Skip to main content
Insects logoLink to Insects
. 2022 May 18;13(5):468. doi: 10.3390/insects13050468

Two New Synonyms of Paraleuctra orientalis (Chu, 1928) (Plecoptera: Leuctridae) Based on Morphological and Molecular Data, with Notes on Paraleuctra cervicornis Du and Qian, 2012

Yu-Ben Yang 1, Yu-Zhou Du 1,2,*
Editor: Umberto Bernardo
PMCID: PMC9145174  PMID: 35621802

Abstract

Simple Summary

Paraleuctra Hanson, 1941, is a widespread genus distributed in the east and west Nearctic and in much of the Palaearctic, with 27 valid species currently known. In China, although six Paraleuctra species have been reported, the differences among these species have not been fully explained. After checking a large number of specimens of this genus from Zhejiang Province, two junior synonyms are proposed for the species Paraleuctra orientalis (Chu, 1928).

Abstract

We recently examined specimens of the genus Paraleuctra Hanson, 1941, from Zhejiang Province and Sichuan Province, China, and two new synonyms are established based on morphological and molecular data. Paraleuctra sinica Yang and Yang, 1995, and Paraleuctra tianmushana Li and Yang, 2010, are synonymized with Paraleuctra orientalis (Chu, 1928). Additionally, we provide new images of Paraleuctra cervicornis Du and Qian, 2012, to facilitate identification of this species.

Keywords: Plecoptera, Leuctridae, Paraleuctra, synonym, China

1. Introduction

Paraleuctra Hanson, 1941, is a widespread genus mainly distributed in the east and west Nearctic and in much of the Palaearctic, with 27 valid species currently known [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15]. The stoneflies of this genus are common inhabitants of stream environments. The nymphs mainly live in cold streams, springs, rock fissure seepage and other water environments with high dissolved oxygen, feeding on mosquito larvae, plant fragments and algae. Their habitat adaptation range is narrow [16]. After emergence into adults, they inhabit the herbs, grasses or shrubs on the bank due to their weak flying ability. Adults live in groups, which is conducive to mating. After mating, the female flies back to the water to lay eggs. Adults can feed on algae, moss, lichens and leaves, allowing them to survive for days to weeks [17,18].

In China, at present, this genus remains poorly known with only six species reported: P. orientalis (Chu, 1928), P. sinica Yang and Yang, 1995, P. tianmushana Li and Yang, 2010, P. cervicornis Du and Qian, 2012, P. qilianshana Li and Yang, 2013, and P. cuihuashana Chen, 2019. The holotype of P. orientalis was destroyed and the numbers of the paratypes of P. sinica and P. tianmushana are small. The differences among these three species are not obvious or unique. The problem of how to identify these three species remains. Therefore, we went to the type locality (province) of these three species for collection to solve this problem.

The mitochondrial cytochrome C oxidase subunit 1 gene (mtCOI) and 18S rDNA of Plecoptera are stable; their gene arrangement is conserved, with few rearrangements, so they have been widely used in evolution, phylogeny, genetics, species identification [8,12,19]. After checking a large number of the specimens of Paraleuctra from Zhejiang Province, we established P. sinica and P. tianmushana as junior synonyms of P. orientalis based on the close agreement of morphological characters, COI gene sequence divergence, 18S rDNA sequence divergence and phylogenetic trees of the two genes. Additionally, we provide new images of P. cervicornis Du and Qian, 2012, to facilitate identification of this species.

2. Material and Methods

2.1. Specimen Preparation

Most of the adults of Paraleuctra live in the bushes or small trees near the clean and cold streams. Due to their weak flight ability, we used an insect catching net to shake the twigs or the branches, and the adults fell into the net. The adults of Paraleuctra have phototaxis, so they can also be collected by a light trapping method. Specimens were preserved in 75% ethanol. Male terminalia specimens were cleared in 10% NaOH. All specimens used in this study are deposited in the Insect Collection of Yangzhou University (ICYZU), Jiangsu Province, China.

2.2. Observation and Description

Morphological details were examined with a Leica MZAPO microscope. Color illustrations were taken with a KEYENCE VHX-5000. The specimens were identified as Paraleuctra species by the following features: The Paraleuctra species is small, generally no more than 10 mm, and brown or dark brown. At rest, the wings roll into a tube to the abdomen. The subanal probe and epiproct of the male are specialized (Figure 1C–E,H–J). The tergum 10 of the male terminalia is divided into two parts (Figure 2A,D,G,J). Cerci sclerotize and form a dentate process (Figure 1A,B,F,G). The sternum 8 of the female forms an obvious subgenital plate; the cercus is simple with no change (Figure 3B,C). The terminology used for description follows Yang et al. (2015) [20].

Figure 1.

Figure 1

(AE) Paraleuctra tianmushana Li and Yang, 2010 syn. nov.: (A,B) right cercus of male, lateral view; (C) subanal probe of male, dorsal view; (D) subanal probe of male, ventral view; (E) epiproct of male, lateral view. (FJ) Paraleuctra orientalis (Chu, 1928): (F,G) right cercus of male, lateral view; (H) subanal probe of male, dorsal view; (I) subanal probe of male, ventral view; (J) epiproct of male, lateral view. (The two specimens were collected from Zhejiang Province, Tianmushan. The arrow points to a small spine on the cerci.)

Figure 2.

Figure 2

(AC) Paraleuctra orientalis (Chu, 1928): (A) Male terminalia, dorsal view; (B) Male terminalia, lateral view; (C) Male terminalia, ventral view; (DF) Paraleuctra tianmushana Li and Yang, 2010 syn. nov.: (D) Male terminalia, dorsal view; (E) Male terminalia, lateral view; (F) Male terminalia, ventral view; (GI: type B, JL: type A) Paraleuctra sinica Yang and Yang, 1995 syn. nov.: (G,J) Male terminalia, dorsal view; (H,K) Male terminalia, lateral view; (I,L) Male terminalia, ventral view. (The four specimens were collected from Zhejiang Province, Tianmushan. The arrow points to a small spine on the cerci.)

Figure 3.

Figure 3

Paraleuctra orientalis (Chu, 1928): (A) female head and pronotum, dorsal view; (B) female terminalia, ventral view; (C) female terminalia, ventral view. (This specimen was collected from Zhejiang Province, Tianmushan.)

2.3. DNA Extraction, Amplification and Sequencing

The five specimens used for molecular analyses and morphological identification were collected from Zhejiang Province, Tianmushan. Genomic DNA was extracted using AxyPrep DNA tissue kits (America), following the manufacturer’s instruction.

A 1745 bp fragment covering the entire mitochondrial COI gene was amplified using a pair of specific primers [8] (F: AAACTAATAGCCTTCAAAG, R: TATWTGGAGCTTAAATCCAT) with 50 °C annealing temperature and 35 PCR cycles. PCR products were purified and sequenced by Biozeron Biotech Co. (Shanghai, China) in both directions using the same primers as above. All sequences of the COI gene were aligned using ClustalW and then cut to 658 bp for analyses.

A 491 bp fragment of 18S rDNA was amplified using a pair of primers [19] (18S a0.7: ATTAAAGTTGTTGCGGTT, 18S b2.9: TATCTGATCGCCTTCGAACCTCT). PCR products were purified and sequenced by Biozeron Biotech Co. (Shanghai, China) in both directions using the same primers as above. All sequences of 18S rDNA were aligned using ClustalW. The sequences were deposited in GenBank under accession numbers, as listed in Table 1.

Table 1.

List of taxa included in this analysis.

Genus Species GenBank Accession No.
COI Gene 18S rDNA
Paraleuctra orientalis OM836700 ON130265
Paraleuctra sinica A OM836702 ON130263
Paraleuctra sinica B OM203120 ON130264
Paraleuctra tianmushana OM836701 ON130266
Paraleuctra sp. F OM836704 ON130267
Paraleuctra cuihuashana MK995183
Paraleuctra cercia MK492251
Paraleuctra vershina MH840222 AY521878
Paraleuctra sara HQ938243
Paraleuctra occidentalis MG380092 EF622723
Perlomyia isobeae MK492252
Perlomyia utahensis EF622724
Rhopalopsole bulbifera MK111419
Leuctra fusca MK568475
Leuctra inermis EF622721

Note: F represents an undetermined female; A indicates the body color of this specimen is yellowish brown; B indicates the body color of this specimen is dark brown (the same as below).

2.4. Phylogenetic Analyses

To root the Paraleuctra section of the trees, we included as outgroups representatives of Leuctra, Perlomyia and Rhopolopsole available from GenBank (Table 1). We also added other species of Paraleuctra from either the Palearctic or Nearctic to add context to our target Paraleuctra species. Note that the outgroups and additional Paraleuctra species varied by gene used, necessitating the separation of genes for analyses.

The genetic distance and maximum likelihood (ML) analysis were computed using MEGA v. 7.0. The parameters of ML analysis are as follows—test of phylogeny: bootstrap method with 1000 bootstrap replications; substitution type: nucleotide; model/method: Kimura 2-parameter model; rates among sites: uniform rates; gaps/missing data treatment: complete deletion; ML heuristic method: nearest-neighbor-interchange (NNI); initial tree for ML: make initial tree automatically (Default-NJ/BioNJ); branch swap filter: none.

MrBayes v. 3.1.2 was utilized to generate the topology for the Bayesian inference (BI) analysis, the working procedure is as follows:

execute XXX.nex

outgroup XX, XX

lset nst = 6 rate = invgamma

showmodel

mcmc ngen = 100000 samplefreq = 100

If the value is greater than 0.01, continue; if it is less than 0.01, enter: sump burnin = 250 (total running generation/sampling frequency then divided by 4) sumt burnin = 250

3. Results

3.1. Paraleuctra orientalis (Chu, 1928)

Leuctra orientalis: Chu, 1928: 87 [2].

Rhopalopsole orientalis: Illies, 1966: 118 [21].

Paraleuctra orientalis: Zwick, 1973: 410 [22]; Du and Sivec, 2005: 40 [23]; Li et al. 2010: 47 [5]; Du and Qian, 2012: 1062 [6]; Qian and Du, 2012: 3 [24]; Qian et al. 2014: 606 [25]; Yang et al. 2015: 84 [20]; Chen, 2019: 237 [8].

Paraleuctra sinicasyn. nov.: Yang and Yang, 1995: 24 [4]; Li et al. 2010: 47 [5]; Du and Qian, 2012: 1062 [6].

Paraleuctra tianmushanasyn. nov.: Li et al. 2010: 47 [5]; Du and Qian, 2012: 1062 [6]; Li et al. 2016: 94 [26].

Type locality: China, Zhejiang Province (Lin–an).

Material examined: 2 males, China, Zhejiang Province, Longwangshan, 1999-Ⅵ-4, leg. DU Yu-Zhou (ICYZU); 21 males, 51 females, China, Zhejiang Province, Tianmushan, 2006-Ⅲ-19, leg. WANG Zhi-Jie (ICYZU); 53 males, 63 females, China, Zhejiang Province, Tianmushan, 378.36 m, N: 30.2118, E: 119.283, 2021-Ⅲ-25, leg. HUO Qing-Bo, ZHAO Meng-Yuan and XIANG Ya-Nan (ICYZU).

Distribution: China (Henan, Shaanxi, Anhui, Hubei, Sichuan, Yunan, Zhejiang, Fujian); Russia.

Remarks: At present, only six species of the genus Paraleuctra Hanson, 1941, are reported in China. Pareleuctra orientalis is widespread in China; the adults are dark brown with uniform body color, cerci somewhat sclerotized, strongly forked into two sharp prongs; the upper prong is longer than the lower prong; a spine is present near base of upper prong, projecting backwards (Figure 1F,G, Figure 2A–C and Figure 4A). Yang et al. (2015) said that P. orientalis can be distinguished from P. tianmushan as the body color of P. tianmushan is yellowish brown. The difference between P. orientalis and P. sinica should be that the male cerci of P. sinica lacks a small bulge on the dorsal arm, tergum 9 with sclerotized median strips; the female subgenital plate lobes are slightly sclerotized, with the posterior margin more roundly expanded [4,5,20].

Figure 4.

Figure 4

(A) Paraleuctra orientalis (Chu, 1928): male head and pronotum, dorsal view; (B) Paraleuctra tianmushana Li and Yang, 2010 syn. nov.: male head and pronotum, dorsal view; (C: type B, D: type A) Paraleuctra sinica Yang and Yang, 1995 syn. nov.: male head and pronotum, dorsal view. (The four specimens were collected from Zhejiang Province, Tianmushan).

Results and Discussion: The holotype of P. orientalis was destroyed and the numbers of the paratypes of P. sinica and P. tianmushana are small. The differences among these three species are not obvious or unique. The problem of how to identify these three species remains. In order to solve this problem, we went to the type locality (province) to collect these three species many times. After checking a large number of specimens of this genus from Zhejiang Province, we have evidence that P. sinica and P. tianmushana are junior synonyms of P. orientalis:

After examining the specimens from Zhejiang Province, according to the original descriptions [4,5,20], we identified the specimen shown in Figure 2A–C and Figure 4A as P. orientalis; Figure 2D–F and Figure 4B as P. tianmushana; Figure 2G–I and Figure 4C (type B: the body color of this specimen is dark brown); Figure 2J–L and Figure 4D (type A: the body color of this specimen is yellowish brown) as P. sinica; although the types of P. sinica have not been examined, we can identified these two specimens as P. sinica by the specimens lacking a bulge on the cerci (Figure 2J–L) or having an almost invisible spine on the dorsal arm (Figure 2G–I).

According to the identification results, we further found that the Paraleuctra specimens from the same site (Tianmushan) had two types of cerci: A spine present near the base of the upper prong (Figure 1F,G and Figure 2B,E), another type without a spine (Figure 2K) or with an almost invisible spine (Figure 2H); two types of color patterns of the body (Figure 1, Figure 2, Figure 3 and Figure 4); the same patterns of epiproct and subanal probe (Figure 1C–E,H–J and Figure 2); all the female specimens had only one pattern of subgenital plates (Figure 3B,C). When we dissected the cercus of the specimens without a spine from all views (Figure 2J–L), the cercus also had an almost invisible spine near the base of the upper prong (Figure 1A,B). It turns out that different color patterns, with or without a spinule can be found on the same species, and this result could overturn the identification basis [20] used to distinguish these three species. Therefore, we have come to the conclusion that the difference in color patterns or spinules consists merely of individual variation and, to some degree, the age of the specimens. Additionally, we think without examining a large number of specimens of the species from this genus, the differences among all species cannot be fully explained, unless a species has unique character, such as the shape of the cerci of P. cervicornis, which is like an antler (Figure 5B), and differs from all other Paraleuctra species.

Figure 5.

Figure 5

Paraleuctra cervicornis Du and Qian, 2012: (A) male terminalia, dorsal view; (B) male terminalia, lateral view; (C) male terminalia, ventral view. The specimen was collected from Sichuan Province (Mt Niba). The arrow points to a small spine on the cerci.

The genetic distance data and phylogenetic analyses using gene sequence data both provide ample evidence for the new junior synonym status of P. sinica and P. tianmushana (Table 1, Table 2, Table 3 and Table 4, Figure 6 and Figure 7). The genetic distance of the COI gene among the specimens of these three species is 0% and the value is lower than the commonly used 3% for species delimitation with DNA barcoding [27,28]. The genetic distance of 18S rDNA among the specimens of these three species ranges 0–1% also supports the synonymy of P. sinica and P. tianmushana with P. orientalis [29]. We also sequence the COI gene and 18S rDNA for one female collected from the same sites, and the genetic distances among the five specimens are also below the commonly used values.

Table 2.

Genetic distance of the COI gene (nucleotides) among the species used in this study.

Genetic Distance (%)
Name P. orientalis P. sinica A P. sinica B P. tianmushana P. undet. P. cuihuashana P. cercia P. vershina P. sara P. occidentalis P. isobeae R. bulbifera
P. orientalis
P. sinica A 0.0
P. sinica B 0.0 0.0
P. tianmushana 0.0 0.0 0.0
P. undet. 0.0 0.0 0.0 0.0
P. cuihuashana 11.7 11.7 11.7 11.7 11.7
P. cercia 18.3 18.3 18.3 18.3 18.3 15.3
P. vershina 17.4 17.4 17.4 17.4 17.4 17.1 14.8
P. sara 19.5 19.5 19.5 19.5 19.5 19.4 14.7 13.0
P. occidentalis 20.4 20.4 20.4 20.4 20.4 20.7 18.8 19.3 19.8
P. isobeae 24.3 24.3 24.3 24.3 24.3 22.8 19.5 21.7 21.1 19.0
R. bulbifera 24.9 24.9 24.9 24.9 24.9 23.2 20.0 22.7 23.3 20.5 15.4
L. fusca 23.0 23.0 23.0 23.0 23.0 22.6 22.6 24.4 23.6 19.6 19.9 20.1

Table 3.

Genetic distance of the 18S rDNA (nucleotides) among the species used in this study.

Genetic Distance (%)
Name P. orientalis P. sinica A P. sinica B P. tianmushana P. undet. P. vershina P. occidentalis P. utahensis
P. orientalis
P. sinica A 0.2
P. sinica B 0.2 0.0
P. tianmushana 0.6 0.4 0.4
P. undet. 0.0 0.2 0.2 0.6
P. vershina 5.6 5.4 5.4 4.9 5.6
P. occidentalis 9.5 9.3 9.3 8.8 9.5 9.0
P. utahensis 30.3 30.0 30.0 29.3 30.3 30.9 29.3
L. inermis 28.0 27.7 27.7 27.0 28.0 24.8 26.9 14.8

Table 4.

Methods used to prove P. sinica and P. tianmushana are junior synonyms of P. orientalis in this study.

Species Name Methods
Morphology Genetic Distance of the COI Gene Genetic Distance of the 18S rDNA Phylogenetic Trees of COI Gene Phylogenetic Trees of 18S rDNA
P. orientalis Share similar features such as head, pronotum, male terminalia and female terminalia. Genetic distance of the COI gene among the three species is below 2%. Genetic distance of the 18S rDNA is below 2%. The three species are grouped in the same clade with high support values. The three species are grouped in the same clade with high support values.
P. sinica A
P. sinica B
P. tianmushana
P. undet.

Figure 6.

Figure 6

Phylogenetic trees of COI gene. Phylogenetic relationships among 13 stoneflies based on maximum likelihood (ML) analysis and Bayesian inference (BI) tree (numbers at the nodes are ML bootstrap values (left) and Bayesian posterior probabilities (right); only nodal support values of >70% are depicted on the tree). The scale bar represents the rate of base substitutions.

Figure 7.

Figure 7

Phylogenetic trees of 18S rDNA. Phylogenetic relationships among 9 stoneflies based on maximum likelihood (ML) analysis and Bayesian inference (BI) tree (numbers at the nodes are ML bootstrap values (left) and Bayesian posterior probabilities (right), only nodal support values of >70% are depicted on the tree.) The scale bar represent the rate of base substitutions.

In the maximum likelihood (ML) and Bayesian inference (BI) trees (Figure 6 and Figure 7), P. orientalis, P. tianmushan, P. sinica type A, type B (A, B represent different color patterns) and P. sp. (a female one) are grouped in the same clade, separated from the clade of other Paraleuctra species. The topology of the ML tree and BI tree are highly supported, with high support values on most nodes. Additionally, in terms of specimen collection location, it supports that specimens collected from the same place belong to the same species. At the genus level, the monophyly of the genus is supported by all phylogenetic trees (Figure 6 and Figure 7). Among them, the phylogenetic relationship between Paraleuctra and Leuctra is the closest, and the genetic distance between the 18S rDNA of Paraleuctra and Perlomyia is the largest (Table 3), indicating that the 18S rDNA may have obvious sequence differences between Paraleuctra and Perlomyia. The genetic distance of the COI gene among the specimens collected from China is below 12%; in contrast to the specimens of Paraleuctra not collected from China, this value is over 15% (Table 2). In addition, in the phylogenetic trees, the clades of them separated from the clades of the specimens of Paraleuctra not collected from China (Figure 6 and Figure 7). The genetic distances of 18S rDNA among the Paraleuctra species are below 10% (Table 3); it seems that 18S rDNA is more stable than COI gene of species in the genus Paraleuctra. Due to the limited samples, the phylogenetic status of Rhopalopsole, Leuctra and Perlomyia still require further study by supplementary sampling.

Molecular data used in this study have proved their efficiency in identifying the morphologically similar species, such as those in the genus Paraleuctra. Combined morphological and molecular evidence (Table 4), we propose that P. sinica and P. tianmushana are junior synonyms of P. orientalis.

3.2. Paraleuctra cervicornis Du and Qian, 2012

Paraleuctra cervicornis: Du and Qian, 2012: 1059 [6].

Type locality: China, Sichuan Province (Mt Niba).

Material examined: Holotype (male): Mt Niba (N: 29.6644, E: 102.6039, 2250 m), Yingjing county, Sichuan Province, 1996-Ⅵ-17, Leg. DU Yu-Zhou; Paratypes: 1 male and 4 females same data as holotype; 1 male and 2 females, Mt Erlang, N: 29.8486, E: 102.3045, 2380 m), Tianquan County, Sichuan Province, 1996-Ⅵ-7, Leg. DU Yu-Zhou.

Distribution: Russia; China (Henan, Shaanxi, Anhui, Hubei, Sichuan, Yunan, Zhejiang, Fujian).

Supplementary Description: This species had been well described by Du and Qian [6]. In this study, we provide the color figures of this species to facilitate identification. The heads of the males and females of this species are much flatter than the pronotum (Figure 8 and Figure 9A). Cerci strongly forked into two prongs, the upper prong sharp, pointed and bearing a small, ventrally directed mesal spine, whereas the lower prong is rounded or somewhat truncate with an emarginated apex (Figure 5B).

Figure 8.

Figure 8

Paraleuctra cervicornis Du and Qian, 2012: male head and pronotum, dorsal view. The specimen was collected from Sichuan Province (Mt Niba).

Figure 9.

Figure 9

Paraleuctra cervicornis Du and Qian, 2012: (A) female head and pronotum, dorsal view; (B) female terminalia, ventral view; (C) female terminalia, ventral view. The specimen was collected from Sichuan Province (Mt Niba).

Remarks: The shape of cerci in the male is unique among all Asian Paraleuctra species. It seems that all the males of Paraleuctra species in China have a spine on the cercus, but it is obvious in some specimens (Figure 1F,G, Figure 2B,E and Figure 5B) and not in some (Figure 1A,B and Figure 2H,K). The subgenital plate of the female of this species can also be distinguished from all other species from China in this genus by the lobes being subrectangular.

Author Contributions

Conceptualization, all authors; methodology, all authors; software, Y.-B.Y.; validation, all authors; formal analysis, all authors; investigation, all authors; resources, Y.-Z.D.; data curation, Y.-Z.D.; writing—original draft preparation, Y.-Z.D.; writing—review and editing, Y.-Z.D.; visualization, Y.-B.Y.; supervision, Y.-Z.D.; project administration, Y.-Z.D.; funding acquisition, Y.-Z.D. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

All data is available in this paper.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This research was supported by the National Natural Science Foundation of China (No. 32170459; 31872266; 31572295).

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.DeWalt R.E., Maehr M.D., Neu-Becker U., Stueber G. Plecoptera Species File Online. [(accessed on 26 February 2022)]. Available online: http://Plecoptera.SpeciesFile.org.
  • 2.Chu Y.T. Description of a new species of Leuctra and notes on Nemoura sinensis from Hangchow. China J. 1928;9:87–89. [Google Scholar]
  • 3.Hanson J.F. Studies on the Plecoptera of North America. Bullet. Brooklyn Entomol. Soc. 1941;36:57–66. [Google Scholar]
  • 4.Yang D., Yang C.K. In: Plecoptera: Leuctridae. Insects and Macrofungi of Gutianshan, Zhejiang. Zhu T., editor. Zhejiang Science and Technology Press; Hangzhou, China: 1995. pp. 20–24. [Google Scholar]
  • 5.Li W.H., Wang Y.B., Yang D. Synopsis of the genus Paraleuctra (Plecoptera: Leuctridae) from China. Zootaxa. 2010;2350:46–52. doi: 10.11646/zootaxa.2350.1.4. [DOI] [Google Scholar]
  • 6.Du Y.Z., Qian Y.H. Paraleuctra cervicornis (Plecoptera: Leuctridae), a new stonefly from China. J. Nat. Hist. 2012;46:1059–1063. doi: 10.1080/00222933.2011.651648. [DOI] [Google Scholar]
  • 7.Kong F.B., Yang D., Li W.H. Discovery of the genus Paraleuctra (Plecoptera: Leuctridae) from Palearctic China, with description of P. qilianshana sp. nov. Zootaxa. 2013;3702:391–396. doi: 10.11646/zootaxa.3702.4.7. [DOI] [PubMed] [Google Scholar]
  • 8.Chen Z.T. The first formal report of brachypterous stonefly of Leuctridae (Plecoptera) from China. Zootaxa. 2019;4624:230–240. doi: 10.11646/zootaxa.4624.2.6. [DOI] [PubMed] [Google Scholar]
  • 9.Zhiltzova L.A. Rare genera of the family Leuctridae (Insecta: Plecoptera) in the fauna of the USSR. Zool. Zhurnal. 1974;53:359–364. [Google Scholar]
  • 10.Harper P.P. Capniidae, Leuctridae, and Perlidae (Plecoptera) from Nepal. Orient. Insects. 1977;11:53–62. doi: 10.1080/00305316.1977.10432083. [DOI] [Google Scholar]
  • 11.Shimizu T. Paraleuctra (Insecta: Plecoptera: Leuctridae) from Japan, with taxonomic notes on the Japanese Leuctridae. Species Divers. 2000;5:285–303. doi: 10.12782/specdiv.5.285. [DOI] [Google Scholar]
  • 12.Stark B.P., Juliana W.K. Systematics of Nearctic Paraleuctra with description of a new genus (Plecoptera: Leuctridae) Tijdschr. Entomol. 2001;144:119–135. doi: 10.1163/22119434-99900060. [DOI] [Google Scholar]
  • 13.Cherchesova S.K., Zhiltzova L.A. The stonefly fauna (Plecoptera) of North Ossetia and its zoogeographical characteristics. Entomol. Rev. 2003;83:451–454. doi: 10.1136/ard.2003.013748. [DOI] [Google Scholar]
  • 14.Baumann R.W., Stark B.P. Paraleuctra alta (Plecoptera: Leuctridae), a new stonefly from Alberta, Canada. Illiesia. 2009;5:30–33. [Google Scholar]
  • 15.Murányi D., Hwang J.M. Four new species and further contributions to the Leuctridae (Plecoptera) of the Korean Peninsula. Zootaxa. 2017;4282:43–61. doi: 10.11646/zootaxa.4282.1.2. [DOI] [Google Scholar]
  • 16.William D.D., Feltmate B.W. Aquatic Insects. CAB International Publish; Wallingford, UK: 1992. Chapter V–Order Plecoptera. [Google Scholar]
  • 17.Zwick P. Variable egg development of Dinocras spp. (Plecoptera, Perlidae) and the stonefly seed banktheory. Freshw. Biol. 1996;35:81–100. doi: 10.1046/j.1365-2427.1996.00482.x. [DOI] [Google Scholar]
  • 18.Snellen R.K., Stewart K.W. The life cycle and drumming behavior of Zealeuctra claasseni (Frison) and Zealeuctra hitei (Ricker and Ross) (Plecoptera: Leuctridae) in Texas, USA. Aquatic Insects. 1979;1:65–89. doi: 10.1080/01650427909360980. [DOI] [Google Scholar]
  • 19.Terry M.D., Whiting M.F. Mantophasmatodea and phylogeny of the lower neopterous insects. Cladistics. 2005;21:240–257. doi: 10.1111/j.1096-0031.2005.00062.x. [DOI] [Google Scholar]
  • 20.Yang D., Li W.H., Zhu F. Fauna Sinica, Insecta. Plecoptera: Nemouroidea. Volume 58. Science Press; Beijing, China: 2015. 518p [Google Scholar]
  • 21.Illies J. Katalog der rezenten Plecoptera. Das Tierreich. 1966;82:1–632. [Google Scholar]
  • 22.Zwick P. Insecta: Plecoptera, Phylogenetisches System und Katalog. Das Tierreich. 1973;94:410. [Google Scholar]
  • 23.Du Y.Z., Sivec I. In: Insect Fauna of Middle-west Qinling Range and South Montains of Gansu Province. Yang X.K., editor. Volume 40. Science Press; Beijing, China: 2005. pp. 38–54. [Google Scholar]
  • 24.Qian Y.H., Du Y.Z. A new stonefly species, Rhopalopsole tricuspis (Leuctridae: Plecoptera), and three new records of stoneflies from the Qinling Mountains of Shaanxi, China. J. Insect Sci. 2012;12:1–9. doi: 10.1673/031.012.4701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Qian Y.H., Li H.L., Du Y.Z. A Study of Leuctridae (Insecta: Plecoptera) from Shennongjia, Hubei Province, China. Fla. Entomol. 2014;97:605–610. doi: 10.1653/024.097.0236. [DOI] [Google Scholar]
  • 26.Li W.H., Li K.F., Wang R.F., Yang D. The first description of the larvae of the Chinese species Paraleuctra tianmushana Li & Yang (Plecoptera: Leuctridae) Zootaxa. 2016;4061:93–100. doi: 10.11646/zootaxa.4061.1.10. [DOI] [PubMed] [Google Scholar]
  • 27.Hebert P.D., Ratnasingham S., de Waard J.R. Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. Lond. Ser. B Biol. Sci. 2003;270((Suppl. 1)):96–99. doi: 10.1098/rsbl.2003.0025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhou X., Adamowicz S.J., Jacobus L.M., DeWalt R.E., Hebert P.D. Towards a comprehensive barcode library for Arctic life-Ephemeroptera, Plecoptera, and Trichoptera of Churchill, Manitoba, Canada. Front. Zool. 2009;6:30. doi: 10.1186/1742-9994-6-30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Baur A., Buschinger A., Zimmermann F.K. Molecular cloning and sequencing of 18S rDNA gene fragments from six different ant species. Insectes Sociaux. 1993;40:325–335. doi: 10.1007/BF01242369. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data is available in this paper.


Articles from Insects are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES