4. NO production assay

RAW264.7 cells incubated with various doses of RGSF or prednisolone (Pred) for 30 min were activated with LPS (1 μg/mL) for 24 h, after which NO amount in culture medium was quantified by a Griess assay as previously described [33].

2.5. PGE2 production assay

RAW264.7 cells incubated with various doses of RGSF for 30 min were activated with LPS (1 μg/mL) for 24 h, after which PGE2 amount in culture medium was quantified by an enzyme immunoassay as described previously [34].

2.6. Quantitative real-time polymerase chain reaction (PCR)

RAW264.7 cells incubated with various doses of RGSF for 30 min were activated with LPS (1 μg/mL) for 6 h, after which total RNA was extracted using TRI reagent®. cDNA was immediately synthesized from the extracted RNA using a MuLV reverse transcriptase, and mRNA of iNOS, TNF-α, COX-2, and IL-1β were quantified by a quantitative real-time polymerase chain reaction (PCR) using primers specific for each target. The information of primers is summarized in Table 1.

Table 1.

The information of primers used in this study for quantitative real-time PCR.

Target Sequence (5′–3′)
iNOS F CCCTTCCGAAGTTTCTGGCAGCAG
R GGCTGTCAGAGCCTCGTGGCTTTGG
TNF-α F TTGACCTCAGCGCTGAGTTG
R CCTGTAGCCCACGTCGTAGC
COX2 F CACTACATCCTGACCCACTT
R ATGCTCCTGCTTGAGTATGT
IL-1β F TAGAGCTGCTGGCCTTGTTA
R ACCTGTAAAGGCTTCTCGGA
GAPDH F CAATGAATACGGCTACAGCAAC
R AGGGAGATGCTCAGTGTTGG
Open in a new tab

2.7. Luciferase reporter gene assay

RAW264.7 cells incubated with various doses of RGSF and LPS (1 μg/mL) were transfected with either an NF-κB-Luc, AP-1-Luc, or CREB-Luc construct along with a β-gal construct using Lipofectamine® 2000 reagent 48 h. HEK293 cells transfected with an AP-1-Luc construct along with a β-gal construct using PEI for 24 h were treated with various doses of RGSF for another 24 h. AP-1-Luc reporter activity was quantified by incubating luciferin with cell lysates.

2.8. Western blot analysis

RAW264.7 cells incubated with RGSF (100 μg/mL) for 30 min were activated with LPS (1 μg/mL), and nuclear as well as whole-cell lysates were prepared as previously described [33]. Western blot analysis was conducted as previously described [33] with the antibodies specific for each target.

2.9. High-performance liquid chromatography analysis

Types and amounts of ginsenosides in RGSF were analyzed by high-performance liquid chromatography (HPLC) as previously described [35].

2.10. Statistical analysis

All data were described as the mean ± standard error of the mean (SEM) of independent experiments performed more than three times. Statistical significance between the control versus experimental groups was evaluated by either a Mann-Whitney test or one-way ANOVA. P values less than 0.05 were considered statistically significant.

3. Results and discussion

In this study, ginsenoside components were identified in RGSF, and anti-inflammatory role of RGSF was evaluated in LPS-activated macrophage, RAW264.7 cells. The types and amounts of panaxdiol ginsenosides in RGSF were first determined by HPLC analysis; the panaxdiol ginsenosides (Gs) G-Rg1, G-Re, G-Rf, G-Rb1, G-Rc, G-Rb2, G-Rb3, G-Rd, G-F2, and G-Rg3 were identified (data not shown), as reported previously [36,37]. The total amount of these ginsenosides was 520.6 mg/g, and the amount of each ginsenoside is summarized in Supplementary Table 1. Among the identified ginsenosides, the amount of G-Rb1 was the highest (158.0 mg/g), followed by G-Rc (107.6 mg/g) and G-Rb2 (80.0 mg/g). Numerous previous studies have demonstrated an anti-inflammatory role of G-Rb1 [15,38,39], G-Rc [37,40], and G-Rb2 [15,37,40], strongly indicating that RGSF may also have anti-inflammatory effect.

Therefore, the anti-inflammatory effects of RGSF and its underlying molecular mechanism were examined in LPS-activated RAW264.7 cells. Pharmacological agents are useless if they exhibit cytotoxicity or adverse effects. Therefore, RGSF cytotoxicity was tested in macrophages, and RGSF exerted no cytotoxicity in RAW264.7 at any of the test doses (Fig. 1A), indicating that it confers no cytotoxicity at the doses tested in this study. Anti-inflammatory effect of RGSF was nest investigated in LPS-activated RAW264.7 cells. RGSF decreased NO and PGE2 production (Fig. 1B) and also down-regulated mRNA levels of pro-inflammatory enzymes, such as iNOS and COX-2 as well as cytokines, such as TNF-α and IL-1β in LPS-activated RAW264.7 cells (Fig. 1C). Meanwhile, prednisolone showed significant suppression of NO production as previously reported [41], implying that the experimental condition of this study is properly established. Given the results, ginsenosides in RGSF exert a strong anti-inflammatory role by reducing inflammatory mediator production and the mRNA levels of pro-inflammatory enzymes and cytokines in macrophages.

Fig. 1.

Fig. 1

Open in a new tab

Suppressive role of RGSF on inflammatory mediator production and mRNA levels of pro-inflammatory enzymes and cytokines (A) RAW264.7 cells were incubated with RGSF (0–100 μg/mL) for 24 h, and viable cells were quantified by an MTT assay. (B and D) RAW264.7 cells incubated with RGSF (0–100 μg/mL) or Pred (0–400 μM) for 30 min were stimulated with LPS (1 μg/mL) for 24 h, and NO and PGE2 in culture medium were quantified by a Griess assay and enzyme immunoassay, respectively. (C) RAW264.7 cells incubated with RGSF (0–100 μg/mL) for 30 min were stimulated with LPS (1 μg/mL) for 6 h, and mRNA levels of iNOS, TNF-α, COX-2, and IL-1β were quantified by quantitative real-time PCR. ∗P < 0.05 and ∗∗P < 0.01 compared to the control.

An inflammatory response is induced by activating intracellular signal transduction pathways of NF-κB, AP-1, and CREB in macrophages, therefore, inhibitory role of RGSF in the activation of these inflammatory signal transduction pathways was evaluated in the LPS-activated RAW264.7 cells. Inhibitory effect of RGSF on the luciferase reporter gene activity induced by NF-κB, AP-1, and CREB transcription factors was evaluated in LPS-activated RAW264.7 cells as well as TRIF-transfected HEK293 cells. RGSF markedly reduced AP-1-Luc reporter activity at 50 and 100 μg/mL and marginally reduced NF-κB-Luc reporter activity at 100 μg/mL in the LPS-activated RAW264.7 cells (Fig. 2A). However, RGSF showed no suppressive effect on CREB-Luc reporter activity at all doses (25, 50 and 100 μg/mL) (Fig. 2A). Inhibitory effect of RGSF on AP-1-Luc reporter activity was further confirmed in the TRIF-transfected HEK293 cells, since TRIF is an intracellular adaptor that leads to activation of the AP-1 signaling pathway [42]. RGSF significantly suppressed AP-1 luciferase reporter gene activity at all doses in TRIF-transfected HEK293 cells (Fig. 2B). Inflammatory signaling is activated by the translocation of transcription factors into the nucleus of macrophages [10,12,13], illustrating the suppressive effect of RGSF on nuclear translocation of these transcription factors in LPS-activated RAW264.7 cells. RGSF (100 μg/mL) markedly suppressed AP-1 nuclear translocation, such as c-Jun (30 and 60 min), c-Fos (60 min) (Fig. 2C), and p-ATF2 (15 and 30 min) (Fig. 2D), but not p-Fra1 (Fig. 2C), in LPS-activated RAW264.7 cells. Additionally, RGSF (100 μg/mL) also suppressed NF-κB nuclear translocation, such as p65 (15 min), but not that of p50, in LPS-activated RAW264.7 cells (Fig. 2E). Given the results, RGSF exerts an anti-inflammatory effect via suppressing NF-κB and AP-1 transcription factors during macrophage-mediated inflammatory response.

Fig. 2.

Fig. 2

Open in a new tab

Suppressive role of RGSF on NF-κB, CREB, and AP-1 transcriptional activities (A) RAW264.7 cells co-transfected with NF-κB-Luc, AP-1-Luc, or CREB-Luc along with a β-gal were incubated with RGSF (0, 25, 50, and 100 μg/mL) and LPS (1 μg/mL), and luciferase reporter activity was quantified. (B) HEK293 cells co-transfected with TRIF (1 μg/mL) and AP-1-Luc along with a β-gal were incubated with RGSF (0–100 μg/mL), and AP-1-Luc reporter activity was quantified. (C–E) RAW264.7 cells 0–100 μg/mL with RGSF (100 μg/mL) for 30 min were stimulated with LPS (1 μg/mL). Western blot analysis of phosphorylated and total forms of c-Jun, c-Fos, Fra1, Lamin A/C (C), ATF2 (D), and p65 (E) and p50. ∗P < 0.05 and ∗∗P < 0.01 compared to the controls.

Many cytosolic molecules, such as kinases, mitogen-activated protein kinases (MAPKs), and MAPK kinases (MAPKKs) in NF-κB and AP-1 pathways are activated through phosphorylation in macrophages during inflammatory response [10,12,13]. Since RGSF suppressed NF-κB and AP-1 activation in macrophages during inflammatory response, the suppressive effect of RGSF extends to activation of inflammatory molecules stimulating NF-κB and AP-1 transcription factors in LPS-activated RAW264.7 cells. RGSF (100 μg/mL) inhibited phosphorylation of MAPKs, such as ERK (15, 30, and 60 min) and p38 (5, 15, and 30 min), but not JNK in LPS-activated RAW264.7 cells (Fig. 3A). Inhibitory effect of RGSF on MAPKKs activation was further evaluated in LPS-activated RAW264.7 cells, and RGSF (100 μg/mL) was found to inhibit the phosphorylation of MKK3/6 (10 min) and MEK1/2 (10 min), but not MKK4/7 (Fig. 3B). In addition, the inhibitory effect of RGSF on activation of inflammatory molecules in NF-κB signaling pathway was evaluated in LPS-activated RAW264.7 cells, and RGSF (100 μg/mL) increased phosphorylation-induced breakdown of IκBα (5, 15, 30, and 60 min) (Fig. 3C). Furthermore, suppressive effect of RGSF on activation of IκBα-upstream inflammatory molecules was also evaluated in LPS-activated RAW264.7 cells, and RGSF (100 μg/mL) inhibited the phosphorylation of IKKα/β (5 and 15 min), but not that of PDK1 or p85 (Fig. 3D), as seen in the previous papers [36,43]. Given the results, RGSF exhibits its anti-inflammatory activity by restraining activation of intracellular inflammatory molecules in AP-1 and NF-κB pathways, such as ERK, p38, MKK3/6, MEK1/2, IκBα, and IKKα/β in macrophages.

Fig. 3.

Fig. 3

Open in a new tab

Suppressive effect of RGSF on NF-κB and AP-1 signaling pathways. (A, B, C, and D) RAW264.7 cells incubated with RGSF (100 μg/mL) for 30 min were stimulated with LPS (1 μg/mL). Western blot analysis of phosphorylated and total forms of ERK, p38, and JNK (A), MKK3/6, MKK4/7, MEK1/2 (B), and β-actin, IκBα (C), and IKKα/β, AKT, PDK1, p85 (D), and β-actin.

In conclusion, this study identified ginsenosides in RGSF and demonstrated the anti-inflammatory role of RGSF in LPS-activated macrophages. RGSF contained various panaxadiol ginsenosides, including Rg1, Re, Rf, Rb1, Rc, Rb2, Rb3, Rd, F2, and Rg3 that have anti-inflammatory effects. RGSF exerted anti-inflammatory effects without any cytotoxicity by reducing inflammatory mediator production and mRNA levels of pro-inflammatory enzymes and cytokines, which was accomplished by suppressing activation of AP-1 and NF-κB inflammatory signaling pathways during macrophage-mediated inflammatory responses (Fig. 4). Taken together, the findings of this study could increase the knowledge of the anti-inflammatory effects mediated by KRG at a molecular level and also provide insight into the use of KRG when developing anti-inflammatory treatments that prevent and treat human inflammatory diseases.

Fig. 4.

Fig. 4

Open in a new tab

Schematic summary of the RGSF-mediated anti-inflammatory effect in macrophages stimulated by LPS.

Declaration of competing interest

The authors have no conflicts of interest to declare.

Acknowledgments

This paper was supported by Konkuk University, Republic of Korea, in 2020.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.jgr.2022.02.004.

Contributor Information

Jeong-Oog Lee, Email: ljo7@konkuk.ac.kr.

Yanyan Yang, Email: yangyy1201@qdu.edu.cn.

Yu Tao, Email: yutao0112@qdu.edu.cn.

Young-Su Yi, Email: ysyi@kgu.ac.kr.

Jae Youl Cho, Email: jaecho@skku.edu.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Multimedia component 1
mmc1.docx (13.7KB, docx)

References

  • 1.Janeway C.A., Jr., Medzhitov R. Innate immune recognition. Annu Rev Immunol. 2002;20:197–216. doi: 10.1146/annurev.immunol.20.083001.084359. [DOI] [PubMed] [Google Scholar]
  • 2.Yi Y.S. Folate receptor-targeted diagnostics and therapeutics for inflammatory diseases. Immune Netw. 2016;16:337–343. doi: 10.4110/in.2016.16.6.337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Takeuchi O., Akira S. Pattern recognition receptors and inflammation. Cell. 2010;140:805–820. doi: 10.1016/j.cell.2010.01.022. [DOI] [PubMed] [Google Scholar]
  • 4.Straub R.H., Schradin C. Chronic inflammatory systemic diseases: an evolutionary trade-off between acutely beneficial but chronically harmful programs. Evol Med Public Health. 2016;2016:37–51. doi: 10.1093/emph/eow001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Liu C.H., Abrams N.D., Carrick D.M., Chander P., Dwyer J., Hamlet M.R.J., Macchiarini F., PrabhuDas M., Shen G.L., Tandon P., Vedamony M.M. Biomarkers of chronic inflammation in disease development and prevention: challenges and opportunities. Nat Immunol. 2017;18:1175–1180. doi: 10.1038/ni.3828. [DOI] [PubMed] [Google Scholar]
  • 6.Ratan Z.A., Youn S.H., Kwak Y.S., Han C.K., Haidere M.F., Kim J.K., Min H., Jung Y.J., Hosseinzadeh H., Hyun S.H., Cho J.Y. Adaptogenic effects of Panax ginseng on modulation of immune functions. J Ginseng Res. 2021;45:32–40. doi: 10.1016/j.jgr.2020.09.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Broz P., Dixit V.M. Inflammasomes: mechanism of assembly, regulation and signalling. Nat Rev Immunol. 2016;16:407–420. doi: 10.1038/nri.2016.58. [DOI] [PubMed] [Google Scholar]
  • 8.Yi Y.S. Caspase-11 non-canonical inflammasome: a critical sensor of intracellular lipopolysaccharide in macrophage-mediated inflammatory responses. Immunology. 2017;152:207–217. doi: 10.1111/imm.12787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yi Y.S. Role of inflammasomes in inflammatory autoimmune rheumatic diseases. KOREAN J PHYSIOL PHARMACOL. 2018;22:1–15. doi: 10.4196/kjpp.2018.22.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yi Y.S., Son Y.J., Ryou C., Sung G.H., Kim J.H., Cho J.Y. Functional roles of Syk in macrophage-mediated inflammatory responses. Mediat Inflamm. 2014;2014:270302. doi: 10.1155/2014/270302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yang Y., Kim S.C., Yu T., Yi Y.S., Rhee M.H., Sung G.H., Yoo B.C., Cho J.Y. Functional roles of p38 mitogen-activated protein kinase in macrophage-mediated inflammatory responses. Mediat Inflamm. 2014;2014:352371. doi: 10.1155/2014/352371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Yu T., Yi Y.S., Yang Y., Oh J., Jeong D., Cho J.Y. The pivotal role of TBK1 in inflammatory responses mediated by macrophages. Mediat Inflamm. 2012;2012:979105. doi: 10.1155/2012/979105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Byeon S.E., Yi Y.S., Oh J., Yoo B.C., Hong S., Cho J.Y. The role of Src kinase in macrophage-mediated inflammatory responses. Mediat Inflamm. 2012;2012:512926. doi: 10.1155/2012/512926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kim J.H. Pharmacological and medical applications of Panax ginseng and ginsenosides: a review for use in cardiovascular diseases. J Ginseng Res. 2018;42:264–269. doi: 10.1016/j.jgr.2017.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kim J.H., Yi Y.S., Kim M.Y., Cho J.Y. Role of ginsenosides, the main active components of Panax ginseng, in inflammatory responses and diseases. J Ginseng Res. 2017;41:435–443. doi: 10.1016/j.jgr.2016.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Baek K.S., Yi Y.S., Son Y.J., Yoo S., Sung N.Y., Kim Y., Hong S., Aravinthan A., Kim J.H., Cho J.Y. In vitro and in vivo anti-inflammatory activities of Korean Red Ginseng-derived components. J Ginseng Res. 2016;40:437–444. doi: 10.1016/j.jgr.2016.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ahuja A., Kim J.H., Yi Y.S., Cho J.Y. Functional role of ginseng-derived compounds in cancer. J Ginseng Res. 2018;42:248–254. doi: 10.1016/j.jgr.2017.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yi Y.S. Ameliorative effects of ginseng and ginsenosides on rheumatic diseases. J Ginseng Res. 2019;43:335–341. doi: 10.1016/j.jgr.2018.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lee S.M., Bae B.S., Park H.W., Ahn N.G., Cho B.G., Cho Y.L., Kwak Y.S. Characterization of Korean red ginseng (Panax ginseng meyer): history, preparation method, and chemical composition. J Ginseng Res. 2015;39:384–391. doi: 10.1016/j.jgr.2015.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang D., Yasuda T., Yu Y., Zheng P., Kawabata T., Ma Y., Okada S. Ginseng extract scavenges hydroxyl radical and protects unsaturated fatty acids from decomposition caused by iron-mediated lipid peroxidation. Free Radic Biol Med. 1996;20:145–150. doi: 10.1016/0891-5849(95)02020-9. [DOI] [PubMed] [Google Scholar]
  • 21.Heo J.H., Park M.H., Lee J.H. Effect of Korean Red Ginseng on cognitive function and quantitative EEG in patients with Alzheimer's disease: a preliminary study. J Alternative Compl Med. 2016;22:280–285. doi: 10.1089/acm.2015.0265. [DOI] [PubMed] [Google Scholar]
  • 22.Chung H.S., Hwang I., Oh K.J., Lee M.N., Park K. The Effect of Korean Red Ginseng on sexual function in premenopausal women: placebo-controlled, double-blind, crossover clinical trial. Evid Based Complement Alternat Med. 2015;2015:913158. doi: 10.1155/2015/913158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Jovanovski E., Peeva V., Sievenpiper J.L., Jenkins A.L., Desouza L., Rahelic D., Sung M.K., Vuksan V. Modulation of endothelial function by Korean red ginseng (Panax ginseng C.A. Meyer) and its components in healthy individuals: a randomized controlled trial. Cardiovasc Ther. 2014;32:163–169. doi: 10.1111/1755-5922.12077. [DOI] [PubMed] [Google Scholar]
  • 24.Lee J.W., Mo E.J., Choi J.E., Jo Y.H., Jang H., Jeong J.Y., Jin Q., Chung H.N., Hwang B.Y., Lee M.K. Effect of Korean Red Ginseng extraction conditions on antioxidant activity, extraction yield, and ginsenoside Rg1 and phenolic content: optimization using response surface methodology. J Ginseng Res. 2016;40:229–236. doi: 10.1016/j.jgr.2015.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jin S.H., Park J.K., Nam K.Y., Park S.N., Jung N.P. Korean red ginseng saponins with low ratios of protopanaxadiol and protopanaxatriol saponin improve scopolamine-induced learning disability and spatial working memory in mice. J Ethnopharmacol. 1999;66:123–129. doi: 10.1016/s0378-8741(98)00190-1. [DOI] [PubMed] [Google Scholar]
  • 26.Vinh L.B., Lee Y., Han Y.K., Kang J.S., Park J.U., Kim Y.R., Yang S.Y., Kim Y.H. Two new dammarane-type triterpene saponins from Korean red ginseng and their anti-inflammatory effects. Bioorg Med Chem Lett. 2017;27:5149–5153. doi: 10.1016/j.bmcl.2017.10.058. [DOI] [PubMed] [Google Scholar]
  • 27.Lee J.S., Choi H.S., Kang S.W., Chung J.H., Park H.K., Ban J.Y., Kwon O.Y., Hong H.P., Ko Y.G. Therapeutic effect of Korean red ginseng on inflammatory cytokines in rats with focal cerebral ischemia/reperfusion injury. Am J Chin Med. 2011;39:83–94. doi: 10.1142/S0192415X1100866X. [DOI] [PubMed] [Google Scholar]
  • 28.Yu T., Rhee M.H., Lee J., Kim S.H., Yang Y., Kim H.G., Kim Y., Kim C., Kwak Y.S., Kim J.H., Cho J.Y. Ginsenoside Rc from Korean Red Ginseng (Panax ginseng C.A. Meyer) attenuates inflammatory symptoms of gastritis, hepatitis and arthritis. Am J Chin Med. 2016;44:595–615. doi: 10.1142/S0192415X16500336. [DOI] [PubMed] [Google Scholar]
  • 29.Lee H.J., Cho S.H. Therapeutic Effects of Korean Red Ginseng extract in a murine model of atopic dermatitis: anti-pruritic and anti-inflammatory mechanism. J Kor Med Sci. 2017;32:679–687. doi: 10.3346/jkms.2017.32.4.679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yi Y.S. Roles of ginsenosides in inflammasome activation. J Ginseng Res. 2019;43:172–178. doi: 10.1016/j.jgr.2017.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yi Y.S. New mechanisms of ginseng saponin-mediated anti-inflammatory action via targeting canonical inflammasome signaling pathways. J Ethnopharmacol. 2021;278:114292. doi: 10.1016/j.jep.2021.114292. [DOI] [PubMed] [Google Scholar]
  • 32.Jeong D., Lee J., Jeong S.G., Hong Y.H., Yoo S., Han S.Y., Kim J.H., Kim S., Kim J.S., Chung Y.S., Yi Y.S., Cho J.Y. Artemisia asiatica ethanol extract exhibits anti-photoaging activity. J Ethnopharmacol. 2018;220:57–66. doi: 10.1016/j.jep.2018.03.037. [DOI] [PubMed] [Google Scholar]
  • 33.Kim H.G., Choi S., Lee J., Hong Y.H., Jeong D., Yoon K., Yoon D.H., Sung G.H., Lee S., Hong S., Yi Y.S., Kim J.H., Cho J.Y. Src is a prime target inhibited by Celtis choseniana methanol extract in its anti-inflammatory action. Evid Based Complement Alternat Med. 2018;2018:3909038. doi: 10.1155/2018/3909038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Cho J.Y., Baik K.U., Jung J.H., Park M.H. In vitro anti-inflammatory effects of cynaropicrin, a sesquiterpene lactone, from Saussurea lappa. Eur J Pharmacol. 2000;398:399–407. doi: 10.1016/s0014-2999(00)00337-x. [DOI] [PubMed] [Google Scholar]
  • 35.Wang H.P., Zhang Y.B., Yang X.W., Zhao D.Q., Wang Y.P. Rapid characterization of ginsenosides in the roots and rhizomes of Panax ginseng by UPLC-DAD-QTOF-MS/MS and simultaneous determination of 19 ginsenosides by HPLC-ESI-MS. J Ginseng Res. 2016;40:382–394. doi: 10.1016/j.jgr.2015.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yayeh T., Jung K.H., Jeong H.Y., Park J.H., Song Y.B., Kwak Y.S., Kang H.S., Cho J.Y., Oh J.W., Kim S.K., Rhee M.H. Korean Red Ginseng saponin fraction downregulates proinflammatory mediators in LPS stimulated RAW264.7 cells and protects mice against endotoxic shock. J Ginseng Res. 2012;36:263–269. doi: 10.5142/jgr.2012.36.3.263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Endale M., Im E.J., Lee J.Y., Kim S.D., Yayeh T., Song Y.B., Kwak Y.S., Kim C., Kim S.H., Roh S.S., Cho J.Y., Rhee M.H. Korean red ginseng saponin fraction rich in ginsenoside-Rb1, Rc and Rb2 attenuates the severity of mouse collagen-induced arthritis. Mediat Inflamm. 2014;2014:748964. doi: 10.1155/2014/748964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Yu S., Zhou X., Li F., Xu C., Zheng F., Li J., Zhao H., Dai Y., Liu S., Feng Y. Microbial transformation of ginsenoside Rb1, Re and Rg1 and its contribution to the improved anti-inflammatory activity of ginseng. Sci Rep. 2017;7:138. doi: 10.1038/s41598-017-00262-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zhou P., Lu S., Luo Y., Wang S., Yang K., Zhai Y., Sun G., Sun X. Attenuation of TNF-alpha-induced inflammatory injury in endothelial cells by ginsenoside Rb1 via inhibiting NF-kappaB, JNK and p38 signaling pathways. Front Pharmacol. 2017;8:464. doi: 10.3389/fphar.2017.00464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yu T., Yang Y., Kwak Y.S., Song G.G., Kim M.Y., Rhee M.H., Cho J.Y. Ginsenoside Rc from Panax ginseng exerts anti-inflammatory activity by targeting TANK-binding kinase 1/interferon regulatory factor-3 and p38/ATF-2. J Ginseng Res. 2017;41:127–133. doi: 10.1016/j.jgr.2016.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Song C., Hong Y.H., Park J.G., Kim H.G., Jeong D., Oh J., Sung G.H., Hossain M.A., Taamalli A., Kim J.H., Kim J.H., Cho J.Y. Suppression of Src and Syk in the NF-kappaB signaling pathway by Olea europaea methanol extract is leading to its anti-inflammatory effects. J Ethnopharmacol. 2019;235:38–46. doi: 10.1016/j.jep.2019.01.024. [DOI] [PubMed] [Google Scholar]
  • 42.Han S.Y., Yi Y.S., Jeong S.G., Hong Y.H., Choi K.J., Hossain M.A., Hwang H., Rho H.S., Lee J., Kim J.H., Cho J.Y. Ethanol extract of Lilium bulbs plays an anti-inflammatory role by targeting the IKKalpha/beta-Mediated NF-kappaB pathway in macrophages. Am J Chin Med. 2018;46:1281–1296. doi: 10.1142/S0192415X18500672. [DOI] [PubMed] [Google Scholar]
  • 43.Xue Q., He N., Wang Z., Fu X., Aung L.H.H., Liu Y., Li M., Cho J.Y., Yang Y., Yu T. Functional roles and mechanisms of ginsenosides from Panax ginseng in atherosclerosis. J Ginseng Res. 2021;45:22–31. doi: 10.1016/j.jgr.2020.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (13.7KB, docx)

Articles from Journal of Ginseng Research are provided here courtesy of Elsevier

RESOURCES