Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2022 May 24;12:8720. doi: 10.1038/s41598-022-12777-2

Intra- and interspecies competition of blackgrass and wheat in the context of herbicidal resistance and environmental conditions in Poland

Anna Wenda-Piesik 1,✉, Agnieszka Synowiec 2, Katarzyna Marcinkowska 3, Barbara Wrzesińska 3, Cezary Podsiadło 4, Krzysztof Domaradzki 5, Piotr Kuc 6, Ewa Kwiecińska-Poppe 7
PMCID: PMC9130282  PMID: 35610348

Abstract

Blackgrass (Alopecurus myosuroides Huds.), one of the most aggressive grass weeds in Europe, is also a strong competitor of crops. This study aimed to assess the impact of environmental conditions on the competition between (1) ACC-ase and ALS herbicide-resistant (BR) and herbicide-susceptible (BS) blackgrass biotypes, (2) BR and winter wheat cv. Arkadia (W), and (3) BS and W. In the replacement series model, the experiment was conducted at seven sites across Poland during two seasons (2018/19 and 2019/20). In the BR-BS experiment, the BS biotype was in majority more competitive toward the BR biotype. However, in the regime of optimal hydrothermal conditions and at a higher sand content in the soil we observed a higher competitiveness of BR towards BS. The combined interactions between W and BR or BS were also affected by environmental conditions, i.e., soil texture and hydrothermal coefficient, as explained by PCA and k-means cluster analysis. At most sites, W was more competitive toward both BS and BR, which could result from earlier emergence of W in relation to B in majority of sites. Except for two cases, located on heavy, clay soils, during humid seasons, where B was more competitive toward W. We summarize that blackgrass competitiveness towards other biotypes and wheat depends to some extent on environmental conditions; however, the phenomenon should be explored in more detail.

Subject terms: Plant sciences, Environmental sciences

Introduction

Blackgrass, Alopecurus myosuroides Huds., is a winter annual, monocotyledonous plant that produces many seeds and is one of the most difficult weeds to control1–3. Fields with consistently dense A. myosuroides patches are characterized by high clay, nutrient, and organic matter contents with a slightly lower pH4–6. Blackgrass emerges in early autumn, often before the emergence of winter crops, i.e., cereals and oilseed rape7,8. A phenotypic variation of blackgrass and its dormancy affect its emergence patterns in a single year, bringing this weed's evolutionary advantage over crops9,10. During the last 50 years, blackgrass has become more prevalent and problematic to control weeds, mostly due to widespread herbicide resistance11. The first case of herbicide-resistant blackgrass was reported in 1982 in Great Britain12. Since then, the weed has evolved field resistance to a few different herbicide modes of action13, especially to post-emergence acetyl-CoA carboxylase inhibitors (aryloxyphenoxypropionate (AOPP) and cyclohexanedione (CHD) and acetolactate synthase (ALS) inhibitors14. The mechanism behind blackgrass resistance is reported to be enhanced metabolism in the case of resistance to AOPP/CHD herbicides15 and target-site resistance (TSR) in the case of ACCase-inhibiting and ALS-inhibiting herbicides16,17. Non-target-site-based resistance (NTSR) mechanisms in blackgrass can confer unpredictable resistance to herbicides with different chemistries or modes of action18–21, but no glyphosate resistance has been reported to date22. The UK's latest report showed that the herbicide resistance-prone, outcrossing A. myosuroides exhibits low genetic differentiation among field-collected populations, with some geographical (latitudinal and longitudinal) clines in genetic diversity and isolation by distance23. In Poland, herbicide-resistant blackgrass populations are mostly found in winter wheat, especially in the northeastern parts of the country24–26.

Blackgrass is a very competitive weed for winter wheat that can cause grain yield losses of up to 41%8. At a density of 25 plants m−2, a 10% decrease in wheat yield is observed27. Studies on wheat-blackgrass competitiveness could support integrated weed management techniques, in addition to mechanical, biological, and cultural control means3,28. Wheat planting design, e.g., plant density, row spacing, and orientation, increases wheat competitiveness against weeds29–31, which is one of the methods of weed management. In the case of the herbicide-resistance trait in agrocenosis, what counts is the competitive pressure of resistant weeds on crops and the interspecies competitiveness of resistant biotypes towards susceptible ones32,33. Identifying this interaction type could be important, especially when herbicide resistance has developed in the field. Nevertheless, due to the introduction of sustainable weed management methods, herbicides have substantially reduced. In that situation, weeds of different susceptibilities to herbicides could compete with each other33,34. The available literature on that topic shows that the competition between resistant vs susceptible biotype depends on many factors, i.e., type of resistance, habitat stresses, and weed densities32–35. On the other hand, the cited studies were performed either in the controlled conditions or in one field site only. For these reasons, testing the resistant vs susceptible biotype in different climatic conditions is a novel aspect of our research. The methods developed to study competition among plants allow the estimation of the losses caused by weeds and the competitiveness among species36. The models for blackgrass and wheat competition may differ significantly in predicting the yield damage caused by blackgrass, and there is no optimum design for competition experiments since the aims, objectives, and practicalities vary from study to study and species to species. However, they could potentially be used in future weed management systems37,38. Our study focused on a replacement-series competition model39 to study the competitive abilities of herbicide-resistant blackgrass toward the susceptible biotype and toward winter wheat cv. Arkadia. A standard replacement series comprises a set of pure and mixed populations in which the combined density of the components is held constant40. The method was developed in 1960 by de Wit41. Correctly used, the approach can lead to some valid interpretations. However, this methodology has some limitations, i.e., a replacement series is unsuitable for the quantitative evaluation of interference or niche differentiation or in predicting the long-term outcome of an association between species40. Based on the replacement series design, a recent study showed that the multiple herbicide-resistant bentgrass (Apera spica-venti (L.) P. Beauv) was more competitive toward winter wheat than the susceptible bentgrass42.

This study aimed to assess the impact of habitat conditions on the competition between (1) herbicide-resistant and herbicide-susceptible blackgrass biotypes, (2) resistant blackgrass and winter wheat, and (3) susceptible blackgrass and winter wheat. We therefore hypothesized that both habitat conditions, species/biotype frequencies, and herbicide resistance of blackgrass affect the competition of plants.

Results

Confirmation of blackgrass biotype resistance to ALS and ACCase inhibitors

The amplification of the blackgrass ALS sequence resulted in the generation of a 1919 bp nucleotide sequence. Mutations were identified in the analyzed nucleotide sequence fragment, where 22 changes were synonymous and seven were nonsynonymous. The analysis of the amino acid sequence to find mutations known to confer resistance to ALS inhibitors revealed the presence of an amino acid substitution at position P197. Two mutations were found: P197A and P197T (Fig. 1A).

Figure 1.

Figure 1

The alignment of blackgrass ALS (A) and ACCase (B) amino acid sequence fragments derived from the plants belonging to the R biotype. The red arrow indicates the mutations known to confer herbicide resistance to ALS or ACCase inhibitors. (A) The uppercase letters (A, B, or C) in sequence names represent DNA templates used in PCR—consisting of pooled equal amounts of DNA isolated from two plants. Amino acid numbering refers to the blackgrass ALS sequence (B). The numbers in the sequence names represent the plant number. The amino acid numbering refers to blackgrass ACCase sequence, a–c—clone name.

The amplification of the blackgrass ACCase sequence fragment resulted in the generation of 2879 bp nucleotide sequences comprising nucleotides from 9223 to 120,101 in the ACCase sequence. The analyzed fragment contained a DNA sequence encoding the carboxyl-transferase (CT) domain (nucleotides from 1117 to 2765 of the analyzed PCR product), which is known to be the site of action for the active substance of the herbicides belonging to group 1. Four mutations were identified in the analyzed nucleotide sequence of the CT domain, where three changes were synonymous and one was nonsynonymous. The nonsynonymous mutation resulted in the substitution of Trp to Leu at position 1999 in the amino acid sequence (Fig. 1B), which is a mutation known for conferring resistance to ACCase inhibitors.

Competition between resistant and susceptible biotypes of blackgrass

ANOVA effects for the relative plant biomass (BCRb) and the relative grain number (BCRgn) of S and R blackgrass biotypes are presented in Table 1. The single effect for site and the interaction effect for year × site were significant for both BCRb and BCRgn, while BCRgn was also significantly affected by the single effect of year.

Table 1.

Mean squares from the three-way analysis of variance for the competitive ratio of susceptible (S) and herbicide-resistant blackgrass (R) calculated for the relative plant biomass (BCRb) and relative grain number (BCRgn).

Source of variation df BCRb BCRgn
Year 1 0.01 0.91**
Site 6 0.33*** 0.81***
Year × site 6 0.27*** 0.72***
Residual 60 0.06 0.13

df degrees of freedom.

*P < 0.05; **P < 0.01; ***P < 0.001.

The values of BCRb (BCRgn) < 1 indicate that the R biotype is more competitive toward the S biotype in the case of biomass (grain) production. In contrast, if BCRb (BCRgn) > 1, then the S biotype is more competitive toward R.

A detailed site × year comparison showed that BR and BS biotypes competed differently. During 2018/19, the BR biotype was more competitive in BCRb at two sites, i.e., Lipnik and Swojczyce, and in BCRgn at one site, i.e., Swojczyce (Fig. 2A). The BS biotype was also more competitive toward BR in BCRb in two sites, i.e., Wrocław and Mochełek, and in BCRgn in all the sites, except for Swojczyce. There was a positive correlation (r = 0.69) between BCRb and BCRgn in 2018/19, but the correlation was nonsignificant (Fig. 3A). In terms of the correlation of each competitive ratio in 2018/2019 with the hydrothermal coefficient K, a negative correlation was found, especially for BCRgn (r = − 0.50) (Fig. 3B,C), indicating that the drier the weather was, the more competitive the BS biotype; however, the trends were not significant. There was no correlation found for the competitive ratios and the soil conditions, expressed here as a percentage content of sand in the soil (Fig. 3D,E).

Figure 2.

Figure 2

Competitive ratio for plant biomass (BCRb) and grain (BCRgn) between susceptible and herbicide-resistant blackgrass biotypes in the years of study for six sites in Poland. Mean (n = 6) ± standard error. Competitive ratio values < 1 indicate that the herbicide-resistant biotype of blackgrass is more competitive than the susceptible biotype.

Figure 3.

Figure 3

Correlation coefficients (r-Pearson) and linear regression of competitive ratio for biomass (BCRb) and grain numbers (BCRgn) between susceptible and herbicide-resistant blackgrass and between hydrothermal coefficient (K), sand content, and BCRb and BCRgn in two years of study (A–E)—2018/2019, (F–J)—2019/2020.

In the 2019/20 season, the average BCRgn value was significantly, by 38%, lower than that in 2018/19, whereas the value of BCRb was similar (Fig. 2B). During that season, the BR biotype was more competitive toward BS again in Swojczyce but also in Mochełek and in terms of BCRb in Wrocław and BCRgn in Lipnik. In this season, both the competitive ratios BCRb and BCRgn were positively (r = 0.87) and significantly correlated (Fig. 3F). The hydrothermal conditions K indicated mostly humid conditions in Poland in the 2019/20 season (Table 9, Materials and methods section). The r-Pearson correlations between the K coefficient and the BCRb (BCRgn) indexes had the opposite direction (r = 0.7 and 0.59, respectively) as in the dry season of 2018/2019. The increasing K provoked an increase in the competitiveness of the S biotype, both in biomass and grain production (Fig. 3G,H). On the other hand, a negative correlation occurred in the 2019/2020 season between the sand content [%] in the soil and BCRb (BCRgn), r = − 0.70 and r = − 0.85 (significant), respectively (Fig. 3 I,J). The higher the sand content in the soil was, the higher the competitiveness of the BR biotype towards BS.

Table 9.

Hydrothermal coefficient (K) calculated for the seasons 2018/19 and 2019/20 for the study sites.

Study site 2018/19 Classification 2019/20 Classification
Lipnik 1.2 Relatively dry 2.7 Humid
Mochełek 0.7 Dry 3.0 Humid
Winna Góra 1.0 Dry 0.8 Dry
Czesławice 1.5 Optimal 4.0 Humid
Swojczyce 1.5 Optimal 2.4 Humid
Wrocław 1.1 Relatively dry 1.6 Optimal
Mydlniki 3.3 Humid 2.0 Humid

Competition between winter wheat and resistant/susceptible biotypes of blackgrass

The emergence of winter wheat (W) was noted 8–16 and 6–19 days after sowing in 2018 and 2019, respectively (Table 2). The fastest emergence of W was noted in 2018 in Mydlniki and Lipnik and the longest in Mochełek and Czesławice. Even though the dates of sowing for both W and B were the same, B emerged, 0–15 days later than W at most sites. In 2018, the emergence of B on the same day as W occurred in Lipnik and Mochełek, while in Winna Góra and Mydlniki, B emerged 6 days after W. In autumn 2019, the emergence of W and B was at the same date in Mochełek and Mydlniki (Table 2).

Table 2.

Dates of winter wheat and blackgrass emergence, number of days from wheat sowing until emergence, and the emergence of blackgrass to wheat.

Site Autumn 2018 Autumn 2019
W1 Days to W emergence B2 The emergence of B to W (average, days) W Days to W emergence B The emergence of B to W (average, days)
Lipnik 25.10 8 25.10 0 25.10 9 29.10  + 4
Mochełek 02.11 16 02.11 0 02.11 16 02.11 0
Winna Góra 30.10 12 05.11  + 6 16.11 16 31.10  + 15
Czesławice 23.10 15 25.10  + 2 24.10 15 26.10  + 2
Swojczyce 23.10 10 26.10  + 3 05.11 19 26.11  + 11
Wrocław 05.11 11 08.11  + 3 14.10 6 18.10  + 4
Mydlniki 12.10 8 18.10  + 6 24.10 18 24.10 0

1W winter wheat.

2B blackgrass.

The ANOVA for WBCRgn and WBCRb displays significant effects for competitive ratios related to the site and the interaction year × site (Table 3). Regarding WBCRgn, a significant effect was also detected in the interaction site × biotype. For WBCRb, the interaction of year × biotype × site was also significant.

Table 3.

Mean squares from the three-way analysis of variance for the competitive ratio of winter wheat (W) and herbicide-resistant or herbicide-susceptible blackgrass (B) calculated for the relative grain number (WBCRgn) and plant biomass (WBCRb).

Source of variation df WBCRgn WBCRb
Year 1 2.87 0.67
Site 6 10.9*** 11.7***
Blackgrass biotype 1 1.20 0.22
Year × site 6 2.62** 1.54**
Year × biotype 1 0.02 2.94**
Site × biotype 6 2.45*** 0.27
Year × biotype × site 6 1.18 3.19***
Residual 140 0.81 0.36

df degrees of freedom.

*P < 0.05; **P < 0.01; ***P < 0.001.

The individual model of competition between blackgrass and winter wheat for each site, both R and S biotypes, and during two seasons was confirmed by the χ2 goodness-of-fit. They are presented in the figures in the supplemental materials (Figs. S1–S7). A typical model for the competition between winter wheat (W) and blackgrass (B) occurred in two variants: model IIa, which represents the higher relative yield of B, and model IIb, when the higher relative yield was attributed to W (Fig. 4).

Figure 4.

Figure 4

The models of competition between winter wheat (W) and blackgrass (B) for the replacement series experiments. The vertical axis represents relative values of a grain number or biomass, whereas the horizontal axis represents the proportion (0 to 1) of species in a mixture. Legend: green line—B; red line—W, grey line—B + W.

The average competitive ratios for both biomass (WBCRb) and grain number (WBCRgn) were similar for the susceptible and resistant B biotypes in the competition with W (Figs. 5 and 6). However, in terms of WBCRb, there was a significant difference between seasons, with the R biotype being less competitive in 2018/2019 than in 2019/2020. Stronger competitiveness in biomass production was attributed to BR in the five locations in 2019/2020 (Mydlniki, Lipnik, Czesławice, Mochełek and Swojczyce) (Fig. 5C), while in 2018/2019, it was only at two locations, i.e. Swojczyce and Mydlniki (Fig. 5A). In 24 cases across Poland, W was more competitive than B in the mixture, as the RY (relative yield) of W was higher in the mixture (convex line) than the RY of B (concave line)—Model IIb (Fig. 4). Mydlniki was the only site where B, both R and S biotypes, was more competitive in the mixture with W, or no competitiveness occurred between both species in both seasons (Fig. S7) The competitive ratios for Mydlniki for the WBCRgn and WBCRb were low, 0.7–1.4 and 0.9–1.0, respectively (Figs. 5 and 6). Additionally, in the 2018/19 season, both the S and R biotypes in Swojczyce were more competitive toward W in the WBCRgn (Fig. 6A,C).

Figure 5.

Figure 5

The competitive ratio for biomass production (WBCRb) between winter wheat and herbicide-resistant (BR)/susceptible (BS) blackgrass in the years of study for seven sites in Poland. Competitive ratio values < 1 indicate that blackgrass is more competitive than wheat.

Figure 6.

Figure 6

The competitive ratio for grain numbers (WBCRgn) between winter wheat and herbicide-resistant (BR)/susceptible (BS) blackgrass in the years of study for seven sites in Poland. Competitive ratio values < 1 indicate that blackgrass is more competitive than wheat.

Principle component analysis and cluster analysis

The relationships between all traits of winter wheat W grown with BR and BS, as well as the environmental parameters, were calculated using principal multidimensional component (PCA) and cluster (CA) analyses separately for the 2018/19 (Fig. 7A,C) and 2019/20 (Fig. 7B,D) seasons, as the variation in years was in interaction with sites or biotype. Three characteristics of soil (sand, silt, and clay contents) were uniform in the two seasons, while the hydrothermal coefficients K and the W parameters varied in both seasons. In 2018/19, the first component (Y1) explained 53.1% of the total variance. It was significant for the silt content (× 2) and plant biomass (× 8), seed yield (× 6), and number of seeds (× 9) in the same direction, while the content of sand (× 1) was significant in the opposite direction: Y1 = 0.84x1 − 0.83x2 − 0.44x3 − 0.63x4 − 0.65x5 − 0.90x6 − 0.25x7 − 0.70x8 − 0.90x9. (× 1 − × 9 correspond to the characteristics in Fig. 7A). The second principal component (Y2) explained 23.8% of the total variance (Y2 = − 0.39x1 + 0.29x2 + 0.66x3 + 0.23x4 − 0.15x5 − 0.16x6 − 0.91x7 − 0.62x8 + 0.06x9), and it was significant for the thousand grain weight (TGW, × 7) (Fig. 7A). The projection of seven locations across Poland, where the BS/BR mixtures with W were planted, displayed two distinctive groups, i.e., Lipnik, Mochełek, Winna Góra, and Swojczyce, highly related to the sandy soil (mean = 76.63%) and low moisture (K = 1.1) in 2018/19 (Fig. 7C). Therefore, the alternation in significantly lower seed number (111.4) and seed yield (5.06) was found (Table 4). The second group consisted of sites, e.g., Czesławice, Wrocław, and Modlniki, where the W yield was significantly higher due to heavier soils (silt content = 49.25) and a higher hydrothermal coefficient (K = 1.97), so the seed number amounted to 245.1 and the yield amounted to 10.19 (Table 4).

Figure 7.

Figure 7

Projection of environmental characteristics and winter wheat characteristics growing in the mixtures with blackgrass resistant (R) and susceptible (S) biotypes in the seasons 2018/19 (A,C) and 2019/20 (B,D) on two principal components. Sites of experiments: Lp Lipnik, Mo Mochełek, Md Mydlniki, Cz Czesławice, Sw Swojczyce, WG Winna Góra, Wr Wrocław. TGW thousand grain weight, K hydrothermal coefficient.

Table 4.

The means of winter wheat characteristics and environmental parameters in the two groups of experimental sites according to the k-means analysis.

xi Characteristic Year Group 1 Group 2 P
Lp S; Lp R; Mo S Mo R
Sw S; Sw R; WG S; WG R
Cz S; Cz R; Wr S;
Wr R; Md S; Md R
1 Sand (× 1) 76.63 36.93 ***
2 Silt (× 2) 20.15 49.20 **
3 Clay (× 3) 3.28 13.87 ***
4 Coefficient K (× 4) 2019 1.10 1.97 *
2020 2.23 2.53 ns
5 Length (× 5) 2019 59.55 73.95 ns
2020 68.28 79.72 ns
6 Yield (× 6) 2019 5.06 10.19 **
2020 6.62 11.68 **
7 TGW (× 7) 2019 42.24 41.16 ns
2020 43.43 42.87 ns
8 Biomass (× 8) 2019 16.22 23.64 ns
2020 27.87 28.81 ns
9 Seeds number (× 9) 2019 111.4 245.1 ***
2020 162.1 278.4 **

Sites of experiments: Lp Lipnik, Mo Mochełek, Md Mydlniki, Cz Czesławice, Sw Swojczyce, WG Winna Góra, Wr Wrocław. Mixture with (R) resistant, (S) susceptible biotype of blackgrass; TGW thousand-grain weight, K hydrothermal coefficient, P probability, *0.05, **0.01, ***0.001, ns not significant.

In the second season, the first principal component Y1 explained 50.9% of the total variance (Y1 = 0.92x1 − 0.62x2 − 0.80x3 + 0.02x4 − 0.44x − 0.92x6 − 0.11x7 − 0.55x8 − 0.91x9), and the second principal component Y2 explained 22.1% of the total variance of nine characteristics (Y2 = 0.55x1 − 0.91x2 + 0.16x3 − 0.75x4 − 0.51x5 + 0.31x6 + 0.67x7 + 0.71x8 + 0.18x9 (× 1 −  × 9 correspond to the characteristics in Fig. 7B). The projection of seven locations where W was planted in the mixtures with BS or BR configured a symmetric distribution on Y1 and Y2 (Fig. 7D). At sites Czesławice, Wrocław and Mydlniki, according to the heavy soil, the W yield parameters were significantly higher than those at other sites, e.g., Lipnik, Mochełek, Swojczyce and Winna Góra, despite the uniform hydrothermal conditions in 2019/20 (Table 4).

Discussion

In Poland, blackgrass herbicide resistance has been recorded mainly in the northern and northeastern parts (Pomerania, Warmia-Mazury) and the Lower Silesia region24,43. The resistant biotype tested in our study had mutations at single positions within the ALS and ACCase sequences. In the ALS amino acid the changes at position P197 were identified. P197T was previously reported in A. myosuroides plants44,45, while P197A was detected in the Lolium rigidum and Conyza canadensis populations46,47. The W1999L mutation found in the ACCase sequence was also acknowledged to confer resistance to the ACCase-inhibiting herbicide fenoxaprop in Alopecurus japonicus48.

Various modeling approaches might be employed to examine the effectiveness of integrated weed management, reducing the need for more expensive and cumbersome long-term in situ experimentation49. We conducted short-term (two growing seasons) experiments in situ in the replacement series model as a tool to investigate the competitiveness between blackgrass-blackgrass and wheat-blackgrass with environmental factors and blackgrass herbicide resistance.

Within two years of study, the tested blackgrass biotypes, herbicide-susceptible (BS) and herbicide-resistant (BR), displayed different competitiveness with each other and with winter wheat. Based on two competitive ratios, i.e., plant biomass and the number of grains produced by the tested plants, we could draw main competitive relations, significant from biological and agronomic points of view50, in different sites across Poland. The sites in this experiment were diversified in terms of soil conditions, from the lightest loamy sands (Lipnik, Mochełek), sandy loams (Winna Góra, Swojczyce), medium-heavy sandy clay loam (Wrocław), to heavy and compacted silt loams (Mydlniki, Czesławice). Additionally, two vegetative seasons during the studies displayed contrasting weather conditions; the first season was dry in most of the sites, whereas the other season was humid.

In the BR-BS experiment, on average, the BS biotype was more competitive toward the BR biotype, which was expressed by the values of the competitive ratio greater than one. This is consistent with other authors' findings, who point out that herbicide-susceptible weed biotypes perform better than resistant ones in the absence of herbicide selective pressure. For example, under drought stress, the nontarget site-resistant biotype of blackgrass germinated less than the susceptible biotype51. In other studies, the blackgrass biotype with enhanced metabolism resistance to ALS inhibitors produced longer tillers than the susceptible plants during vegetative growth. However, there was a reproductive cost of resistance, i.e., 27% fewer seed heads per plant and a 23% reduction in total seed head length52. The worse performance of herbicide-resistant biotypes, the so-called resistance penalty, was also observed in other herbicide-resistant weed species53–55. Our study also showed site-specific correlations between both competitive ratios of BR and BS biotypes, especially in the humid season. We found that the content of sand affected the competitive relations between the BS-BR biotypes during the humid season. Specifically, the more sand there was in the soil, the higher the competitiveness of the BR biotype toward the BS biotype, and vice versa. In our opinion, this finding suggests the existence of internal plasticity of blackgrass biotypes that change their intraspecies competitive efforts depending on the site-specific conditions.

The diversified soil and weather conditions also affected the studied parameters of winter wheat (seed number and biomass), as was observed in the wheat (W) – barnyardgrass (BS/BR) experiment. The multivariate data mining at each site and BS/BR mixtures with winter wheat explained the division into two distinctive in situ groups. The first group was highly related to sandy soil and low moisture. In contrast, the second group had heavier soils of higher moisture where wheat productivity was significantly higher, as confirmed in the studies by56. In our study, wheat cv. Arkadia has been shown to suppress blackgrass at most study sites, particularly in the humid season of 2019/20 and regardless of the herbicide-susceptibility level of B. Increasing wheat competitiveness against weeds through a combination of breeding and planting design (planting density, row spacing, and orientation) has a strong potential to reduce weed-induced yield losses in wheat30,57. Sardana58 declared that cultivars possessing traits such as fast germination and growth, high biomass, and large leaf area have a competitive advantage over weeds. Lazzaro59 listed four traits linked to the competitive ability of wheat against weeds, i.e., aboveground biomass before stem elongation, tillering index, plant height, flag leaf morphology, and two production-related traits (grain yield and thousand-kernel weight). The combined effect on wheat-blackgrass interactions was also studied by Andrew and Storkey60 using the INTERCOM model parameterized for two wheat cultivars with contrasting competitive ability and simulations run across 10 years at different crop densities and two sowing dates. The authors found that sowing date, sowing density, and cultivar choice largely work in a complementary fashion, allowing enhanced competitive ability against weeds when used in combination. However, the relative benefit of choosing a more competitive cultivar decreases at later sowing dates and higher crop densities. Perhaps another important element in the competitiveness of W against B in our study that supported W competitiveness was the time of W emergence, which was in the vast majority of sites earlier than the emergence of B, or at least both species emerged on the same day. As other studies confirm, a delay in weed emergence to wheat emergence enhances wheat competitiveness toward weeds and a final wheat grain yield42,61–63.

The observed W-B competition pattern exception was noted only in two sites, namely, Mydlniki and Czesławice (south and south-eastern Poland), located on heavy, clay soils, where B was more competitive toward W during humid seasons. Blackgrass also takes advantage of environmental conditions, such as clay content and moisture in the soil6,10, which could support its competitiveness with W at both sites.

Conclusions

Our study showed all the competitive replacement series models between blackgrass—blackgrass and winter wheat—blackgrass of different herbicide susceptibilities (R—resistant, S—susceptible). There were site-specific changes in the blackgrass R and S competitive abilities, depending on the sand soil content, supporting the thesis about blackgrass plasticity depending on environmental conditions. Winter wheat in our study was a strong competitor for blackgrass; only in three out of a total of 28 cases was blackgrass more competitive toward wheat. One of the winter wheat characteristics that could affect this relationship was that wheat emerged 15–0 days earlier than blackgrass. A more detailed understanding of belowground competition may also be required to increase the robustness of the predictions when water or nutrients are limiting.

Materials and methods

Plant material

Ethics approval and consent to participate. The collection of biotypes of blackgrass samples from plantations was permitted by local famers on survey. The plant collection and the study complied with local and national (Poland) regulations. The study was approved by the institutional research ethics committee of Institute of Plant Protection in Poznań, and written informed consent was obtained from each participant. All the methods in this manuscript were carried out in accordance with relevant guidelines and regulations.

Two biotypes of blackgrass (B) with contrasting susceptibility to herbicides were used in the two-year-long pot experiments at seven sites across Poland. Both biotypes were collected in Poland in 2017. The herbicide multiresistant (BR) biotype was from western Poland, voivodship Lubuskie, from winter wheat. The susceptible biotype (BS) was from eastern Poland from the ruderal site. An initial level of herbicide resistance of both BR and BS biotypes was confirmed in two sets of greenhouse dose–response tests carried out in 2017 and is presented in Table 5.

Table 5.

Characteristics of herbicide multiresistant (BR) and herbicide-susceptible (S) biotypes of blackgrass used in the pot experiments.

Biotype Herbicide (HRAC group)
Fenoxaprop-P (HRAC A) Pinoxaden (HRAC A) Piroxulam (HRAC B) Iodosulfuron (HRAC B) Pendimathalin (HRAC K1)
R RRR (> 2650) RRR (684) RRR (> 288) RRR (> 3200) RRR (> 51000)
S S (< 51.0) S (< 25.5) S (< 12.5) S (< 5.0) S (< 300)

The numbers in brackets relate to the effective dose (g ha−1) of the active ingredient causing a 50% reduction in plant biomass (ED50).

1S susceptible.

2RRR highly resistant.

Molecular analysis of the herbicide-resistant blackgrass biotype

Leaves from plants of the multiresistant BR biotype in the leaf development stage (BBCH 13–14) were ground in a mortar using liquid nitrogen. Genomic DNA was isolated using a NucleoSpin Plant II Mini kit for DNA from plants (Mecherey-Nagel, Düren, Germany). Blackgrass ALS and ACCase gene sequences were amplified by means of PCR. For the analysis of the ALS sequence, equal amounts of DNA isolated from two plants were pooled and used in PCR, while for the analysis of the ACCase sequence, DNA was isolated from one plant. The 50 µl reaction mixture contained 5.0 µl of 10X PfuUltra II reaction buffer (Agilent Technologies, Santa Clara, CA, USA), 0.5 µl of dNTPs mix (25 mM each), 1.0 µl of 10 µM forward primer and reverse primers (Table 2), 100 ng of genomic DNA, and 1 U of PfuUltra II Fusion HS DNA polymerase (Agilent Technologies). PCR was carried out in a Mastercycler nexus (Eppendorf, Hamburg, Germany). The PCR program consisted of the following steps: an initial denaturation at 95 °C for 2 min, 35 cycles of amplification: 20 s at 95 °C, 20 s at the temperatures listed in Table, and 30 s or 45 s at 72 °C for the amplification of ALS and ACCase sequences, respectively. The final elongation step was set to 2 min at 72 °C. The reaction products were separated with 1% gel electrophoresis followed by purification from the gel with a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA). ALS and ACCase sequence fragments were ligated to the pJET1.2 plasmid using a CloneJET PCR Cloning Kit (Thermo Fisher Scientific, Waltham, MA, USA) and cloned into DH10B Escherichia coli competent cells (Table 6). Three plasmids were isolated from E. coli cells using the NucleoSpin Plasmid (Mecherey-Nagel). Three plasmids containing inserts synthesized in each PCR were digested with BglII to confirm the presence of the insert and sequenced by Genomed (Warsaw, Poland). Sequencing data were analyzed using the BioEdit Sequence Alignment Editor 7.5.564.

Table 6.

Primer sequences used in this study.

Gene Primer sequence (5′–3′) Amplicon length (bp) Annealing temperature (°C) References
ALS F: TACCCAAACCTACTCTCCCG 1919 61.6 44
R: TGATCAGGCACATTGCACC
ACCase F: AGGACACGCAGAGGAACCT 2879 60.6 Designed in this study
R: GCAGCTGCCTCAGAAGCCAA

Description of the replacement-series pot experiments

Following the replacement series competition model65, the pot experiments in field conditions were designed and set across Poland at six or seven sites (Fig. 8, Table 7). The experimental design was based on randomized blocks with three replications and took place in the next two growing seasons, 2018/19 and 2019/20.

Figure 8.

Figure 8

Study site distribution. Lp Lipnik; Mo Mochełek; WG Winna Góra; Cz Czesławice; Sw Swojczyce; Wr Wrocław; Md Mydlniki.

Table 7.

Coordinates and soil characteristics of the study sites.

Site Latitude Longitude Particles (%) Texture N1 P K OM pH
Sand Silt Clay
Lipnik 53°34′ N 14°95′ E 85.4 14.0 0.6 Loamy sand 0.11 232 301 2.2 6.4
Mochełek 53°20′ N 17°86′ E 84.7 14.3 1.1 Loamy sand 0.17 238 296 2.6 6.6
Winna Góra 52°12′ N 17°26′ E 70.4 26.3 3.4 Sandy loam – 137 162 1.1 5.5
Czesławice 51°18′ N 22°16′ E 15.8 72.6 11.6 Silt loam 0.12 158 196 1.5 6.4
Swojczyce 51°06′ N 17°08′ E 66.0 26.0 8.0 Sandy loam 0.51 128 125 1.2 6.5
Wrocław 51°04′ N 17°02′ E 56.0 23.0 21.0 Sandy (clay) loam 0.70 182 197 1.2 6.2
Mydlniki 50°07′ N 19°84′ E 39.0 52.0 9.0 Silt loam 0.07 173 196 1.1 6.3

1N nitrogen (%), P phosphorus (mg kg−1), K potassium (mg kg−1), OM organic matter (%).

At each of the sites, pots (7 l vol., 0,0075 m2 area) were dug into the soil at a distance of 0.5 m, and ca. A total of 2.5 cm of pots remained above the soil surface. Subsequently, they were filled with local arable soil from the 0–30 cm layer. Prior to placing it in the pots, the soil was sieved through a metal mesh to remove stones and other larger impurities. Soil samples were taken for detailed texture and chemical analyses (Table 7). Black foil was placed in the area between pots, and the whole experiment was protected from insects and birds with a fine plastic net.

The layout of pots and the distribution of plants in a pot remained the same at every site. The competitive effects of BR and BS biotypes were studied in two proportions of plants R4:S6 and R6:S4 at six sites, i.e., Lipnik, Mochełek, Czesławice, Swojczyce, Wrocław, and Mydlniki. The competitive effects of BR or BS were tested against winter wheat (W) cv. Arkadia (breeder: HR Danko PL) at all seven sites. The proportions of winter wheat W and BR were in the ratios of W10:R0, W8:R2, W6:R4, W4:R6, W2:R8, and W0:R10. The same ratios were used for the W and BS plants: W10:S0, W8:S2, W6:S4, W4:S6, W2:S8, and W0:S10.

Seeds of the W, BR, and BS biotypes were sown on the same day, optimal for W (Table 8). The grains of B were sown at a depth of 0.5 cm, and W was sown at a depth of 2 cm, with a few additional grains per spot. The sowing spot of each plant was marked.

Table 8.

Dates of winter wheat sowing and harvest.

Study site 2018/19 2019/20
Sowing Harvest Sowing Harvest
Lipnik 18.10.2018 10.07.2019 17.10.2019 19.07.2020
Mochełek 17.10.2018 03.07.2019 17.10.2019 08.07.2020
Winna Góra 18.10.2018 11.07.2019 15.10.2019 23.07.2020
Czesławice 09.10.2018 24.07.2019 08.10.2019 23.07.2020
Swojczyce 13.10.2018 17.07.2019 17.10.2019 28.07.2020
Wrocław 25.10.2018 18.07.2019 08.10.2019 09.07.2020
Mydlniki 04.10.2018 13.06.2019 06.10.2019 21.07.2020

In the spring, the density of W and B plants was regulated according to the layout. During that time, N fertilization was applied in 30.0 g NH4NO3 m−2; 50% of the dose was applied at the beginning of vegetation, and the remaining dose was applied at wheat shooting (BBCH 31–33). Wheat and blackgrass were harvested at full-grain maturity (BBCH 97–99). At harvest, a fresh mass of plants, both W and B, was weighed. Wheat plants were measured with a ruler from the base of shoots up to the highest ear's tip. All grains of W/B plants were counted from the pot, and their fresh mass was weighed and calculated per plant for statistical analysis. Based on three samples of 100 grains, the 1000 grain weight (TGW) of W and B was calculated.

Weather conditions

Weather data, i.e., precipitation and air temperature, were collected during the study from the nearest weather stations (Tables S1 and S2). The weather data for the months from winter wheat sowing till harvesting, with temperatures > 0 °C, namely, October–November 2018 and April–July 2019, October–November 2019, and April–July 2020, were valorized using the hydrothermal coefficient (K) according to the equation:

K=10P/t, 1

where P is the precipitation total and t is the sum of the daily mean air temperature values. The classification for Poland's temperate climate is K < 1.3 moderately dry seasons; 1.3–1.6 optimum; and > 1.6 humid season66. The calculated K values are presented in Table 9.

Statistical methods

Two parameters, namely, fresh plant biomass and the number of seeds per plant, were measured for both winter wheat W and blackgrass B. The blackgrass competitive ratio (BCR) was calculated for the mixtures of susceptible blackgrass (BS) with resistant blackgrass (BR), representing the comparative growth based on plant fresh biomass (BCRb) and the number of grains (BCRgn). The competitive ratio between wheat and blackgrass WBCR was calculated separately for the mixtures of W and BS and W and BR.

The BCR and WBCR were calculated according to the formula described by Hoffman and Buller67:

BCR=1p/p/RYBS/RYBR, 2

where RY is the relative yield and p is the proportion of biotype.

If the competitive ratio BCR < 1, the R biotype is more competitive toward the S biotype; if BCR > 1, the S biotype is more competitive toward the R biotype.

WBCR=1p/p/RYW/RYB, 3

where RY is the relative yield and p is the proportion of species.

If the competitive ratio WBCR < 1, B is more competitive toward W; if WBCR > 1, W is more competitive toward B.

The RY and the total relative yield (TRY) for all the measured parameters of B and W were calculated according to the formulas:

RYW=pWmix/Wmon, 4
RYB=p-1Bmix/Bmon, 5
TRY=RYW+RYB, 6

The analysis was performed for the replacement series experiment63. where RYW is the relative yield of W; RYB is the relative yield of B; p is the proportion of species; Wmix is the value of the W parameter analyzed for the mixture; Wmon is the value of the W parameter analyzed for the monoculture; Bmix is the value of the B parameter analyzed for the mixture; Bmon is the value of the B parameter analyzed for the monoculture; and TRY is the total relative yield. The RY values were measured for both W and B and were averaged for a single plant.

The biomass and grain yield or seed number, calculated into RY and TRY, were presented as graphs and fitted into one of the five competition models according to Radosevich68. The most explanatory models were determined by using the χ2 goodness-of-fit69, giving the best fit for all tested sites and biotypes. If RY is a straight line, it denotes no competition; a convex line shows a benefit to species; a concave line represents a loss to species. If TRY equals 1 (straight line), there is competition for the same resources between both species/biotypes. If TRY is greater than 1 (convex), there is no competition since the demand does not exceed the resources. If TRY is less than 1 (concave), an antagonism resulting in a mutual loss to the species involved becomes apparent67.

ANOVA of two models was performed, i.e. the two-way model for the year × site of plants to calculate the BCRgn and BCRb in R/S blackgrass and the three-way model for the year × site × biotype to calculate the WBCRgn and WBCRb in wheat/blackgrass. Data from the indexes were transformed to a normal distribution. The post hoc HSD Tukey test was used for the means separation. The r-Pearson correlation coefficient was calculated for relations between BCRgn/WBCRgn and BCRb/WBCRb, the relations between the hydrothermal K coefficient and BCRgn/WBCRgn and BCRb/WBCRb and the relations between sand [%] and BCRgn/WBCRgn and BCRb/WBCRb. The exploration technique of principal component analysis (PCA) was used to explain the multidimensional diversity of W and environmental variables in terms of the first two components. Five biometrical parameters of W, i.e. mean length and fresh biomass of the plant, number of seeds per plant, yield of seeds per plant, and TGW (1000 grain weight), and four environmental parameters, i.e. The hydrothermal coefficient K and soil texture were analyzed using PCA and CA (k-means procedure).

The calculations were performed in the STATISTICA 13.0 program (TIBCO Software Inc.).

Supplementary Information

Supplementary Figures. (315.2KB, docx)
Supplementary Tables. (53.7KB, docx)

Author contributions

A.W.P. designed the concept of the study with the support of all authors; A.W.P., A.S., K.M., C.P., K.D., P.K., E.K.P. performed the field experiments; B.W. performed the molecular study; A.W. processed and analyzed the data; all authors interpreted the results; A.W. wrote the draft of the manuscript under the supervision of A.S.; all authors contributed to manuscript revisions and approved its final version.

Funding

This research was funded by The National Centre for Research and Development, contract number: BIOSTRATEG 3/347445/1/NCBR/2017.

Data availability

Data available from Zenodo repository under https://zenodo.org/record/5910336.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-022-12777-2.

References

  • 1.Lutman PJW, Moss SR, Cook S, Welham SJ. A review of the effects of crop agronomy on the management of Alopecurus myosuroides. Weed Res. 2013;53:299–313. doi: 10.1111/wre.12024. [DOI] [Google Scholar]
  • 2.Maréchal PY, Henriet F, Vancutsem F, Bodson B. Ecological review of black-grass (Alopecurus myosuroides Huds.) propagation abilities in relationship with herbicide Resistance. Biotechnol. Agron. Soc. 2012;16:103–113. [Google Scholar]
  • 3.Bitarafan Z, Andreasen C. Seed production and retention at maturity of blackgrass (Alopecurus myosuroides) and silky windgrass (Apera spica-venti) at wheat harvest. Weed Sci. 2020;68:151–156. doi: 10.1017/wsc.2020.7. [DOI] [Google Scholar]
  • 4.Murdoch A, Flint C, Pilgrim R. Eyeweed: Automating mapping of black-grass (Alopecurus myosuroides) for more precise applications of pre- and post-emergence herbicides and detecting potential herbicide resistance. Asp. Appl. Biol. 2014;127:151–158. [Google Scholar]
  • 5.Meiners I. Management of Black-Grass (Alopecurus myosuroides Huds.) in Winter Wheat and Taking Into Account the Soil Activity of Post-emergence Herbicides. VVB Laufersweiler Verlag; 2015. pp. 1–202. [Google Scholar]
  • 6.Metcalfe H, et al. Defining the habitat niche of Alopecurus myosuroides at the field scale. Weed Res. 2018;58:165–176. doi: 10.1111/wre.12300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Vila-Aiub MM. Fitness of herbicide-resistant weeds: Current knowledge and implications for management. Plants. 2019;8(11):469. doi: 10.3390/plants8110469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zeller AK, Zeller YI, Gerhards R. A long-term study of crop rotations, herbicide strategies and tillage practices: Effects on Alopecurus myosuroides Huds. Abundance and contribution margins of the cropping systems. Crop Prot. 2021;145:105613. doi: 10.1016/j.cropro.2021.105613. [DOI] [Google Scholar]
  • 9.RubiodeCasas R, Donohue K, Venable DL, Cheptou PO. Gene-flow through space and time: Dispersal, dormancy and adaptation to changing environments. Evol. Ecol. 2015;29:813–831. doi: 10.1007/s10682-015-9791-6. [DOI] [Google Scholar]
  • 10.Menegat A, Milberg P, Nilsson ATS, Andersson L, Vico G. Soil water potential and temperature sum during reproductive growth control seed dormancy in Alopecurus myosuroides Huds. Ecol. Evol. 2018;8:7186–7194. doi: 10.1002/ece3.4249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chauvel B, Guillemin JP, Colbach N, Gasquez J. Evaluation of cropping systems for management of herbicide-resistant populations of blackgrass (Alopecurus myosuroides Huds.) Crop Prot. 2001;20:127–137. doi: 10.1016/S0261-2194(00)00065-X. [DOI] [Google Scholar]
  • 12.Moss SR. The survival of Alopecurus myosuroides Huds. seeds in soil. Weed Res. 1985;25:201–211. doi: 10.1111/j.1365-3180.1985.tb00636.x. [DOI] [Google Scholar]
  • 13.Heap, I. The International Herbicide-Resistant Weed Database. (2021). www.weedscience.org
  • 14.Franco-Ortega S, et al. Non-target site herbicide resistance is conferred by two distinct mechanisms in black-grass (Alopecurus myosuroides) Front. Plant Sci. 2021;12:636–652. doi: 10.1007/10.3389/fpls.2021.636652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hall TA. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acid Symp. 1999;41:95–98. [Google Scholar]
  • 16.Moss RS, Cocker KM, Brown AC, Hall L, Field LM. Characterisation of target-site resistance to ACCase-inhibiting herbicides in the weed Alopecurus myosuroides (black-grass) Pest Manag. Sci. 2003;59:190–201. doi: 10.1002/ps.623. [DOI] [PubMed] [Google Scholar]
  • 17.Marshall R, Hanley SJ, Hull R, Moss SR. The presence of two different target-site resistance mechanisms in individual plants of Alopecurus myosuroides Huds., identified using a quick molecular test for the characterisation of six ALS and seven ACCase SNPs. Pest Manag. Sci. 2013;69:727–737. doi: 10.1002/ps.3429. [DOI] [PubMed] [Google Scholar]
  • 18.Délye C, Gardin JAC, Boucansaud K, Chauvel B, Petit C. Non-target-site-based resistance should be the centre of attention for herbicide resistance research: Alopecurus myosuroides as an illustration. Weed Res. 2011;51:433–437. doi: 10.1111/J.1365-3180.2011.00864.X. [DOI] [Google Scholar]
  • 19.Burgos N, et al. Review: Confirmation of resistance to herbicides and evaluation of resistance levels. Weed Sci. 2013;61:4–20. doi: 10.1614/WS-D-12-00032.1. [DOI] [Google Scholar]
  • 20.Délye C, Duhoux A, Pernin F, Riggins C, Tranel P. Molecular mechanisms of herbicide resistance. Weed Sci. 2015;63:91–115. doi: 10.1614/WS-D-13-00096.1. [DOI] [Google Scholar]
  • 21.Keshtkar E, Mathiassen SK, Moss SR, Kudsk P. Resistance profile of herbicide-resistant Alopecurus myosuroides (black-grass) populations in Denmark. Crop Prot. 2015;69:83–89. doi: 10.1016/j.cropro.2014.12.016. [DOI] [Google Scholar]
  • 22.Davies LR, Neve P. Interpopulation variability and adaptive potential for reduced glyphosate sensitivity in Alopecurus myosuroides. Weed Res. 2017;57:323–332. doi: 10.1111/Wre.12264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Dixon A, Comont D, Slavov GT, Neve P. Population genomics of selectively neutral genetic structure and herbicide resistance in UK populations of Alopecurus myosuroides. Pest Manag. Sci. 2021;77:1520–1529. doi: 10.1002/ps.6174. [DOI] [PubMed] [Google Scholar]
  • 24.Adamczewski K, Matysiak K, Kierzek R, Kaczmarek S. Significant increase of weed resistance to herbicides in Poland. J. Plant Prot. Res. 2019;59:139–150. doi: 10.24425/jppr.2019.129293. [DOI] [Google Scholar]
  • 25.Stankiewicz-Kosyl M, Wrochna M, Tołłoczko M. Increase in resistance to sulfonylurea herbicides in Alopecurus myosuroides populations in north-eastern Poland. Zemdirbyste. 2020;107:249–254. doi: 10.13080/z-a.2020.107.032. [DOI] [Google Scholar]
  • 26.Wrochna, M., Stankiewicz-Kosyl, M. & Winska-Krysiak, M. Differential Reaction of Alopecurus myosuroides Biotypes to ACCase Inhibitors. 01 May 2021 by MDPI in 1st International Electronic Conference on Agronomy session Weed Invasion, Biology and Management in Agricultural Settings. 10.3390/IECAG2021-09742 (2021).
  • 27.Blair A, Cussans JW, Lutman PJW. Biological Framework for Developing a Weed Management Support System for Weed Control in Winter Wheat: Weed Competition and Time of Weed Control. Brighton Conference Weeds. BCPC; 1999. pp. 753–760. [Google Scholar]
  • 28.Menegat A, Nilsson ATS. Interaction of preventive, cultural, and direct methods for integrated weed management in winter wheat. Agron. 2019;9:564. doi: 10.3390/agronomy9090564. [DOI] [Google Scholar]
  • 29.Walker SR, Medd RW, Robinson GR, Cullis BR. Improved management of Avena ludoviciana and Phalaris paradoxa with more densely sown wheat and less herbicide. Weed Res. 2002;42:257–270. doi: 10.1046/j.1365-3180.2002.00283.x. [DOI] [Google Scholar]
  • 30.van der Meulen A, Chauhan BS. A review of weed management in wheat using crop competition. Crop Prot. 2017;95:38–44. doi: 10.1016/j.cropro.2016.08.004. [DOI] [Google Scholar]
  • 31.Bajwa AA, Walsh M, Chauhan BS. Weed management using crop competition in Australia. Crop Prot. 2017;95:8–13. doi: 10.1016/j.cropro.2016.08.021. [DOI] [Google Scholar]
  • 32.Thompson CR, Thill DC, Shafii B. Growth and competitiveness of sulfonyhirea-resistant and-susceptible kochia (Kochia scoparia) Weed Sci. 1994;42:172–179. doi: 10.1017/S0043174500080231. [DOI] [Google Scholar]
  • 33.Mobli A, Yadav R, Chauhan BS. Enhanced weed-crop competition effects on growth and seed production of herbicide-resistant and herbicide-susceptible annual sowthistle (Sonchus oleraceus) Weed Biol. Manag. 2020;20:38–46. doi: 10.1111/wbm.12197. [DOI] [Google Scholar]
  • 34.Travlos IS. Competition between ACCase-inhibitor resistant and susceptible sterile wild oat (Avena sterilis) biotypes. Weed Sci. 2013;61:26–31. doi: 10.1614/WS-D-12-00065.1. [DOI] [Google Scholar]
  • 35.Shrestha A, Hanson BD, Fidelibus MW, Alcorta M. Growth, phenology, and intraspecific competition between glyphosate-resistant and glyphosate-susceptible horseweeds (Conyza canadensis) in the San Joaquin Valley of California. Weed Sci. 2010;58:147–153. doi: 10.1614/WS-D-09-00022.1. [DOI] [Google Scholar]
  • 36.Costa LO, Rizzardi MA. Competitive ability of wheat in association with biotypes of Raphanus raphanistrum L. resistant and susceptible to als-inhibitor herbicides. Cienc. Agrotec. 2015;39:121–130. doi: 10.1590/S1413-70542015000200003. [DOI] [Google Scholar]
  • 37.Storkey J, Cussans JW, Lutman PJW, Blair AM. The combination of a simulation and an empirical model of crop/weed competition to estimate yield loss from Alopecurus myosuroides in winter wheat. Field Crop Res. 2003;84:291–301. doi: 10.1016/S0378-4290(03)00096-0. [DOI] [Google Scholar]
  • 38.Munier-Jolain NM, Chavvel B, Gasquez J. Long-term modelling of weed control strategies: Analysis of threshold-based options for weed species with contrasted competitive abilities. Weed Res. 2002;42:107–122. doi: 10.1046/j.1365-3180.2002.00267.x. [DOI] [Google Scholar]
  • 39.Park SE, Laurence BR, Watkinson AR. The theory and application of plant competition models: An agronomic. Persp. Ann. Bot. 2003;92:741–748. doi: 10.1093/aob/mcg204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Jolliffe PA. The replacement series. J. Ecol. 2000;88:371–385. doi: 10.1046/j.1365-2745.2000.00470.x. [DOI] [Google Scholar]
  • 41.de Wit CT. On competition. Verslagen Landbouwkundige Onderzoekingen. 1960;66:1–182. [Google Scholar]
  • 42.Synowiec A, et al. Environmental factors effects on winter wheat competition with herbicide-resistant or susceptible silky bentgrass (Apera spica-venti L.) in Poland. Agron. 2021;11:871. doi: 10.3390/agronomy11050871. [DOI] [Google Scholar]
  • 43.Marczewska-Kolasa K, Kucharski M, Bortniak M. Resistance of blackgrass (Alopecurus myosuroides Huds.) to ALS inhibitors in region of south-western Poland. Progr. Plant Prot. 2022;62:76–81. doi: 10.14199/ppp-2022-010. [DOI] [Google Scholar]
  • 44.Marshall R, Moss SR. Characterisation and molecular basis of ALS inhibitor resistance in the grass weed Alopecurus myosuroides. Weed Res. 2007;48:439–447. doi: 10.1111/j.1365-3180.2008.00654.x. [DOI] [Google Scholar]
  • 45.Huang Z, et al. The target-site based resistance mechanism of Alopecurus myosuroides Huds. to pyroxsulam. Crop Prot. 2021;147:105707. doi: 10.1016/j.cropro.2021.105707. [DOI] [Google Scholar]
  • 46.Yu Q, Han H, Powles SB. Mutations of the ALS gene endowing resistance to ALS-inhibiting herbicides in Lolium rigidum populations. Pest Manag. Sci. 2008;64:1229–1236. doi: 10.1002/ps.1624. [DOI] [PubMed] [Google Scholar]
  • 47.Zheng D, et al. Cross-resistance of horseweed (Conyza canadensis) populations with three different ALS mutations. Pest Manag. Sci. 2011;67:1486–1492. doi: 10.1002/ps.2190. [DOI] [PubMed] [Google Scholar]
  • 48.Xu H, et al. Mutations at codon position 1999 of acetyl-CoA carboxylase confer resistance to ACCase-inhibiting herbicides in Japanese foxtail (Alopecurus japonicus) Pest Manag. Sci. 2014;70:1894–1901. doi: 10.1002/ps.3753. [DOI] [PubMed] [Google Scholar]
  • 49.Colbach N, Kurstjens DAG, Munier-Jolain NM, Dalbiès A, Doré T. Assessing non-chemical weeding strategies through mechanistic modelling of blackgrass (Alopecurus myosuroides Huds.) dynamics. Eur. J. Agron. 2010;32:205–218. doi: 10.1016/j.eja.2009.11.005. [DOI] [Google Scholar]
  • 50.Dass A, et al. Weed management in rice using crop competition-a review. Crop Prot. 2017;95:45–52. doi: 10.1016/j.cropro.2016.08.005. [DOI] [Google Scholar]
  • 51.Ghazali Z, Keshtkar E, Agha Alikhani M, Kudsk P. Germinability and seed biochemical properties of susceptible and non–target site herbicide-resistant blackgrass (Alopecurus myosuroides) subpopulations exposed to abiotic stresses. Weed Sci. 2020;68:157–167. doi: 10.1017/wsc.2020.9. [DOI] [Google Scholar]
  • 52.Comont D, et al. Alterations in life-history associated with non-target-site herbicide resistance in Alopecurus myosuroides. Plant Sci. 2019;10:837. doi: 10.3389/fpls.2019.00837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Keshtkar E, et al. Assessing fitness costs from a herbicide-resistance management perspective: A review and insight. Weed Sci. 2019;67:137–148. doi: 10.1017/wsc.2018.63. [DOI] [Google Scholar]
  • 54.Vila-Aiub MM, Neve P, Powles SB. Fitness costs associated with evolved herbicide resistance alleles in plants. New Phytol. 2009;184:751–767. doi: 10.1111/j.1469-8137.2009.03055.x. [DOI] [PubMed] [Google Scholar]
  • 55.Vila-Aiub MM, Neve P, Roux F. A unified approach to the estimation and interpretation of resistance costs in plants. Heredity. 2011;107:386–394. doi: 10.1038/hdy.2011.29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Bönecke E, et al. Decoupling of impact factors reveals the response of German winter wheat yields to climatic changes. Global Change Biol. 2020;26:3601–3626. doi: 10.1111/gcb.15073. [DOI] [PubMed] [Google Scholar]
  • 57.Bertholdsson NO, Weedon O, Brumlop S, Finckh MR. Evolutionary changes of weed competitive traits in winter wheat composite cross populations in organic and conventional farming systems. Eur. J. Agron. 2016;79:23–30. doi: 10.1016/j.eja.2016.05.004. [DOI] [Google Scholar]
  • 58.Sardana V, Mahajan G, Jabran K, Chauhan BS. Role of competition in managing weeds: An introduction to the special issue. Crop Prot. 2017;95:1–7. doi: 10.1016/j.cropro.2016.09.011. [DOI] [Google Scholar]
  • 59.Lazzaro M, et al. Unraveling diversity in wheat competitive ability traits can improve integrated weed management. Agron. Sust. Devel. 2019;39:6. doi: 10.1007/s13593-018-0551-1. [DOI] [Google Scholar]
  • 60.Andrew IKS, Storkey J. Using simulation models to investigate the cumulative effects of sowing rate, sowing date and cultivar choice on weed competition. Crop Prot. 2017;95:109–115. doi: 10.1016/j.cropro.2016.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Kropff MJ, Weaver SE, Smits MA. Use of ecophysiological models for crop-weed interference: Relations amongst weed density, relative time of weed emergence, relative leaf area, and yield loss. Weed Sci. 1992;40:296–301. doi: 10.1017/S0043174500057374. [DOI] [Google Scholar]
  • 62.Fahad S, et al. Weed growth and crop yield loss in wheat as influenced by row spacing and weed emergence times. Crop Prot. 2015;71:101–108. doi: 10.1016/j.cropro.2015.02.005. [DOI] [Google Scholar]
  • 63.Kaur S, Kaur R, Chauhan BS. Understanding crop-weed-fertilizer-water interactions and their implications for weed management in agricultural systems. Crop Prot. 2018;103:65–72. doi: 10.1016/j.cropro.2017.09.011. [DOI] [Google Scholar]
  • 64.Hall LM, Moss SR, Powles B. Mechanisms of resistance to Aryloxyphenoxypropionate herbicides in two resistant biotypes of Alopecurus myosuroides (blackgrass): Herbicide metabolism as a cross-resistance mechanism. Pestic. Biochem. Physiol. 1997;57:87–98. doi: 10.1006/pest.1997.2259. [DOI] [Google Scholar]
  • 65.Cousens R. Aspects of the design and interpretation of competition (interference) experiments. Weed Technol. 1991;5:664–673. doi: 10.1017/S0890037X00027524. [DOI] [Google Scholar]
  • 66.Ziernicka-Wojtaszek A. Pluviothermal regionalization of poland in light of present-day climate change. Pol. J. Environ. Stud. 2020;29(1):989–996. doi: 10.15244/pjoes/99976. [DOI] [Google Scholar]
  • 67.Hoffman M, Buhler D. Utilizing Sorghum as a functional model of crop–weed competition. I. Establishing a competitive hierarchy. Weed Sci. 2002;50:466–472. doi: 10.1614/0043-1745(2002)050[0466:USAAFM]2.0.CO;2. [DOI] [Google Scholar]
  • 68.Radosevich S. Methods to study interactions among crops and weeds. Weed Technol. 1987;1:190–198. doi: 10.1017/S0890037X00029523. [DOI] [Google Scholar]
  • 69.Throne JE, Weaver DK, Baker JE. Probit analysis: Assessing goodness-of-fit based on back transformation and residuals. J. Econ. Entomol. 1995;88:1513–1516. doi: 10.1093/jee/88.5.1513. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures. (315.2KB, docx)
Supplementary Tables. (53.7KB, docx)

Data Availability Statement

Data available from Zenodo repository under https://zenodo.org/record/5910336.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES