Abstract
The various fibroblast growth factors (FGF) regulate their function via binding to four main FGF receptor (FGFR) subtypes and their splice variants, FGFR1b, FGF1c, FGFR2b, FGFR2c and FGFR3c and FGFR4, but which of these FGFR are expressed in the granulosa (GC) and theca cells (TC), the two main cell layers of ovarian follicles, or change during follicular development is unknown. We hypothesized that FGFR1c, FGFR2c and FGFR3c (but not FGFR4) gene expression in GC (but not TC) would change with follicular development. Hence, the objective of this study was to determine if abundance of FGFR1c, FGFR2c, FGFR3c, and FGFR4 mRNA change according to follicular size, steroidogenic status, and days post-ovulation during growth of first-wave dominant follicles in Holstein cattle exhibiting regular estrous cycles. Estrous cycles of non-lactating dairy cattle were synchronized, and ovaries were collected on either day 3 to 4 (n = 8) or day 5 to 6 (n = 8) post-ovulation for GC and TC RNA extraction from small (1 to 5 mm), medium (5.1 to 8 mm) or large (8.1 to 18 mm) follicles for real-time PCR analysis. In GC, FGFR1c and FGFR2c mRNA relative abundance was greater in estrogen (E2)-inactive (i.e., concentrations of E2 < progesterone, P4) follicles of all sizes than in GC from large E2-active follicles (i.e., E2 > P4), whereas FGFR3c and FGFR4 mRNA abundance did not significantly differ among follicle types or days post-estrus. In TC, medium E2-inactive follicles had greater FGFR1c and FGFR4 mRNA abundance than large E2-active and E2–inactive follicles on day 5 to 6 post-ovulation whereas FGFR2c and FGFR3c mRNA abundance did not significantly differ among follicle types or day post-estrus. In vitro experiments revealed that androstenedione increased abundance of FGFR1c, FGFR2c and FGFR4 mRNA in GC whereas estradiol decreased FGFR2c mRNA abundance. Neither androstenedione nor estradiol affected abundance of the various FGFR mRNAs in cultured TC. Taken together, the findings that FGFR1c and FGFR2c mRNA abundance was less in GC of E2-active follicles and FGFR1c and FGFR4 mRNA was greater in TC of medium inactive follicles at late than at early growing phase of the first dominant follicle support an anti-differentiation role for FGF and their FGFR as well as support the idea that steroid-induced changes in FGF and their receptors may regulate selection of dominant follicles in cattle.
Keywords: Fibroblast growth factor receptors (FGFR), follicle growth, theca cell, granulosa cell, cattle
1. Introduction
Ovarian folliculogenesis is a tightly regulated process where the somatic cells of the follicle, granulosa (GC) and theca (TC) cells, communicate in a coordinated way with the oocyte for both follicular and oocyte growth and maturation [1, 2, 3]. Several fibroblast growth factors (FGF) have been implicated as important regulators of ovarian function, playing autocrine, paracrine, and endocrine roles in the regulation of development of ovarian follicles [for reviews, see 4, 5]. These polypeptides belong to a family of 22 members in mammals [6, 7], and, to date, ten members have been detected in the ovary: FGF1, 2, 7–10, 16–18, 22 [4, 5, 8]. In cattle, these FGF play diverse roles in ovarian function and in order for FGF to exert their actions in the ovary, they need to bind to high affinity receptors (FGFR). The FGFR is a single chain transmembrane tyrosine kinase with two or three immunoglobulin-like domains and a heparin-binding domain in the extracellular ligand-binding portion [9, 10, 11]. There are four distinct genes encoding for FGFR (FGFR1-FGFR4) in vertebrates and mRNA alternative splicing occurs in the immunoglobulin-like domains III of the FGFR1, FGFR2, and FGFR3 genes (but not of FGFR4), generating diversity of sequence and resulting in various isoforms [11, 12, 13]. According to ligand binding specificity, the preferred receptors for FGF produced in the ovary are: FGFR1c for FGF1 and FGF2; FGFR3c for FGF1, FGF2, FGF8, FGF9, FGF16, FGF17, and FGF18 [6, 11]. In addition, FGFR2c is the second preferred receptor for FGF9 and FGF16; and FGFR4 is the second preferred receptor for FGF8, FGF17, and FGF18 [6, 11]. Because much work has been done showing effects of FGF1, FGF2, FGF8 and FGF9 on bovine ovarian cells, the preferred receptors for these ligands were selected to be measured in the present study (i.e., FGFR1c, 2c, 3c and 4).
In cattle, FGFR1c and FGFR2b have been detected in GC [14, 15] and oocytes [16, 17], FGFR1b has been detected in GC, TC, and oocytes [17, 18], FGFR2c and FGFR3c have been detected in both GC and TC [14, 19], and FGFR4 has been detected exclusively in TC [19] but only two studies have evaluated two of these receptors (i.e., FGFR1b and FGFR2b) in ovarian follicles of beef cattle during the first follicular wave [18, 20]. In addition, some FGFR change according to follicular fate in beef cattle: FGFR1b and FGFR2b mRNA abundance is greater in GC of presumed subordinate follicles than presumed dominant follicles [14, 20]; FGFR3c mRNA abundance is greater in GC (but not in TC) of small healthy follicles and in response to FSH [19]; FGFR4 mRNA abundance is greater in small than in large follicles [19]. Some of these changes in FGFR are associated with changes in follicular fluid (FFL) estradiol (E2) levels [14, 20], but whether steroids directly regulate these changes in FGFR in bovine follicles is unknown. Moreover, how endogenous production of FGFR1c, FGFR2c, FGFR3c and FGFR4 by ovarian follicular cells change during selection of dominant follicles in cattle is unknown. Hence, the objective of this study was to determine if mRNA abundance of FGFR1c, FGFR2c, FGFR3c, and FGFR4 in GC and TC changes during growth of first-wave dominant follicles in cattle exhibiting regular estrous cycles, and to determine if steroids regulate expression of the various FGFR in GC and TC of cattle.
2. Materials and methods
2.1. In vivo experimental design
Samples analyzed for this study were obtained from an experiment previously performed using non-lactating Holstein cows (n = 18) from Oklahoma State University herd [21]. All cows were non-lactating (5.4 ± 0.7 yr of age) and identified to be culled for nonreproductive reasons from the Oklahoma State University herd. Briefly, estrous cycles were synchronized using two injections (i.m.) of prostaglandin F2α (Lutalyse®, 25 mg) with an interval of 11 d, after which, follicle development was monitored daily via ultrasonography using an Aloka 500V with a 7.5 MHz probe. Following ovulation, cows were assigned to be ovariectomized either at 3 d to 4 d (early growing phase of the first dominant follicle; n = 9 cows) or 5 d to 6 d post-ovulation (late growing phase of the first dominant follicle; n = 9 cows) as previously described [21]. From the 18 cows used in the synchronization program, two failed (one from 3 d to 4 d and one from 5 d to 6 d post-ovulation groups) to ovulate and were excluded from this experiment. After each ovariectomy, ovaries were put on ice, and transported to the laboratory where diameters of all follicles ≥ 5 mm (surface diameter) in diameter were recorded, the numbers of all follicles ≥ 1 mm in diameter on the ovarian surface were determined, and ovarian tissue and fluid collected as previously described [21]. The animal experimentation described in this report was approved by the Oklahoma State University Institutional Animal Care and Use Committee (Protocol No. AG106).
For GC sample collection, follicles were categorized by surface diameter as small (1 to 5 mm), medium (5.1 to 8 mm) or large (8.1 to 18 mm); TC samples were collected from only medium and large follicles. The FFL from medium and large follicles was aspirated individually and centrifuged to obtain GC, and FFL from small follicles was pooled within each ovary and then centrifuged to obtain GC as previously described [21]. After centrifugation, FFL was aspirated and stored at −20 °C for measurement of E2 and progesterone (P4) via RIA. After collection of FFL, each medium and large follicle was bisected in situ, the inner wall was scraped, rinsed with Ham’s F-12 to remove any remaining GC, and these GC were combined with GC collected from FFL as previously described [21]. GC collected from small follicles were kept separate for each ovary. GC were lysed in 0.5 mL of TRIzol® reagent solution (Life Technologies, Inc., Grand Island, NY) and stored frozen at −80 °C until RNA extraction (see description below). TC were dissected from the bisected follicles and placed in 0.75 mL of TRIzol Reagent and homogenized for 2 to 3 min on ice using the Omni TH tissue homogenizer (Omni International Inc., Marietta, GA) with Omni Tip™ disposable generator probes as previously described [22].
2.2. In vitro experiments
The in vivo results suggested that E2 may be inhibitory to FGFR gene expression. To test this hypothesis, we designed experiments to test the effects of E2 and androstenedione (A4) on FGFR mRNA abundance in GC and TC. The dose (i.e., 300 ng/mL) of E2 and A4 was selected to represent concentrations of these steroids found in dominant follicles [23, 24] and based on previous studies [25–27]. Ovaries from nonpregnant cyclic (i.e., corpora lutea present) beef cattle were collected from a local slaughterhouse, and based on surface diameter, GCs were collected from small (1 to 5 mm) follicles via aspiration of FFL as previously described [21, 27, 28]. To isolate TC, large (8 to 20 mm) follicles were bisected with a scalpel after aspiration of FFL, GC were separated from theca interna via blunt dissection, theca interna tissue removed from the follicle wall, enzymatically digested, and non-digested thecal tissue was removed via filtration as previously described [25, 28, 29]. TC were centrifuged at 50 × g for 8 min, the pellets were washed twice in serum-free medium (1:1 DMEM and F12 with 38.5 mM sodium bicarbonate, 0.12 mM gentamicin, and 2.0 mM glutamine; Sigma-Aldrich Chemical Company, St. Louis, MO) and then re-suspended in serum-free medium containing collagenase and DNase to prevent clumping as previously described [8].
Viability of GC and TC used for cell culture was determined by trypan blue exclusion method using a hemacytometer, and averaged 42.2 ± 2.4% and 95.6 ± 0.8%, respectively. On average, 3.5 × 105 viable cells/well were plated on 24-well Falcon multi-well plates (No. 3047; Becton Dickinson, Lincoln Park, NJ) with 1 mL of medium/well and cultured (at 38.5°C with 5% CO2 and 95% air) in 10% fetal calf serum (Equitech-Bio, Inc.; Kerrville, TX) for the first 48 h with medium changed every 24 h. Cells were washed twice with serum-free medium (0.5 mL) and three treatments were applied in serum-free medium (1 mL/well) as follows: control, E2 (300 ng/mL) or A4 (300 ng/mL) (Sigma-Aldrich Chemical Co.). After 24 h of treatment, cells were lysed in TRIzol reagent (Life Technologies, Inc.) and extracted for RNA. Each experiment was replicated three times. This culture system was developed to yield hormonally responsive non-luteinized GC and TC [27–29]. In this system, aromatase activity of GC remains responsive to FSH, insulin and IGF-I and increases between d 3 and 4 of culture [28, 30], and the TC remain responsive to LH and IGF1 in terms of CYP17A1 mRNA and A4 production [29, 31]. Contemparary GC cultures in the present study responded to IGF1, with E2 secretion averaging 8 ± 1 pg/mL in FSH-treated controls vs 146 ± 18 pg/mL in IGF1 plus FSH-treated cultures. Also, contemparary TC cultures in the present study responded to IGF1, with androstenedione secretion averaging 324 ± 32 pg/mL in LH-treated controls vs. 578 ± 122 pg/mL in IGF1 plus LH-treated cultures.
2.3. Extraction of RNA and quantitative PCR
Ovarian follicular cells, GC and TC, were lysed in TRIzol® reagent solution (Life Technologies, Inc., Grand Island, NY) as described elsewhere [21, 25]. RNA samples were solubilized in diethylpyrocarbonate-treated water (Life Technologies), quantitated at 260 nm using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE), and stored at −80 °C.
Primers and probes for FGFR1c, FGFR2c, FGFR3c, and FGFR4 (supplied as 5’ FAM reporter dye and a 3’ TAMRA quencher dye; TaqMan TAMARA; Applied Biosystems Inc., Foster City, CA) for quantitative PCR (Table 1) were designed using Primer Express software (Foster City, CA). Relative mRNA abundance of target genes was quantified using fluorescent quantitative single-step RT-PCR using a CFX96 Real-Time System in 96-well plates (Bio-Rad, Hercules, CA). On each 96-well plate, samples were placed in duplicate wells to determine an average threshold cycle (Ct) value of both target gene and housekeeping gene. Thus, for the in vivo study, 24 samples balanced across d 3 and d 6 groups were included on each plate. Quality control for PCR was conducted as previously described [25]; intra-assay CV for real-time PCR averaged 0.75%. In addition, the RT-PCR products were run on agarose gels to verify the length and size of the expected target genes, and the same RT-PCR cDNA samples were used to verify the amplified sequence. Target gene expression was normalized to constitutively expressed 18S ribosomal RNA (18S rRNA; supplied as a VIC probe; TaqMan Ribosomal RNA Control Reagent, Applied Biosystems Inc.). The relative quantity of target gene mRNAs was expressed as 2-ΔΔCt using the relative comparative threshold cycle (Ct) method as previously described [32]. The housekeeping gene, 18S rRNA (accession no. X03205.1) was selected because previous studies show it to be a stable gene over a variety of treatments [25, 33, 34].
Table 1.
Sequences and characteristics for primers (forward and reverse) and probes for real-time PCR amplification of target genes.
| Target Gene1 | Oligo2 | Sequence | Accession | Tm3 (°C) | Concentration (nM) |
|---|---|---|---|---|---|
| FGFR1c | FWD | AGGTGAACGGGAGTAAGATTGG | XM_010820329.3 | 56.5 | 200 |
| REV | GTGCAGCACCTCCATCTCTTT | 57.6 | 200 | ||
| Probe | TCTTGAAGACGGCCGGAGTTAACACCA | 63.3 | 100 | ||
| FGFR2c | FWD | GTTCCAATGCGGAAGTGCTG | XM_010820096.3 | 57.1 | 200 |
| REV | GTTTTGGCAGGACAGTGAGC | 56.8 | 200 | ||
| Probe | AGGCGGATGCTGGCGAGTATATTTGTAAGG | 63.9 | 100 | ||
| FGFR3c | FWD | TAACACCACCGACAAGGAGC | NM_174318.3 | 57.2 | 200 |
| REV | CCACGCAGAGTGATGGGAAA | 57.6 | 200 | ||
| Probe | TGCGCAATGTCACCTTTGAGGACG | 62.0 | 100 | ||
| FGFR4 | FWD | CACTGCCCCCCAGAGCTATAC | XM_005209123.3 | 59.5 | 200 |
| REV | AGGACCTTGTCCAGTGCCTCTA | 59.6 | 200 | ||
| Probe | AGCACCCTCTCAGAGGCCCACTTTCA | 65.3 | 100 |
Target genes: = fibroblast growth factor receptor (FGFR) 1c, 2c, 3c and 4.
FWD = forward; REV = reverse.
Tm = melting temperature.
2.4. P4 and E2 RIA
Concentrations of P4 and E2 in FFL were determined by RIA as previously described [21, 23]. All samples were run in one assay for each of the steroid RIA. The intra-assay CV for P4 and E2 RIA was 11.6 % and 10.6 %, respectively. The inter-assay CV for P4 and E2 RIA average 23% and 14%, respectively, and recoveries of mass are >99% [23, 24].
2.5. Statistical analyses
Data were analyzed using the general linear models procedure of the Statistical Analysis System (SAS) for Windows (version 9.4, SAS Institute Inc., Cary, NC) and are presented as the least squares means (± SEM) of measurements. For Exp. 1, main factors were days post-ovulation (early, 3 d to 4 d, and late, 5 d to 6 d, growing phase of the first dominant follicle), follicle status based on size (small, medium, or large in the case of GC, and medium or large in the case of TC) and follicle estrogenic status (E2 active: E2>P4 concentrations or E2 inactive: E2<P4 concentrations), and their various interactions. Some cows had two E2-active follicles on 3 d to 4 d whereas some cows had no E2-active follicles on 5 d to 6 d. Also, if FFL samples were lost during collection, then E2-status could not be determined and gene expression data was not included in the analysis. For analysis of E2 concentrations in the subset of FFL samples, main factors were: days post-ovulation (early, 3 d to 4 d, and late, 5 d to 6 d, growing phase of the first dominant follicle), follicle group based on size (small E2-inactive, large E2-active or large E2-inactive), and their various interaction. To evaluate the relationships among variables measured in follicles > 5 mm in diameter (i.e., those collected individually), Pierson correlation coefficients were generated using CORR procedure of SAS. Because of the wide range and heterogeneous variances of the variables measured, log-transformed variables were correlated among each other. In vitro experiments (Exp. 2 and 3) were replicated three times (biological replicate) and within each experiment each treatment was duplicated, and data were analyzed via one-way ANOVA. To correct for heterogeneity of variance, target genes abundance was analyzed after transformation to natural log (x + 1). Mean differences were assessed using Fisher’s protected least significant differences test [35] only if significant main effects (in ANOVA) were detected. Significance was declared at P < 0.05.
3. Results
3.1. In vivo Exp. 1
3.1.1. Follicle size, E2, and P4 concentrations in FFL
Follicle size and steroid concentrations in FFL have been reported for this study [21]. Briefly, diameter of large dominant E2-active, large subordinate E2-inactive, and medium E2-inactive follicles averaged 12.9 ± 0.5, 9.48 ± 0.36, and 6.37 ± 0.23 mm, respectively. Concentrations of E2 in FFL of large dominant E2-active, large subordinate E2-inactive, medium E2-inactive, and small E2-inactive follicles averaged 186.5 ± 29.5, 8.45 ± 3.7, 2.3 ± 0.8, and 2.0 ± 0.2 ng/mL, respectively. Concentrations of P4 in FFL did not differ (P > 0.10) among follicle groups and ranged between 61 ± 7 and 236 ± 42 ng/mL.
3.1.2. GC FGFR1c mRNA
Abundance of FGFR1c mRNA, the main receptor for FGF1 and FGF2, was significantly affected by follicle group, but not by days post-ovulation or their interaction. Specifically, FGFR1c mRNA abundance was 4.3-, 6.1-, and 4.2-fold greater (P < 0.01) in large, medium, and small E2-inactive (E2/P4 ratio < 1), respectively, than in large E2-active (E2/P4 ratio > 1) follicles, and was 1.4–fold greater (P < 0.05) in medium E2-inactive than in large and small E2-inactive follicles (Fig. 1A). No other significant differences were detected among follicles of different sizes and steroidogenic status.
Fig. 1.

Effects of follicular size (Lg = Large; Md = Medium; Sm = Small) and E2 status (EA = estrogen active; EI = estrogen inactive) on FGF1c, FGFR2c, FGFR3c, and FGFR4 mRNA relative abundance in bovine granulosa cells averaged across days 3 to 4 and days 5 to 6. Panel A: Effects of follicular size and E2 status on FGF1c and FGFR2c mRNA in bovine granulosa cells; n = 16, 33, 64, and 29 and for Lg-EA, Lg-EI, Md-EI and Sm-EI, respectively. Panel B: Lack of effect of follicular size and E2 status on FGFR3c and FGFR4 mRNA in bovine granulosa cells; n = 16, 33, 62, and 28 for Lg-EA, Lg-EI, Md-EI and Sm-EI, respectively. For each FGFR, values are expressed as a ratio (fold ± SEM) of the Lg-EA values. abcWithin a panel and FGFR subtype, means without a common letter differ (P < 0.05).
3.1.3. GC FGFR2c mRNA
Abundance of FGFR2c mRNA, the second main receptor for FGF9 and FGF16, was significantly affected by follicle group, but not by days post-ovulation or their interaction (Fig. 1A). Specifically, FGFR2c mRNA abundance was 7.5-, 10.4-, and 4.9-fold greater (P < 0.01) in large, medium, and small E2-inactive follicles, respectively, than in large E2-active follicles. No other significant differences were detected among follicles of different sizes and steroidogenic status (Fig. 1A).
3.1.4. GC FGFR3c and FGFR4 mRNA
Abundance of FGFR3c mRNA in GC was not different (P > 0.10) among follicles of different sizes and steroidogenic status or days post-ovulation (Fig. 1B). Abundance of FGFR4 mRNA in GC was not different (P > 0.10) among follicles of different sizes and steroidogenic status or days post-ovulation (Fig. 1B).
3.1.5. TC FGFR1c mRNA
Abundance of FGFR1c mRNA in TC was significantly affected (P < 0.05) by follicle group, days post-ovulation, and their interaction. Specifically, FGFR1c mRNA abundance was 2.7- and 1.7-fold greater (P < 0.05) in medium E2-inactive than in large E2-active and small E2– inactive follicles, respectively, on 5 d to 6 d post-ovulation (Fig. 2A). Moreover, FGFR1c mRNA abundance was 2–fold greater in medium E2-inactive at late than at early growing phase of first dominant follicle. No significant differences in FGFR1c mRNA abundance were detected between large E2-active, large E2-inactive and medium E2-inactive follicles on 3 d to 4 d post-ovulation (Fig. 2A).
Fig. 2.

Effects of follicular size (Lg = Large; Md = Medium; Sm = Small), E2 status (EA = estrogen active; EI = estrogen inactive) and day post-ovulation (day 3 to 4 or day 5 to 6) on FGF1c (Panel A) and FGFR4 (Panel B) mRNA relative abundance in bovine theca cells. Panel A: Effects of follicular size and E2 status on FGF1c mRNA in bovine theca cells; n = 9, 10, and 27 for Lg-EA, Lg-EI, and Md-EI, respectively, for day 3 to 4; n = 4, 11, and 22 for Lg-EA, Lg-EI, and Md-EI, respectively, for day 5 to 6. Panel B: Effects of follicular size and E2 status on FGF4 mRNA in bovine theca cells; n = 9, 11, and 25 for Lg-EA, Lg-EI, and Md-EI, respectively, for day 3 to 4; n = 4, 11, and 22 for Lg-EA, Lg-EI, and Md-EI, respectively, for day 5 to 6. For each FGFR, values are expressed as a ratio (fold ± SEM) of the Lg-EA values. abWithin a panel, means without a common letter differ (P < 0.05).
3.1.6. TC FGFR2c mRNA
Abundance of FGFR2c mRNA in TC was not different (P > 0.10) among follicles of different sizes and steroidogenic status or days post-ovulation. Relative abundance of FGFR2c mRNA averaged 1.0, 0.5, and 0.8 ± 0.3 for large E2-active, large E2-inactive, and medium E2-inactive follicles, respectively, on 3 d to 4 d post-ovulation, and averaged 0.6, 0.5 and 1.1 ± 0.3 for large E2-active, large E2-inactive, and medium E2-inactive follicles, respectively, on 5 d to 6 d post-ovulation.
3.1.7. TC FGFR3c and FGFR4 mRNA
Abundance of FGFR3c mRNA in TC was not different (P > 0.10) among follicles of different sizes and steroidogenic status or days post-ovulation. Relative abundance of FGFR3c mRNA averaged 1.0, 0.6, and 0.9 ± 0.3 for large E2-active, large E2-inactive, and medium E2-inactive follicles, respectively, on 3 d to 4 d post-ovulation, and averaged 0.9, 0.5 and 1.3 ± 0.3 for large E2-active, large E2-inactive, and medium E2-inactive follicles, respectively, on 5 d to 6 d post-ovulation.
Abundance of FGFR4 tended (P < 0.09) to be affected by the follicle group x days post-ovulation interaction such that FGFR4 mRNA abundance was 1.4–fold greater (P < 0.05) in medium E2-inactive at 5 d to 6 d post-ovulation than at 3 d to 4 d post-ovulation (Fig. 2B). In addition, FGFR4 mRNA abundance was 5.2-fold greater (P < 0.05) in medium E2-inactive than in large E2-active follicles at late growing phase of first dominant follicle. No other significant differences were detected between follicles of different sizes at early or late growing phases of first dominant follicle.
3.1.8. Relative abundance of the various FGFR isoforms in GC and TC
Based on the average Ct values of each of the FGFR in freshly isolated GC and TC (Table 2), FGFR1c mRNA was the most abundant FGFR in both GC and TC. Specifically, abundance of GC FGFR1c mRNA was 30-, 42- and 315-fold greater than FGFR2c, FGFR3c and FGFR4 mRNA abundance, respectively. In TC, FGFR1c mRNA abundance was 64-, 158- and 64-fold greater than FGFR2c, FGFR3c and FGFR4 mRNA abundance, respectively.
Table 2.
Average Ct values from quantitative PCR analysis of fibroblast growth factor receptor (FGFR) 1c, 2c, 3c and 4 mRNA in granulosa cells (GC) and theca cells (TC) of Exp. 1–3.
| Exp. | FGFR subtype | GC FGFR mRNA Ct averages1 | TC FGFR mRNA Ct averages |
|---|---|---|---|
| 1 | FGFR1c | 26.3 | 24.6 |
| 1 | FGFR2c | 31.2 | 30.6 |
| 1 | FGFR3c | 31.7 | 31.9 |
| 1 | FGFR4 | 34.6 | 30.6 |
| 2 | FGFR1c | 23.3 | -- |
| 2 | FGFR2c | 29.1 | -- |
| 2 | FGFR3c | 22.7 | -- |
| 2 | FGFR4 | 34.8 | -- |
| 3 | FGFR1c | -- | 24.0 |
| 3 | FGFR2c | -- | 30.8 |
| 3 | FGFR3c | -- | 34.1 |
| 3 | FGFR4 | -- | 34.4 |
Ct = Threshold cycle value.
3.1.9. Correlations
Negative correlations existed between follicular size and GC FGFR1c (r = −0.30), FGFR2c (r = - 0.32), and FGFR4 (−0.36, P < 0.01, n = 108) mRNA abundance. In TC, a negative correlation existed between follicular size and FGFR4 mRNA abundance (r = −0.29, P < 0.01, n = 82). No significant correlations were observed between follicular size and FGFR3c mRNA abundance in GC or between follicular size and FGFR1c, FGFR2c, or FGFR3c mRNA abundance in TC.
Negative correlations existed between FFL E2 concentrations and GC FGFR1c (r = - 0.71), FGFR2c (r = −0.70), FGFR3c (r = −0.42) and FGFR4 (r = −0.42, P < 0.01, n = 108) mRNA abundance. In TC, negative correlations existed between FFL E2 concentrations and FGFR1c (r = −0.30) and FGFR4 (r = −0.30, P < 0.05, n = 82) mRNA abundance, whereas no significant correlations were observed between FFL concentrations of E2 and TC FGFR2c or FGFR3c mRNA abundance.
Positive correlations were detected between FFL concentrations of P4 and GC FGFR1c (r = 0.32, P < 0.01), FGFR2c (r = 0.22, P < 0.05), and FGFR3c (r = 0.35, P < 0.01, n = 108) mRNA abundance. In TC, levels of P4 in FFL were also positively correlated with abundance of FGFR1c (r = 0.35, P < 0.01) and FGFR4 (r = 0.24, P < 0.05, n = 82) mRNA. No significant correlations were detected between FFL concentrations of P4 and GC FGFR4 mRNA abundance or TC FGFR2c and FGFR3c mRNA abundance.
Negative correlations were detected between FFL E2/P4 ratio and GC FGFR1c (r = - 0.51), FGFR2c (r = −0.59), FGFR3c (r = −0.29) and FGFR4 (r= −0.32, P < 0.01, n = 108) mRNA abundance. In TC, FGFR1c mRNA abundance was negatively correlated with FFL E2/P4 ratio (r = −0.30, P < 0.01, n = 82). No significant correlations were detected between FFL E2/P4 ratio and GC FGFR4 mRNA abundance or between FFL E2/P4 ratio and TC FGFR2c, FGFR3c, or FGFR4 mRNA abundance.
3.2. In vitro Exp. 2 and 3
3.2.1. Effects of steroids on FGFR mRNA abundance in GC (Exp. 2)
Treatment of small-follicle GC with E2 had no effect (P > 0.10) on FGFR1c, FGFR2c and FGFR3c mRNA abundance (Fig. 3A). However, A4 increased (P < 0.05) FGFR1c, FGFR2c and FGFR4 mRNA abundance by 2-fold, while A4 treatment had no effect (P > 0.10) on FGFR3c mRNA abundance in small-follicle GC (Fig. 3A). Based on the average Ct values of each of the FGFR in cultured GC (Table 2), abundance of FGFR3c mRNA was 1.5-, 84- and 4390-fold greater than FGFR1c, FGFR2c and FGFR4 mRNA abundance, respectively.
Fig. 3:

In vitro effects of E2 and A4 on abundance of FGFR1c, FGFR2c, FGFR3c and FGFR4 mRNA in bovine granulosa cells (Exp. 2) and theca cells (Exp. 3). Granulsoa cells and theca cells were isolated and cultured in 10% FCS and then treated in serum-free medium with 300 ng/mL of either E2 or A4 for 24 h. Values (± SEM; n = 6) are expressed as a ratio (fold ± SEM) of the controls. *Within a Panel and FGFR subtype, mean differs from control (P < 0.05).
Statistical analysis of the 18S Ct revealed no significant effect of treatment.
3.2.2. Effects of steroids on FGFR mRNA abundance in TC (Exp. 3)
Treatment of large-follicle TC with E2 or A4 had no effect (P > 0.10) FGFR1c, FGFR2c, FGFR3c or FGFR4 mRNA abundance in large-follicle TC (Fig. 3B). Based on the average Ct values of each of the FGFR in cultured TC (Table 2), abundance of FGFR1c mRNA was 128-, 1024- and 1352-fold greater than FGFR2c, FGFR3c and FGFR4 mRNA abundance, respectively. Statistical analysis of the 18S Ct revealed no significant effect of treatment.
4. Discussion
Evidence for a role of FGF in the mammalian ovary was first reported in the seventies [36] when acidic FGF (FGF1) was found to stimulate proliferation of bovine GC and luteal cells. To date, ten members of the FGF family have been shown to regulate ovarian follicular function via altering GC and TC proliferation and steroidogenesis [for reviews, see 4, 5, 13]. The diversity of roles played by FGF is influenced by the nature of the ligands and the four families of high affinity FGFR and cofactors that regulate the FGF signaling complex [12, 13, 37, 38]. The present study determined whether FGFR1c, FGFR2c, FGFR3c, and FGFR4 change according to follicular size, steroidogenic status, and days post-ovulation during growth of first-wave dominant follicles tracked via ultrasonography in dairy cattle. The present study also revealed for the first time that the most abundant of these 4 isoforms of FGFR was FGFR1c and FGFR3c for GC and FGFR1c and FGFR2c for TC, and that FGFR4 was a scarce mRNA particularly in GC. Consistent with the latter observation, Buratini et al. [19] was unable to detect FGFR4 mRNA in GC of cattle.
In the present study, FGFR1c and FGFR2c mRNA abundance was greater in GC from E2-inactive follicles of all sizes (i.e., subordinate follicles) than in GC from large E2-active follicles (i.e., dominant follicles) whereas GC FGFR3c and FGFR4 mRNA abundance did not differ among follicle types during the first follicular wave in dairy cattle. In beef cattle, FGFR2b but not FGFR1b mRNA abundance was greater in GC of subordinate vs. dominant follicles [18, 20]. Previous studies using abattoir-collected bovine ovaries found that mRNA for all four FGFR subtypes were detected in bovine cumulus cells [2], and determined that abundance of FGFR3c mRNA in GC significantly increased with increasing follicle size and with increasing E2 levels in FFL [19] whereas FGFR2c mRNA in GC did not change and FGFR2b mRNA in GC increased with increasing E2 levels in FFL [14]. Reasons for some of the differences between the present and previous studies is unknown but may be due to breed differences or due to abattoir vs. synchronized-estrus collected ovaries. Nonetheless, previous studies [14, 18, 20] consistently reported increased FGFR2b mRNA abundance in dominant and E2-active follicles.
Also in the present study, TC from medium E2-inactive follicles had greater FGFR1c and FGFR4 mRNA abundance than TC from large E2-active follicles while TC FGFR2c and FGFR3c mRNA abundance did not differ among follicle types. Similarly, previous studies using abattoir-collected beef cattle ovaries determined that abundance of FGFR4 mRNA in TC decreased with increasing follicle size but did not change with changes in E2 levels in FFL, whereas FGFR3c mRNA in TC did not change with either follicle size or E2 levels [19]. Berisha et al. [14] reported that abundance of FGFR2b and FGFR2c mRNA in TC did not change with increasing E2 levels in FFL, whereas Castilho et al., [18] reported that abundance of FGFR2b mRNA in TC was greater in subordinate vs. dominant follicles. Therefore, collective evidence indicates that FGFR gene expression in TC is less regulated than FGFR gene expression in GC of cattle. In further support of this conclusion, abundance of FGFR1c, FGFR2c, FGFR3c and FGFR4 mRNA in GC was negatively correlated with FFL E2 concentrations and E2/P4 ratio whereas only FGFR1c mRNA abundance in TC was negatively correlated with FFL E2 concentrations and E2/P4 ratio in the present study. These results also suggest that E2 may be inhibitory to FGFR gene expression. To test this hypothesis we evaluated the effect of E2 and A4 on FGFR gene expression in GC and TC and found that A4 stimulated FGFR1c, FGFR2c and FGFR4 mRNA in GC but had no effect on expression of any of the FGFR genes in TC. In vitro treatment with E2 decreased only FGFR2c mRNA in GC, supporting the hypothesis that E2 may be directly driving the decrease in FGFR2c mRNA in E2-active follicles, a conclusion supported by the high negative correlation between GC FGFR2c mRNA abundance and FFL E2 concentrations (i.e., r = −0.70) in the present study. Similarly, in vivo, E2 inhibits FGFR2 mRNA in mouse mammary glands [39].
Because androgens are needed to produce estrogens, and the novel observation that A4 increased FGFR1c and FGFR2c mRNA in GC suggests that elevated androgens (i.e., when aromatase is low) may act to slow differentiation by promoting increases in receptors for the known anti-differentiation factors, FGF2 and FGF9 [40]. A follicle’s estrogenic status can be used to assess the health of follicles, and thus, large E2-active follicles are considered as those selected to escape atresia and become dominant [41–43]. The present results indicate that FGFR1c and FGFR2c are produced in greater amounts in GC from subordinate than dominant follicles, implying a pro-atretic or an anti-differentiation role for these receptors. The fact that relative abundance of mRNA for FGFR1c and FGFR2c in GC and FGFR1c in TC are negatively correlated with size and E2/P4 ratio reinforces this idea. The present study also supports the idea that E2 and A4 may be regulating some of the changes in GC FGFR mRNA abundance. The greater expression of GC FGFR1c and FGFR2c in E2-inactive follicles parallel changes in FGF9 mRNA reported from this same study [44]. Interestingly, both E2 and androgens also induce FGF9 mRNA expression in bovine GC [44]. In porcine GC, FGF9 suppresses whereas IGF1 induces FGFR2c mRNA expression [45], but whether FGF9 or IGF1 is directly inducing FGFR1c or FGFR2c expression in bovine GC will require further study. Previous studies have reported that FSH increases abundance of FGFR1c, FGFR2c and FGFR3c mRNA in bovine GC [17, 19], and thus, additional work should be conducted to evaluate if other hormones or growth factors regulate expression of the various FGFR in bovine GC and TC.
Abundance of GC FGFR4 mRNA was not different among follicles of different steroidogenic status and sizes, but it was greater in TC from medium E2-inactive follicles at 5 d to 6 d post-ovulation than at 3 d to 4 d post-ovulation. In addition, FGFR4 mRNA abundance in TC was negatively correlated with size and with FFL E2 concentrations and positively correlated with FFL P4 concentrations. Since transcripts for FGFR4 only changed in TC, but not in GC across days, it is likely to suppose that the action of the ligands that bind to FGFR4 (e.g., FGF8) may be more functionally important in TC than in GC. This is in agreement with previous observations [19] where FGFR4 mRNA was only detected in TC, but not in GC or oocytes from bovine antral follicles. Although we detected FGFR4 mRNA in GC and its expression was up-regulated by A4, it was the least expressed FGFR in GC. The fact that FGFR4 mRNA is increasing in medium-sized E2-inactive follicles during follicular selection and dominance is an indication that this receptor could be playing a role in preventing differentiation of this size class of antral follicles. Similarly, Buratini et al. [19] found that transcripts for FGFR4 were greater in TC from small than from large antral follicles of cattle. However, the hormones or growth factors that are regulating these changes in TC FGFR4 mRNA will require further study, as E2 and A4 had no effect on FGFR4 mRNA abundance in TC of the present study.
Interestingly, several FGF that preferentially bind to FGFR1c, FGFR2c, FGFR3c, and FGFR4 appear to be critical regulators of large follicle differentiation and atresia. For example, FGF2 (preferentially binding to FGFR1c and FGFR3c), FGF9 (preferentially binding to FGFR3c followed by FGFR2c), and FGF17 and FGF18 (preferentially binding to FGFR3c followed by FGFR4) inhibit steroidogenic enzyme activity and FSH-stimulated E2 production by GC in cattle [16, 40, 46, 47]. Because E2 is important for GC survival, oocyte maturation and differentiation of dominant follicles [3, 48, 49], FGF suppression of E2 production may be playing a role in inducing atresia or preventing differentiation of GC in cattle. The fact that some of the ligands that preferentially bind to FGFR3c, including FGF9, FGF17, and FGF18, have a greater mRNA abundance in subordinate or atretic antral follicles than in dominant follicles in cattle [8, 16, 44] reinforces this idea. Furthermore, of the ligands mentioned above, FGF18 induced regression of the dominant follicle when injected in vivo and increased cleaved caspase-3 in GC in vitro [50], which is a major downstream effector of apoptosis and serves a marker for GC apoptosis [51], confirming a role for FGF18 in the induction of atresia in bovine antral follicles.
It is noteworthy that some members of the FGF family that preferentially bind to FGFR1c, FGFR2c and/or FGFR3c are mitogenic factors of ovarian follicle somatic cells of cattle. Specifically, FGF1 [36, 52, 53] stimulates GC proliferation whereas FGF2 [54, 55] and FGF9 [8, 48] stimulate both GC and TC proliferation. In addition, FGF9 appears to be stimulating GC and TC proliferation via induction of expression of genes related to cell proliferation such as MAPK/ERK and CCND1 in TC [56]. Hence, FGFR1c, FGFR2c and FGFR3c and their ligands appear to be playing a positive role in development and selection of bovine antral follicles via stimulation of mitosis. However, additional research is needed to further elucidate the physiological regulation of the various FGFRs during growth and atresia of ovarian follicles in cattle.
5. Conclusions
In summary, GC of large, medium and small E2-inactive follicles had greater abundance of FGFR1c and FGFR2c mRNA than in large E2-active follicles, and FGFR1c and FGFR4 mRNA abundance was greater in TC of medium E2-inactive follicles at the late than early growing phase of first dominant follicle. Furthermore, FGFR1c and FGFR4 mRNA relative abundance was greater in TC of medium E2-inactive follicles than large E2-active and E2-inactive follicles at the late than early growing phase of first dominant follicle. In vitro evidence indicated that E2 may be directly inhibiting GC FGFR2c mRNA expression and the stimulatory effect of A4 on GC FGFR1c, FGFR2c and FGFR4 indicates that changes in FFL androgen levels may be driving changes in GC FGFR gene expression as well. However, the hormones or factors that regulate changes in TC FGFR1c and FGFR4 will require further study. Also, future research will be required to verify the protein expression levels of these various FGFR proteins in bovine GC and TC. Taken together, the previous and present findings suggest a role for FGF and their receptors as anti-differentiation factors of follicular GC and TC in a mono-ovulatory species such as cattle.
Highlights.
FGFR1c and FGFR2c mRNA abundance is least in granulosa cells of dominant follicles
Estradiol decreased FGFR2c mRNA abundance in granulosa cells
Androgen increased FGFR1c, FGFR2c and FGFR4 mRNA abundance in granulosa cells
FGFR3c and FGFR4 mRNA abundance in granulosa cells is similar among follicle types
FGFR2c and FGFR3c mRNA abundance in theca cells is similar among follicle types
Acknowledgements
The authors thank Lingna Zhang, Jeff Williams and John Evans for laboratory assistance; David Jones, Jeff Davis and other members of the OSU Dairy Cattle Center for care and management of the cows. This work supported in part by: the NICHD, National Institutes of Health, through Agreement R15-HD-066302 (to L.J.S), and the Oklahoma State University Agricultural Experiment Station (OKL02970 to L.J.S.) and The Endowment of Howard M. & Adene R. Harrington Chair in Animal Science (Project 21–58500 to L.J.S.).
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
CRediT authorship contribution statement
L.F. Schutz: Conceptualization, Methodology, Formal data analysis, Investigation, Writing - original draft, Writing - review&editing, A. M. Hemple: Methodology, Investigation,Writing - review&editing. B.C. Morrell: Investigation, Methodology, Writing - review&editing. N.B. Schreiber: Methodology, Investigation, Writing – review&editing. J.N. Gilliam: Methodology, Investigation, Writing – review&editing. C. Cortinovis: Methodology, Investigation, Writing – review&editing. M.L. Totty: Methodology, Investigation, Writing – review&editing. F. Caloni: Resources, Writing – review&editing. P. Y. Aad: Methodology, Investigation, Writing - review&editing. L.J. Spicer: Project administration, Conceptualization, Resources, Formal data analysis, Writing - review&editing.
References
- [1].Eppig JJ. Intercommunication between mammalian oocytes and companion somatic-cells. Bioessays 1991; 13:569–574. [DOI] [PubMed] [Google Scholar]
- [2].Zhang K, Hansen PJ, Ealy AD. Fibroblast growth factor 10 enhances bovine oocyte maturation and developmental competence in vitro. Reproduction 2010;140(6):815–26. doi: 10.1530/REP-10-0190. [DOI] [PubMed] [Google Scholar]
- [3].Fortune JE., Rivera GM, Yang MY. Follicular development: The role of the follicular microenvironment in selection of the dominant follicle. Anim Reprod Sci 2004; 82–83:109–126. [DOI] [PubMed] [Google Scholar]
- [4].Chaves RN, de Matos MHT, Buratini J, de Figueiredo JR. The fibroblast growth factor family: Involvement in the regulation of folliculogenesis. Reprod Fertil Dev 2012; 24:905–915. [DOI] [PubMed] [Google Scholar]
- [5].Price CA. Mechanisms of fibroblast growth factor signaling in the ovarian follicle. J Endocrinol 2016; 228:R31–43. [DOI] [PubMed] [Google Scholar]
- [6].Ornitz DM, Itoh N. Fibroblast growth factors. Genome Biol 2001; 2:REVIEWS3005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7].Itoh N, Ornitz DM. Fibroblast growth factors: From molecular evolution to roles in development, metabolism and disease. J Biochem 2011; 149:121–130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8].Schreiber NB, Totty ML, Spicer LJ. Expression and effect of fibroblast growth factor 9 in bovine theca cells. J Endocrinol 2012; 215:167–175. [DOI] [PubMed] [Google Scholar]
- [9].Dell KR, Williams LT. A novel form of fibroblast growth factor receptor 2. Alternative splicing of the third immunoglobulin-like domain confers ligand binding specificity. J Biol Chem 1992; 267:21225–21229. [PubMed] [Google Scholar]
- [10].Plotnikov AN, Hubbard SR, Schlessinger J, Mohammadi M. Crystal structures of two fgf-fgfr complexes reveal the determinants of ligand-receptor specificity. Cell 2000; 101:413–424. [DOI] [PubMed] [Google Scholar]
- [11].Ornitz DM, Itoh N. The fibroblast growth factor signaling pathway. Wiley Interdiscip Rev. Dev. Biol 2015; 4:215–266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [12].Itoh N, Ornitz DM. Evolution of the FGF and FGFR gene families. Trends Genet 2004; 20:563–569. [DOI] [PubMed] [Google Scholar]
- [13].Li XW, Wang C, Xiao J, McKeehan WL, Wang F. Fibroblast growth factors, old kids on the new block. Semin Cell Dev Biol 2016; 53:155–167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [14].Berisha B, Sinowatz F, Schams D. Expression and localization of fibroblast growth factor (FGF) family members during the final growth of bovine ovarian follicles. Mol Reprod Dev 2004; 67:162–171. [DOI] [PubMed] [Google Scholar]
- [15].Buratini J, Pinto MGL, Castilho AC, Amorim RL, Giometti IC, Portela VM, Nicola ES, Price CA. Expression and function of fibroblast growth factor 10 and its receptor, fibroblast growth factor receptor 2B, in bovine follicles. Biol Reprod 2007; 77:743–750. [DOI] [PubMed] [Google Scholar]
- [16].Machado MF, Portela VM, Price CA, Costa IB, Ripamonte P, Amorim RL, Buratini J. Regulation and action of fibroblast growth factor 17 in bovine follicles. J Endocrinol 2009; 202:347–353. [DOI] [PubMed] [Google Scholar]
- [17].Zhang K, Ealy AD. Disruption of fibroblast growth factor receptor signaling in bovine cumulus-oocyte complexes during in vitro maturation reduces subsequent embryonic development. Domest Anim Endocrinol 2012; 42:230–238. [DOI] [PubMed] [Google Scholar]
- [18].Castilho ACS, Price CA, Dalanezi F, Ereno RL, Machado MF, Barros CM, Gasperin BG, Goncalves PBD, Buratini J. Evidence that fibroblast growth factor 10 plays a role in follicle selection in cattle. Reprod. Fertil. Dev 2017; 29:234–243. [DOI] [PubMed] [Google Scholar]
- [19].Buratini J, Teixeira AB, Costa IB, Glapinski VF, Pinto MGL, Giometti IC, Barros CM, Cao M, Nicola ES, Price CA. Expression of fibroblast growth factor-8 and regulation of cognate receptors, fibroblast growth factor receptor-3c and-4, in bovine antral follicles. Reproduction 2005; 130:343–350. [DOI] [PubMed] [Google Scholar]
- [20].Gasperin BG, Ferreira F, Rovani MT, Santos JT, Buratini J, Price CA, Goncalves PB. FGF10 inhibits dominant follicle growth and estradiol secretion in vivo in cattle. Reproduction 2012; 143:815–823. [DOI] [PubMed] [Google Scholar]
- [21].Dentis JL, Schreiber NB, Gilliam JN, Schutz LF, Spicer LJ. Changes in brain ribonuclease (BRB) mRNA in granulosa cells (GC) of dominant versus subordinate ovarian follicles of cattle and the regulation of BRB gene expression in bovine GC. Domest Anim Endocrinol 2016; 55:32–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [22].Aad PY, Echternkamp SE, Sypherd DD, Schreiber NB, Spicer LJ. The hedgehog system in ovarian follicles of cattle selected for twin ovulations and births: Evidence of a link between the IGF and hedgehog systems. Biol Reprod 2012; 87:79. [DOI] [PubMed] [Google Scholar]
- [23].Stewart RE, Spicer LJ, Hamilton TD, Keefer BE, Dawson LJ, Morgan GL, and Echternkamp SE 1996. Levels of insulin-like growth factor (IGF) binding proteins, luteinizing hormone and IGF-I receptors, and steroids in dominant follicles during the first follicular wave in cattle exhibiting regular estrous cycles. Endocrinology 137:2842–2850. [DOI] [PubMed] [Google Scholar]
- [24].Spicer LJ, Enright WJ. Concentrations of insulin-like growth factor I and steroids in follicular fluid of preovulatory bovine ovarian follicles: effect of daily injections of a growth hormone-releasing factor analog and(or) thyrotropin-releasing hormone. J Anim Sci 1991;69(3):1133–1139. doi: 10.2527/1991.6931133x. [DOI] [PubMed] [Google Scholar]
- [25].Zhang L, Schütz LF, Robinson CL, Totty ML, Spicer LJ. Evidence that gene expression of ovarian follicular tight junction proteins is regulated in vivo and in vitro in cattle. J Anim Sci 2017; 95:1313–1324. [DOI] [PubMed] [Google Scholar]
- [26].Spicer LJ. Effects of estradiol on bovine thecal cell function in vitro: dependence on insulin and gonadotropins. J Dairy Sci 2005; 88:2412–2421. [DOI] [PubMed] [Google Scholar]
- [27].Langhout DJ, Spicer LJ, Geisert RD. Development of a culture system for bovine granulosa cells: effects of growth hormone, estradiol, and gonadotropins on cell proliferation, steroidogenesis, and protein synthesis. J Anim Sci 1991; 69 3321–3334. [DOI] [PubMed] [Google Scholar]
- [28].Spicer LJ, Chamberlain CS. Influence of cortisol on insulin- and insulin-like growth factor 1 (IGF-1)-induced steroid production and on IGF-1 receptors in cultured bovine granulosa cells and thecal cells. Endocrine 1998; 9:153–161. [DOI] [PubMed] [Google Scholar]
- [29].Stewart RE, Spicer LJ, Hamilton TD, Keefer BE. Effects of insulin-like growth factor I and insulin on proliferation and on basal and luteinizing hormone-induced steroidogenesis of bovine thecal cells: involvement of glucose and receptors for insulin-like growth factor I and luteinizing hormone. J Anim Sci 1995; 73:3719–3731. [DOI] [PubMed] [Google Scholar]
- [30].Spicer LJ, Alpizar E, Echternkamp SE. Effects of insulin, insulin-like growth factor I, and gonadotropins on bovine granulosa cell proliferation, progesterone production, estradiol production, and(or) insulin-like growth factor I production in vitro. J Anim Sci 1993; 71:1232–1241. [DOI] [PubMed] [Google Scholar]
- [31].Spicer LJ, Aad PY, Allen DT, Mazerbourg S, Payne AH, Hsueh AJ. Growth differentiation factor 9 (GDF9) stimulates proliferation and inhibits steroidogenesis by bovine theca cells: influence of follicle size on responses to GDF9. Biol Reprod 2008; 78:243–53. [DOI] [PubMed] [Google Scholar]
- [32].Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25:402–408. [DOI] [PubMed] [Google Scholar]
- [33].Schmittgen TD, Zakrajsek BA. Effect of experimental treatment on housekeeping gene expression: validation by real-time, quantitative RT-PCR. J Biochem Biophys Methods 2000; 46:69–81. [DOI] [PubMed] [Google Scholar]
- [34].Voge JL, Aad PY, Santiago CA, Goad DW, Malayer JR, Allen DT, Spicer LJ. Effect of insulin-like growth factors (IGF), FSH, and leptin on IGF-binding-protein mRNA expression in bovine granulosa and theca cells: quantitative detection by real-time PCR. Peptides 2004; 25:2195–2203. [DOI] [PubMed] [Google Scholar]
- [35].Ott L 1977. An introduction to statistical methods and data analysis Duxbury Press, North Scituate, MA. [Google Scholar]
- [36].Gospodarowicz D, Ill CR, Birdwell CR. Effects of fibroblast and epidermal growth-factors on ovarian cell-proliferation in vitro .1. Characterization of response of granulosa-cells to FGF and EGF. Endocrinology 1977; 100:1108–1120. [DOI] [PubMed] [Google Scholar]
- [37].Givol D, Yayon A. Complexity of FGF receptors: Genetic basis for structural diversity and functional specificity. FASEB J 1992; 6:3362–3369. [PubMed] [Google Scholar]
- [38].Dailey L, Ambrosetti D, Mansukhani A, Basilico C. Mechanisms underlying differential responses to FGF signaling. Cytokine & Growth Factor Rev 2005; 16:233–247. [DOI] [PubMed] [Google Scholar]
- [39].Imagawa W, Pedchenko VK. In vivo inhibition of keratinocyte growth factor receptor expression by estrogen and antagonism by progesterone in the mouse mammary gland. J Endocrinol 2001; 171:319–327. [DOI] [PubMed] [Google Scholar]
- [40].Schreiber NB, Spicer LJ. Effects of fibroblast growth factor 9 (FGF9) on steroidogenesis and gene expression and control of FGF9 mRNA in bovine granulosa cells. Endocrinology 2012; 153:4491–4501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [41].Ireland JJ, Roche JF. Development of antral follicles in cattle after prostaglandin-induced luteolysis: Changes in serum hormones, steroids in follicular fluid, and gonadotropin receptors. Endocrinology 1982; 111:2077–2086. [DOI] [PubMed] [Google Scholar]
- [42].Mihm M, Evans AC. Mechanisms for dominant follicle selection in monovulatory species: a comparison of morphological, endocrine and intraovarian events in cows, mares and women. Reprod Domest Anim 2008; 43 Suppl 2:48–56. [DOI] [PubMed] [Google Scholar]
- [43].Ginther OJ. 2016. The theory of follicle selection in cattle. Domest Anim Endocrinol 57:85–99. [DOI] [PubMed] [Google Scholar]
- [44].Schütz LF, Schreiber NB, Gilliam JN, Cortinovis C, Totty ML, Caloni F, Evans JR, Spicer LJ. Changes in fibroblast growth factor 9 mRNA in granulosa and theca cells during ovarian follicular growth in dairy cattle. J Dairy Sci 2016; 99:9143–9151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [45].Evans JR, Schreiber NB, Williams JA, Spicer LJ. Effects of fibroblast growth factor 9 on steroidogenesis and control of FGFR2IIIc mRNA in porcine granulosa cells. J Anim Sci 2014; 92:511–519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [46].Vernon RK, Spicer LJ. Effects of basic fibroblast growth factor and heparin on follicle-stimulating hormone-induced steroidogenesis by bovine granulosa cells. J Anim Sci 1994; 72:2696–2702. [DOI] [PubMed] [Google Scholar]
- [47].Portela VM, Machado M, Buratini J, Zamberlam G, Amorim RL, Goncalves P, Price CA. Expression and function of fibroblast growth factor 18 in the ovarian follicle in cattle. Biol. Reprod 2010; 83:339–346. [DOI] [PubMed] [Google Scholar]
- [48].Spicer LJ, and Echternkamp SE The ovarian insulin and insulin-like growth factor system with an emphasis on domestic animals. Dom. Anim. Endocrinol 12:223–245, 1995. [DOI] [PubMed] [Google Scholar]
- [49].Knecht M, Brodie AM, Catt KJ. Aromatase inhibitors prevent granulosa cell differentiation: An obligatory role for estrogens in luteinizing hormone receptor expression. Endocrinology 1985; 117:1156–1161. [DOI] [PubMed] [Google Scholar]
- [50].Portela VM, Dirandeh E, Guerrero-Netro HM, Zamberlam G, Barreta MH, Goetten AF, Price CA. The role of fibroblast growth factor-18 in follicular atresia in cattle. Biol Reprod 2015; 92:14. [DOI] [PubMed] [Google Scholar]
- [51].Feranil JB, Isobe N, Nakao T. Apoptosis in the antral follicles of swamp buffalo and cattle ovary: Tunel and caspase-3 histochemistry. Reprod Domest Anim 2005; 40:111–116. [DOI] [PubMed] [Google Scholar]
- [52].Hoshi H, Konno S, Kikuchi M, Sendai Y, Satoh T. Fibroblast growth factor stimulates the gene expression and production of tissue inhibitor of metalloproteinase-1 in bovine granulosa cells. In Vitro Cell Dev Biol Anim 1995; 31:559–63. [DOI] [PubMed] [Google Scholar]
- [53].Schams D, Kosmann M, Berisha B, Amselgruber WM, Miyamoto A. Stimulatory and synergistic effects of luteinising hormone and insulin like growth factor 1 on the secretion of vascular endothelial growth factor and progesterone of cultured bovine granulosa cells. Exp Clin Endocrinol Diabetes 2001; 109:155–162. [DOI] [PubMed] [Google Scholar]
- [54].Gospodarowicz D, Cheng J, Lui GM, Baird A, Esch F, Bohlen P. Corpus luteum angiogenic factor is related to fibroblast growth factor. Endocrinology 1985; 117:2383–2391. [DOI] [PubMed] [Google Scholar]
- [55].Spicer LJ, Stewart RE. Interactions among basic fibroblast growth factor, epidermal growth factor, insulin, and insulin-like growth factor-I (IGF-I) on cell numbers and steroidogenesis of bovine thecal cells: Role of IGF-I receptors. Biol Reprod 1996; 54:255–263. [DOI] [PubMed] [Google Scholar]
- [56].Totty ML, Morrell BC, Spicer LJ. Fibroblast growth factor 9 (FGF9) regulation of cyclin D1 and cyclin-dependent kinase-4 in ovarian granulosa and theca cells of cattle. Mol Cell Endocrinol 2017; 440:25–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
