Skip to main content
Brazilian Journal of Microbiology logoLink to Brazilian Journal of Microbiology
. 2022 Mar 11;53(2):525–534. doi: 10.1007/s42770-022-00719-z

Salmonella enterica serovar Typhi influences inflammation and autophagy in macrophages

Huiyun Wang 1,#, Zhongyi Xie 2,#, Fanfan Yang 2,#, Yurou Wang 2, Haiqiang Jiang 1, Xinxiang Huang 2, Ying Zhang 2,✉
PMCID: PMC9151981  PMID: 35274232

Abstract

Salmonella enterica serovar Typhi (S. Typhi) is a human enteropathogen that can survive in macrophages and cause systemic infection. Autophagy and inflammation are two important immune responses of macrophages that contribute to the elimination of pathogens. However, Salmonella has derived many strategies to evade inflammation and autophagy. This study investigated inflammation-related NF-κB signaling pathways and autophagy in S. Typhi-infected macrophages. RNA-seq and quantitative real-time PCR indicated that mRNA levels of NF-κB signaling pathway and autophagy-related genes were dynamically influenced in S. Typhi-infected macrophages. Western blots revealed that S. Typhi activated the NF-κB signaling pathway and induced the expression of inhibitor protein IκBζ. In addition, S. Typhi enhanced autophagy during early stages of infection and may inhibit autophagy during late stages of infection. Thus, we propose that S. Typhi can influence the NF-κB signaling pathway and autophagy in macrophages.

Supplementary Information

The online version contains supplementary material available at 10.1007/s42770-022-00719-z.

Keywords: S. Typhi, Inflammation, NF-κB signaling pathway, Autophagy, Transcriptome

Introduction

Salmonella enterica is a Gram-negative bacterium with 2600 different serovars, which are differentiated by their antigenic presentation [1]. These serovars can also be classified as typhoidal or non-typhoidal. Salmonella is usually contracted by oral ingestion of infected water or food and causes a variety of intestinal diseases [1]. However, human-adapted Salmonella enterica serovar Typhi (S. Typhi) can stay in the intestinal lumen or cross the intestinal barrier to enter non-phagocytic enterocytes or phagocytes. S. Typhi can survive in macrophages and cause systemic transmission within the reticuloendothelial system, leading to systemic disease [2]. Therefore, it is particularly important for S. Typhi to endure different mechanisms associated with resistance to infections, like inflammatory pathways and autophagy.

The innate immune system of the host plays an important role in Salmonella infection. Pathogen-associated molecular patterns are highly conserved structures on pathogens that can be recognized and bound by a group of pattern recognition receptors, such as Toll-like receptors and NOD-like receptors, leading to activation of the host innate immune response [3]. Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) is a protein complex that controls DNA transcription [4], and the NF-κB signaling pathway plays a vital role in maintaining the normal physiological functions of the host. This pathway is divided into canonical and non-canonical pathways. The canonical signaling pathway mediates the activation of p50 (NF-κB1), p65 (RelA), and c-rel [5], whereas the non-canonical pathway mediates activation of the NF-κB complex composed of p52 (NF-κB2) and RelB to regulate specific immune responses [6]. Salmonella can activate the NF-κB signaling pathway through a variety of mechanisms, causing the release of inflammatory factors such as IL-6 and IL-1β to kill and remove Salmonella [7]. Autophagy is a homeostatic and highly conserved survival mechanism in cells that forms membrane structures that encapsulate cellular proteins, organelles, and pathogens and traffics them to lysosomes for degradation [8]. The autophagy pathway can be induced by various conditions, such as nutrient starvation and pathogens [9]. Salmonella-infected macrophages can trigger canonical autophagy, xenophagy, and LC3-associated phagocytosis (LAP). Canonical autophagy pathways involve initiation (ULK1 complex), membrane nucleation (BECLIN1-PtdIns3KC3-ATG14L complex and WIPIs), membrane extension and closure (ATG12-ATG5 and LC3-PE systems), and circulation (ATG9) [10]. Xenophagy pathways can selectively bind ubiquitinated Salmonella or Salmonella-containing vacuoles (SCVs) to autophagosomes through autophagy receptor proteins [11]. LAP is triggered by membrane receptors that recognize Salmonella in combination with other proteins, such as RUBCN and NADPH oxidase to form a special LC3-II-containing endocytic vesicle in macrophages [11, 12]. All autophagosomes and vesicles can transport Salmonella to lysosomes and limit its growth and proliferation [10–12].

Meanwhile, Salmonella has evolved methods, such as type III secretion system (T3SS) and effectors, to escape host innate immune response and promote its intracellular survival. For example, Seek1 and Seek3, effector proteins of T3SS encoded by Salmonella pathogenicity island 2 (SPI-2), inhibit the degradation of IκB during Salmonella infection of macrophages [13, 14], thereby inhibiting activation of the NF-κB signaling pathway and attenuating the inflammatory response [15]. Salmonella can activate the non-receptor tyrosine kinase focal adhesion kinase and Akt/mTOR signaling pathways [16] or target Sirt1, LKB1, or AMPK to lysosomal degradation, blunting autophagy in macrophages through a SPI-2-dependent mechanism [17]. SseL deubiquitinates ubiquitin aggregates to inhibit p62 anchoring to autophagosomes [18]. SopF secreted by T3SS-1 blocks V-ATPase recruitment of ATG16L1 to damaged SCV membranes [19]. SpiC interferes with the lysosome network and inhibits phagosome–lysosome fusion [20]. In addition, lipopolysaccharide (LPS) from Gram-negative bacteria inhibits the inflammatory response by inducing the Nfkbiz-encoded inhibitory protein IκBζ of the NF-κB canonical signaling pathway to prevent the expression of inflammatory factors after NF-κB complex activation and entry into the nucleus [21, 22]. Autophagy is also influence by Salmonella plasmid virulence (spv) locus of S. Typhimurium and plasmid pRST98 of S. Typhi. SpvB impairs the initial stage of autophagy by depolymerization of F-actin [23]. At the early stage of infection, pRST98 suppresses autophagy by decreasing the number of autophagy vacuoles as well as the levels of autophagy-related proteins Beclin 1 and LC3-II [24]. These actions ultimately reduce autophagic flux and facilitate bacterial replication.

T3SS1 and T3SS2 are expressed in different stages of Salmonella infection. The expression of T3SS1 is required for active invasion and continues for 1–2 h after bacterial internalization. The expression of T3SS2 and effectors increases post-invasion and promotes intracellular survival within SCVs [25]. Therefore, the effects of T3SS effectors on host immune system may also have dynamic changes. In addition, a complex association has been identified between autophagy and inflammation. The recognition of pathogens by PRRs, especially toll-like receptor 4 sensing of bacterial lipopolysaccharide, activates autophagy by promoting autophagosome formation [26]. Cytokines, such as IFN-γ, TNF-α, IL-1, IL-2, IL-6, and TGF-β, can induce autophagy. In turn, autophagy has been shown to regulate the production and secretion of cytokines (including IL-1, IL-18, TNF-α, and type I IFN) [27].

The influence of Salmonella on the dynamics of host inflammation and autophagy may be beneficial to the survival of itself in host cells. However, the dynamic changes of inflammation and autophagy in different stages of Salmonella infection are rarely studied. Meanwhile, most research has focused on Salmonella and autophagy in non-phagocytic cells. There have been few studies on Salmonella-related autophagy in macrophages, and the specific molecular mechanisms involved are still not clear. Therefore, in this study, the NF-κB inflammatory signaling pathway and autophagy in S. Typhi-infected macrophages were examined. We identified dynamic differential expression of inflammation- and autophagy-related genes in Salmonella-infected macrophages. Our findings also suggest that S. Typhi can activate the NF-κB signaling pathway and influence autophagy at the protein level.

Results

Analysis of S. Typhi-infected macrophage transcriptome data

S. Typhi-infected macrophages trigger host immune defense mechanisms, such as inflammation and autophagy. THP-1 cells were differentiated into macrophages by treatment of PMA. The treatment induced the typical changes in cell morphology and increased the expression of cell surface marker CD68 (Supplement Fig. 1). To investigate differences in gene expression in macrophages, we used RNA-seq to analyze the RNA of macrophages infected with wild-type S. Typhi strains at 0 h, 2 h (early stages), and 24 h (late stages). Differential genes (|fold change| ≥ 2.00 and false discovery rate (FDR) ≤ 0.001) were selected by comparing the transcriptome at 0 h with those at 2 and 24 h and classified with Gene Ontology (GO) functions (Fig. 1). Genes related to the canonical NF-κB signaling pathway, such as P50, and non-canonical pathway genes, including P52 and RelB, were upregulated in the early or late stages of macrophage infection, but proteins negatively associated with NF-κB signaling, such as Nfkbiz, Cyld, Tnfaip3, Traf1, Tnip1, and Tnip2, were also upregulated at the transcriptional level, indicating that S. Typhi infection does activate the NF-κB signaling pathway in macrophages but also induces the expression of proteins negatively associated with NF-κB signaling to counteract the inflammatory response. The results also showed that the mRNA levels of autophagy-related genes were altered at least at one time point after infection. mRNA levels of genes positively related to autophagy, such as Pim2, Trim5, Tp53inp2, Lamp3, Dram1, Mefv, Zc3h12a, Tp53inp2, and Galectins-9c, were upregulated, whereas Atg4c, Atg16l1, Dapk1, Trim65, Nod1, Rnf166, and Rubcnl were downregulated. mRNA levels of genes negatively associated with autophagy, such as Stat2, Tbc1d17, Casp1, Lamp3, and Tab2, were upregulated, whereas Tbc1d14 was downregulated. These results showed that S. Typhi influences the expression of inflammatory and autophagy-related genes.

Fig. 1.

Fig. 1

Heatmap analysis of 44 genes in S. Typhi-infected macrophage by RNA-seq. The heatmap was clustered by rows and columns. Rows indicate genes, and columns are time points. The heatmap was clustered by rows and columns

Validation of NF-κB signaling pathway and autophagy-related genes

In order to further validate the transcriptome results and show that S. Typhi has the potential to inhibit the NF-κB signaling pathway and autophagy, we selected the following NF-κB signaling pathway genes: Nfkbiz, which encodes IκBζ, a specific inhibitor protein of the canonical NF-κB pathway [21, 28–30]; P50, which encodes the key protein p50; and Tnfaip3, Cyld, Traf1, Tnip1, Tnip3, and Zc3h12a, which encode proteins negatively associated with NF-κB signaling pathway (Fig. 2A). Differentially expressed genes that suggested decreased autophagy, including Rnf166 [31], Atg4c [32], Atg16l1, Rubcnl [33], Lamp3 [34], Casp1 [35], and Dapk1 [36], were selected for validation by quantitative real-time PCR (qRT-PCR) (Fig. 2B). The qRT-PCR results were generally consistent with the transcriptome data trends (Fig. 2C, D).

Fig. 2.

Fig. 2

Transcriptome validation of PMA-THP-1 macrophages infected with S. Typhi. A–B NF-κB signaling pathway and autophagy-related differentially expressed genes in transcriptome. +, differentially expressed genes; fold change, 2 h or 24 h/0 h; parameter, |fold change| ≥ 2.00 and FDR ≤ 0.001. C–D qRT-PCR analysis of the mRNA levels of NF-κB pathway and autophagy-related genes in PMA-THP-1 macrophages infected with S. Typhi at 0, 2, and 24 h. Results are presented as the means ± SEM of the results of at least three independent experiments. NS, no significance; *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. Relative mRNA level: comparing the copy numbers of each gene cDNA with that of β-actin cDNA

The above results showed that S. Typhi affected NF-κB as well as autophagy-related genes in macrophages during the early and late stages of infection. However, phosphorylation modifications of some major proteins in the NF-κB signaling pathway, such as p65, could not be detected at the mRNA level. Furthermore, genes such as Lamp3 and Casp1 are not specifically related to xenophagy. Thus, the qRT-PCR results only suggest that these proteins negatively associated with NF-κB pathway and autophagy-related genes may reflect attenuated inflammation and autophagy responses.

Dynamic mRNA changes in NF-κB signaling pathway and autophagy-related genes

If a mature SCV is not formed shortly after infection, inflammation and autophagy may affect S. Typhi. Thus, we analyzed the mRNA levels of genes involved in these two responses from 0 to 30 min. The results showed that mRNA levels of the P50 gene were not significantly different in macrophages after S. Typhi infection, whereas the mRNA levels of genes encoding proteins negatively associated with NF-κB signaling pathway such as NFKBIZ and TRAF1 were all upregulated 30 min after infection, and the mRNA levels of Atg4c and Atg16l1 were increased as well. These results suggest that the canonical NF-κB pathway is silent, but whether this state is due to the role of inhibitory factors needs to be further studied. However, the expression of autophagy components may be activated shortly after infection (Fig. 3A–B).

Fig. 3.

Fig. 3

Expression of NF-κB and autophagy-related genes in PMA-THP-1 macrophages infected with S. Typhi in different time phases. The mRNA levels of NF-κB signaling pathway and autophagy-related genes from 0 to 30 min (A–B) or 0–6 h (C–D) in macrophages after S. Typhi infection. Results are presented as the means ± SEM of the results of at least three independent experiments. NS, no significance; *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. Relative mRNA level: comparing the copy numbers of each gene cDNA with that of β-actin cDNA

S. Typhi can enhance inflammation, xenophagy, and LAP in macrophages. RNA-seq results showed that the mRNA levels of some genes involved in Salmonella-related xenophagy and LAP did not change significantly at 2 or 24 h (Table 1). In order to further study other phases of infection, we analyzed the mRNA levels of NF-κB signaling pathway and autophagy-related genes at 0, 2, 4, and 6 h after infection using qRT-PCR (Fig. 3C–D). The P50 gene of the canonical pathway was upregulated from 2 to 6 h, indicating that this pathway may gradually increase in activity, while the mRNA levels of inhibitors of this pathway, such as Nfkbiz, Tnfaip3, and Cyld, are also increasing. It is possible that S. Typhi activates the NF-κB signaling pathway and also induces the expression of a series of negative regulators. It has been shown that the mRNA levels of Lc3b and Lamp1 and the autophagy receptors Ndp52, P62, and Optn [37, 38] are upregulated at 2 h, but the mRNA levels of p62, Lc3b, and Lamp1 are slightly downregulated at 6 h. Galectins8, a marker of damaged SCVs, triggers autophagy [39], and its expression was gradually upregulated. In addition, the increasing mRNA levels of Rubcn suggested that the LAP pathway may be activated. These results demonstrated that the NF-κB signaling pathway, its inhibitors, and autophagy were generally activated in macrophages within 0–6 h of infection. However, some autophagy-related genes were downregulated at 6 h and were not significantly changed at 24 h. It is possible that S. Typhi resist autophagy during the late stages of infection.

Table 1.

The mRNA levels’ unobvious changed autophagy-related genes in macrophages infected with S. Typhi at 2 and 24 h

Gene Protein function Log2 2 h/0 h Log2 24 h/0 h
Ndp52 Autophagy receptor protein −0.47 −0.54
P62 Autophagy receptor protein 0.83 0.28
Optn Autophagy receptor protein 0.81 0.62
Galectins8 SCV damage related protein −0.41 0.35
Rubcn Key regulatory protein of LAP Pathway −0.37 0.94
Lamp1 Membrane protein of SCVs and lysosomes 0.15 −0.05
Lc3b Autophagy-related molecular 0.08 −0.26

Dynamic expression changes in NF-κB signaling pathway and autophagy pathway proteins

In order to further explore the NF-κB signaling pathway and autophagy, we extracted total protein from macrophages infected with S. Typhi at 0, 2, 4, 6, and 24 h. The phosphorylation levels of p65 (S563), which is a key protein in the canonical NF-κB pathway, and the non-canonical pathway proteins p100, p52, and RelB were detected by western blot. IκBζ, encoded by Nfkbiz, is a specific inhibitor of the classical pathway, and previous qRT-PCR results showed that its expression was most obviously altered, so this inhibitor was selected as the main focus of subsequent experiments. In the NF-κB signaling pathway, phosphorylation levels of p65 in the canonical pathway were upregulated from 2 to 24 h compared with 0 h, indicating that the canonical pathway was activated in macrophages at all stages of infection. A similar trend was observed for non-canonical pathway proteins. Furthermore, the expression of IκBζ was upregulated at 2, 4, and 6 h, indicating that when the NF-κB signaling pathway is activated in macrophages infected with S. Typhi, this inhibitor protein may inhibit the NF-κB signaling pathway to induce the expression of inflammatory factors in the nucleus (Fig. 4A, B).

Fig. 4.

Fig. 4

S. Typhi infects macrophages to inhibit the NF-κB signaling pathway and affect the autophagy pathway. Western blot analysis of inflammation pathway (A)- or autophagy pathway (C)-related protein levels in macrophages infected with S. Typhi at 2, 4, 6, and 24 h. Quantitation of inflammation pathway (B)- or autophagy pathway (D)-related proteins was based on results of western blots. NS, no significance; *, p < 0.05; **, p < 0.01; ***, p < 0.001

Due to the sudden increase in the expression of the OPTN protein at 6 and 24 h, we added 12 and 18 h as additional time points and detected the three autophagy receptors OPTN, p62, and NDP52 and also LC3-II by western blot to determine autophagy levels. The autophagy-related proteins OPTN, p62, and NDP52 showed reduced expression, whereas the protein level of LC3-II was increased from 2 to 6 h, indicating that S. Typhi enhances autophagy during the early stages (2–6 h) of infection (Fig. 4C, D). From 12 to 24 h, the expression of LC3-II was still higher than that of the uninfected group, and the expression of LC3-II reached the highest levels at 24 h. OPTN and p62 expression increased, but that of NDP52 did not change significantly. According to the transcriptome data, there were no significant differences in mRNA levels of Optn, p62, or Ndp52 compared with the uninfected group. Thus, we suggest that S. Typhi may impair the degradation process of autophagy from 12 to 24 h. In addition, NDP52 did not change significantly until 24 h. We speculate that different autophagy receptors function during different phases. Our results indicate that S. Typhi dynamically affects autophagy in macrophages.

Discussion

Previous studies have shown that Salmonella enterica serovar Typhimurium has an inhibitory effect on the NF-κB signaling pathway [13, 40–42]. In the present study, we examined the role of S. Typhi in immune regulation by studying its effect on the NF-κB signaling pathway. We found that during S. Typhi infection, both the canonical and non-canonical NF-κB signaling pathways were upregulated in macrophages to varying degrees at 2, 4, 6, and 24 h, indicating that activation of the NF-κB signaling pathway was induced in macrophages at all stages of S. Typhi infection. Related inhibitory proteins of NF-κB signaling pathway were also upregulated from 2 to 24 h. Among these, the IκBζ protein encoded by Nfkbiz is localized to the nucleus and is able to bind to p50 in the NF-κB complex of the canonical pathway and inhibit the binding of p65 to DNA, thereby affecting the expression of downstream inflammatory factors [21, 22]. In the present study, we found that both the canonical pathway and the IκBζ protein were upregulated 2–24 h after macrophages were infected, suggesting that after NF-κB complex activation in the nucleus, IκBζ may exert an inhibitory effect on p65-induced transcription of downstream inflammatory factors. The non-canonical pathway gene p100 did not change significantly, possibly due to continued upstream synthesis of p100 after cleavage of p100 to p52. Despite these advances, several outstanding issues remain to be resolved. How is IκBζ activated and expressed by S. Typhi? How does IκBζ inhibit p65 binding to downstream DNA after binding p50? Do certain effector proteins exist in S. Typhi that activate or inhibit the NF-κB signaling pathway and by what mechanism? Therefore, the molecular mechanisms of the interaction between S. Typhi and the NF-κB signaling pathway need to be further studied. Future experiments could use chromatin immunoprecipitation (ChIP) technology to assess the expression of inflammatory factors affected by IκBζ protein binding to p50 protein to determine whether S. Typhi can inhibit the inflammatory response.

Salmonella can both strengthen different autophagy responses and also use its secretion systems and effectors, Vi antigen, Salmonella plasmid virulence proteins, superoxide dismutases, and reactive persulfides to counteract autophagy [43]. However, the function of these virulence factors derived from cellular Salmonella is time-dependent. For example, Salmonella expresses T3SS-1 in the early stages of infection, whereas T3SS-2 plays a role in the middle and late stages [44]. The expression of Vi antigen gradually weakens as the time after infection increases [45], and the antigen mainly functions during the early stages of infection. In this study, we demonstrated that S. Typhi dynamically affected mRNA levels of autophagy-related genes in macrophages. However, the transcriptome showed that some genes did not change significantly at 24 h. This may indicate that autophagy gradually weakens in the late stages of infection. Western blot analysis showed that autophagy was enhanced from 2 to 6 h but that the degradation process of autophagy may have been blocked from 18 to 24 h. We proposed that time-dependent changes in the autophagy response may be closely related to the expression of S. Typhi virulence factors.

Recent studies have suggested that differentially expressed autophagy-related genes are involved in multiple cellular pathways. For example, CASP1 hydrolyzes TRIF to inhibit autophagy, but it is also linked to the pyroptosis pathway [35]. LAMP3 is associated with autophagosome–lysosome fusion/degradation of pathogens. However, the co-localization of this protein with Salmonella induces its proliferation [34]. This indicates that these genes are not specific to the autophagy pathway, and further exploring of the autophagy pathway is required to verify their roles. Xenophagy is a degradation process by which autophagy receptors anchor bacteria or other contents to lysosomes. However, mRNA levels of receptor proteins and LC3 only represent transcription levels. The final effects of autophagy still need to be confirmed at the protein level. In addition, galectin 8 and LAMP1 involve non-specific co-localization with SCVs. Therefore, immunofluorescence should be used to observe these proteins and SCVs in the future. Here, we only studied S. Typhi infection of macrophages, and when S. Typhi infects humans, it interacts with many other immune cells besides macrophages. The crosstalk among the leukocytes was cytokine-dependent. Macrophages, infecting by S. Typhi, increase inflammatory effect and release cytokines (such as IL-1β, IL-6, and TNF-α). Meanwhile, macrophages also promote the secretion of pro-inflammatory cytokines by other immune cells [46]. Some of the cytokines induce autophagy; in turn, autophagy has been shown to regulate the production and secretion of cytokines [27].

In summary, our studies show that S. Typhi activates the NF-κB signaling pathway in macrophages. Additionally, S. Typhi promotes autophagy in the early infection stages but may inhibit autophagy in the late stages. The mRNA and protein levels of NF-κB signaling pathway and autophagy-related genes are dynamic in infected macrophages and may provide targets for future research on molecular mechanisms. Our findings provide critical insights into the study of the survival strategies of S. Typhi in macrophages.

Materials and methods

Bacterial strains and growth conditions

The S. Typhi strain used in this study was wild-type S. Typhi GIFU10007. Bacteria were grown overnight in LB liquid medium at 37 °C in a shaking incubator (250 rpm) and diluted 1:100 in fresh LB. When the bacteria reached the logarithmic growth phase (OD600nm = 0.4), centrifugation was performed at 1700×g, the supernatant was discarded, and the bacteria were suspended in RPMI culture medium (Gibco) and used to perform extracellular infection tests.

Cell lines, cell culture, and reagents

THP-1 human monocytic cells were purchased from the Chinese Academy of Sciences (CAS) and cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco) at 37 °C in a 5% CO2 cell incubator.

In vitro infection of cells

THP-1 cells were seeded in 6-well plates at a density of 5 × 105/ml per well with 2.5 ml per well. THP-1 was induced in macrophage-like cells by culturing the cells in RPMI medium and 10% FBS supplemented with 150 ng/mL phorbol 12-myristate 13-acetate (PMA) (Sigma) for 48 h. One hour before macrophage infection, the culture medium was discarded, and residual PMA was washed off with 1× phosphate buffered saline (PBS) at 37 °C. Then, 2.5 mL of fresh RPMI culture medium containing FBS was added to each well. When S. Typhi reach the logarithmic growth phase (OD600nm = 0.4), the supernatant was discarded by centrifugation at 1700×g, and the bacteria were suspended in RPMI culture medium containing FBS and subjected to extracellular infection tests at a multiplicity of infection (MOI) of 20:1. At 0 h, RPMI culture medium was added to the control group with an equal volume of FBS and cultured in an incubator containing 5% CO2 at 37 °C for 1 h. Gentamicin was then added to a final concentration of 100 μg/mL for 1 h to kill extracellular bacteria. The point at which S. Typhi was added was considered the starting time point, and all culture fluids were discarded at 0 h as well as 2 h and washed twice with 1× PBS at 4 °C before cellular RNA extraction. For the remaining infections, the gentamicin concentration was reduced by 50 μg/mL, and macrophage RNA or total cellular protein was extracted after culturing for the appropriate amount of time. For the short time points (0, 5, 15, and 30 min), no gentamicin was added to PMA-THP-1 macrophages infected with S. Typhi, and macrophage RNA or total cellular protein was directly extracted at the appropriate time after bacterial infection.

For RNA-seq and validation tests, S. Typhi was grown to the logarithmic phase (OD600nm = 0.4) and centrifuged at 1700×g, and the supernatant was discarded. The cells were then suspended in fresh LB culture medium, and extracellular infection tests were performed at an MOI of 20:1. An equal volume of fresh LB culture medium was added to the control group at 0 h and cultured in a 5% CO2 incubator at 37 °C for 1 h. Gentamicin was then added to a final concentration of 100 μg/mL for 1 h to kill extracellular bacteria. One hour after the addition of gentamicin was considered the starting time point, and the culture medium was discarded and rinsed twice with 1× PBS at 4 °C before cellular RNA extraction. For the remaining infections, the gentamicin concentration was reduced by 50 μg/mL, and macrophage RNA was extracted after culturing for the appropriate amount of time.

RNA extraction qRT-PCR

Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Total RNA (2.6 μg) was subjected to cDNA synthesis using HiScript II Q Select RT SuperMix reverse transcriptase (Vazyme). cDNA quantification was performed using AceQ qPCR SYBR Green Master Mix (Vazyme) with the appropriate primers on a CFX 96 real-time PCR machine (Bio-Rad). Primers and their sequences are shown in Table 2. A standard curve was constructed to determine the cDNA copy number of each gene, and the copy number of β-actin cDNA was used for normalization for differences. All experiments were performed in triplicate.

Table 2.

Oligonucleotides used in this study

Primers Sequence in 5′→3′ direction
Nfkbiz-F AGAGGCCCCTTTCAAGGTGT
Nfkbiz-R TCCATCAGACAACGAATCGGG
Tnfaip3-F TCAACTGGTGTCGAGAAGTCC
Tnfaip3-R CAAGTCTGTGTCCTGAACGC
Cyld-F CGTCACACTCTCTGGGATGA
Cyld-R GCAACTGGGATGGAAGATTT
Traf1-F TCCTGTGGAAGATCACCAATGT
Traf1-R GCAGGCACAACTTGTAGCC
Tnip1-F CTAGTGTGACGGCAGGTAAGG
Tnip1-R GCTGCTTCATGGACCGGAA
Tnip3-F ATTGCCGCAGAAAGTTCTACG
Tnip3-R GTCCAGTTTCGTCTTCAGCTC
Zc3h12a-F ACGGGATCGTGGTTTCCAAC
Zc3h12a-R TGGCTTCTTACGCAGGAAGTT
P50-F GAAGCACGAATGACAGAGGC
P50-R GCTTGGCGGATTAGCTCTTTT
β-actin-F TCCTTCCTGGGCATGGAGTC
β-actin-R GTAACGCAACTAAGTCATAGTC
Rnf166-F TCACAGCCTATCCCCAGCAA
Rnf166-R AGGAGAACTTGTGTCGGTGAA
Atg4C-F GCATAAAGGATTTCCCTCTTGA
Atg4C-R GCTGGGATCCATTTTTCG
Atg16L1-F AACGCTGTGCAGTTCAGTCC
Atg16L1-R AGCTGCTAAGAGGTAAGATCCA
Rubcnl-F ATCAGAGGGACTGAAGACTGGG
Rubcnl-R AGGCTCTACTGGAGTTCCACAG
Lamp3-F GGGAGCCTATTTGACCGTCT
Lamp3-R AGGCTTGAAGTTGGACATCG
Casp1-F CTCAGGCTCAGAAGGGAATG
Casp1-R CGCTGTACCCCAGATTTTGT
Dapk1-F ACGTGGATGATTACTACGACACC
Dapk1-R TGCTTTTCTCACGGCATTTCT
Ndp52-F ATTTCATCCCTCGTCGAAAGGA
Ndp52-R TGAAGGTGTAATACTCACGGGTT
P62-F GAACTCCAGTCCCTACAGAT
P62-R CGATGTCATAGTTCTTGGTC
Optn-F AAAGAGCGTCTAATGGCCTTG
Optn-R GTTCAGACACGATGCCCAACA
Galectins8-F ATCTATAACCCGGTAATCCCGTT
Galectins8-R CATGCCCACGTATCACAATCAA
Lamp1-F TCTCAGTGAACTACGACACCA
Lamp1-R AGTGTATGTCCTCTTCCAAAAGC
Rubcn-F CCTGCTCGGGGATAGACAGTA
Rubcn-R CTGGCAAACATGGACGCATC
Lc3b-F GATGTCCGACTTATTCGAGAGC
Lc3b-R TTGAGCTGTAAGCGCCTTCTA

Cell fractionation and protein quantification

Whole cell lysates were collected using RIPA Lysis Buffer (Sango) according to the manufacturer’s instructions after infection of PMA-THP-1 macrophages for the appropriate amount of time. Protein concentrations were then quantified using bicinchoninic acid (BCA) (Sango) for SDS-PAGE and immunoblotting.

SDS-PAGE and immunoblotting

The concentration of the SDS-PAGE separation gel (Bio-Rad) was chosen according to the molecular weight of the protein, and the sample size of each protein was kept consistent. The separation was transferred to a 0.2-μm polyvinylidene fluoride membrane (PVDF) (Bio-Rad). The membrane was blocked using 5% bovine serum albumin (BSA) blocking solution (Ameresco), incubated with primary antibody overnight at 4 °C washed three times with 1× TBST for 10 min, incubated with horseradish peroxidase (HRP)-conjugated secondary antibody in a horizontal shaker for 1 h at room temperature, washed three times with 1× TBST for 10 min, and exposed using ECL luminescence reagent (Sango) to detect the target band.

The following primary antibodies were diluted in 5% BSA: mouse anti-β-actin (BBI, monoclonal antibody, 1:2500), rabbit anti-phospho-p65-S536 (Abclonal, polyclonal antibody, 1:500), rabbit anti-p100/p52 (Abclonal, polyclonal antibody, 1:2000), rabbit anti-RelB (Abclonal, polyclonal antibody, 1:500), rabbit anti-IκBζ (Abclonal, polyclonal antibody, 1:1000), rabbit anti-OPTN (Abclonal, polyclonal antibody, 1:1000), rabbit anti-p62 (Abclonal, polyclonal antibody, 1:2000), rabbit anti-NDP52 (BBI, polyclonal antibody, 1:500), and rabbit anti-LC3B (CST, monoclonal antibody, 1:1000). Secondary antibodies HRP goat anti-rabbit IgG (BBI, 1:5000) and HRP Goat Anti-Mouse IgG (BBI, 1:5000) were dissolved in TBST. All experiments were performed in triplicate.

Statistical analysis

All values presented are expressed as the mean ± SEM of the results of at least three independent experiments. Student’s t test (two-tailed, unpaired) were performed to assess differences between the two experimental groups (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001).

Supplementary information

Supplementary Fig. 1 (5.3MB, png)

PMA induced the differentiation of THP-1 cells into macrophages. Representative bright field images of THP-1 cells differentiated for 48 h in the presence of PMA (150 ng/mL) (A). Flow cytometric analysis of THP-1 cells stained using anti-CD68, magnification, ×100 (B). (PNG 5391 kb)

Author contribution

XH and YZ contributed to the conception of the study; HW, ZX, YF, and YW performed the experiment; HW, ZX, YF, and YW contributed significantly to analysis and manuscript preparation; XH, YZ, and HJ helped perform the analysis with constructive discussions.

Funding

This study was supported by the China Postdoctoral Science Foundation (2018M642186), the Natural Science Research of Jiangsu Higher Education Institutions of China (20KJA310006), the Postdoctoral Research Foundation of Jiangsu Province (2021K209B), and the Program for Excellent Young Talents in Jiangsu University.

Declarations

Conflict of interest

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Huiyun Wang, Zhongyi Xie and Fanfan Yang These authors contributed equally to this work.

References

  • 1.Gal-Mor O, Boyle EC, Grassl GA. Same species, different diseases: how and why typhoidal and non-typhoidal Salmonella enterica serovars differ. Front Microbiol. 2014;5:391. doi: 10.3389/fmicb.2014.00391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.de Jong HK, Parry CM, van der Poll T, Wiersinga WJ. Host-pathogen interaction in invasive salmonellosis. PLoS Pathog. 2012;8:e1002933. doi: 10.1371/journal.ppat.1002933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.West AP, Koblansky AA, Ghosh S. Recognition and signaling by toll-like receptors. Annu Rev Cell Dev Biol. 2006;22:409–437. doi: 10.1146/annurev.cellbio.21.122303.115827. [DOI] [PubMed] [Google Scholar]
  • 4.Miraghazadeh B, Cook MC. Nuclear factor-kappaB in autoimmunity: man and mouse. Front Immunol. 2018;9:613. doi: 10.3389/fimmu.2018.00613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Perkins ND. Integrating cell-signalling pathways with NF-kappaB and IKK function. Nat Rev Mol Cell Biol. 2007;8:49–62. doi: 10.1038/nrm2083. [DOI] [PubMed] [Google Scholar]
  • 6.Smale ST. Hierarchies of NF-κB target-gene regulation. Nat Immunol. 2011;12:689–694. doi: 10.1038/ni.2070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Johannessen M, Askarian F, Sangvik M, Sollid JE. Bacterial interference with canonical NFκB signalling. Microbiology (Reading) 2013;159:2001–2013. doi: 10.1099/mic.0.069369-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Siqueira MDS, Ribeiro RM, Travassos LH. Autophagy and its interaction with intracellular bacterial pathogens. Front Immunol. 2018;9:935. doi: 10.3389/fimmu.2018.00935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tattoli I, Sorbara MT, Vuckovic D, Ling A, Soares F, Carneiro LA, Yang C, Emili A, Philpott DJ, Girardin SE. Amino acid starvation induced by invasive bacterial pathogens triggers an innate host defense program. Cell Host Microbe. 2012;11:563–575. doi: 10.1016/j.chom.2012.04.012. [DOI] [PubMed] [Google Scholar]
  • 10.Codogno P, Mehrpour M, Proikas-Cezanne T. Canonical and non-canonical autophagy: variations on a common theme of self-eating? Nat Rev Mol Cell Biol. 2011;13:7–12. doi: 10.1038/nrm3249. [DOI] [PubMed] [Google Scholar]
  • 11.Sil P, Muse G, Martinez J. A ravenous defense: canonical and non-canonical autophagy in immunity. Curr Opin Immunol. 2018;50:21–31. doi: 10.1016/j.coi.2017.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Masud S, Prajsnar TK. Macrophages target Salmonella by LC3-associated phagocytosis in a systemic infection model. Autophagy. 2019;15:796–812. doi: 10.1080/15548627.2019.1569297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Günster RA, Matthews SA, Holden DW, Thurston TLM. SseK1 and SseK3 type III secretion system effectors inhibit NF-κB signaling and necroptotic cell death in Salmonella-infected macrophages. Infect Immun. 2017;85:e00010–e00017. doi: 10.1128/IAI.00010-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Stanger BZ, Leder P, Lee TH, Kim E, Seed B. RIP: a novel protein containing a death domain that interacts with Fas/APO-1 (CD95) in yeast and causes cell death. Cell. 1995;81:513–523. doi: 10.1016/0092-8674(95)90072-1. [DOI] [PubMed] [Google Scholar]
  • 15.Hsu H, Huang J, Shu HB, Baichwal V, Goeddel DV. TNF-dependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex. Immunity. 1996;4:387–396. doi: 10.1016/S1074-7613(00)80252-6. [DOI] [PubMed] [Google Scholar]
  • 16.Owen KA, Meyer CB, Bouton AH, Casanova JE. Activation of focal adhesion kinase by Salmonella suppresses autophagy via an Akt/mTOR signaling pathway and promotes bacterial survival in macrophages. PLoS Pathog. 2014;10:e1004159. doi: 10.1371/journal.ppat.1004159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ganesan R, Hos NJ, Gutierrez S, Fischer J, Stepek JM, Daglidu E, Krönke M, Robinson N. Salmonella typhimurium disrupts Sirt1/AMPK checkpoint control of mTOR to impair autophagy. PLoS Pathog. 2017;13:e1006227. doi: 10.1371/journal.ppat.1006227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Mesquita FS, Thomas M, Sachse M, Santos AJ, Figueira R, Holden DW. The Salmonella deubiquitinase SseL inhibits selective autophagy of cytosolic aggregates. PLoS Pathog. 2012;8:e1002743. doi: 10.1371/journal.ppat.1002743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xu Y, Zhou P, Cheng S, Lu Q, Nowak K, Hopp AK, Li L, Shi X, Zhou Z, Gao W, Li D, He H, Liu X, Ding J, Hottiger MO, Shao F. A bacterial effector reveals the V-ATPase-ATG16L1 axis that initiates xenophagy. Cell. 2019;178:552–566.e520. doi: 10.1016/j.cell.2019.06.007. [DOI] [PubMed] [Google Scholar]
  • 20.Shotland Y, Krämer H, Groisman EA. The Salmonella SpiC protein targets the mammalian Hook3 protein function to alter cellular trafficking. Mol Microbiol. 2003;49:1565–1576. doi: 10.1046/j.1365-2958.2003.03668.x. [DOI] [PubMed] [Google Scholar]
  • 21.Pan ZK, Fisher C, Li JD, Jiang Y, Huang S, Chen LY. Bacterial LPS up-regulated TLR3 expression is critical for antiviral response in human monocytes: evidence for negative regulation by CYLD. Int Immunol. 2011;23:357–364. doi: 10.1093/intimm/dxr019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Knuff K, Finlay BB. What the SIF is happening-the role of intracellular Salmonella-induced filaments. Front Cell Infect Microbiol. 2017;7:335. doi: 10.3389/fcimb.2017.00335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chu Y, Gao S, Wang T, Yan J, Xu G, Li Y, Niu H, Huang R, Wu S. A novel contribution of spvB to pathogenesis of Salmonella Typhimurium by inhibiting autophagy in host cells. Oncotarget. 2016;7:8295–8309. doi: 10.18632/oncotarget.6989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wu S, Chu Y, Yang Y, Li Y, He P, Zheng Y, Zhang C, Liu Q, Han L, Huang R. Inhibition of macrophage autophagy induced by Salmonella enterica serovar typhi plasmid. Front Biosci (Landmark Ed) 2014;19:490–503. doi: 10.2741/4220. [DOI] [PubMed] [Google Scholar]
  • 25.Wu S, Shen Y, Zhang S, Xiao Y, Shi S. Salmonella interacts with autophagy to offense or defense. Front Microbiol. 2020;11:721. doi: 10.3389/fmicb.2020.00721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Krakauer TA-O. Inflammasomes, autophagy, and cell death: the trinity of innate host defense against intracellular bacteria. Mediat Inflamm. 2019;2019:2471215. doi: 10.1155/2019/2471215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Harris J. Autophagy and cytokines. Cytokine. 2011;56:140–144. doi: 10.1016/j.cyto.2011.08.022. [DOI] [PubMed] [Google Scholar]
  • 28.Afonina IS, Zhong Z, Karin M, Beyaert R. Limiting inflammation-the negative regulation of NF-κB and the NLRP3 inflammasome. Nat Immunol. 2017;18:861–869. doi: 10.1038/ni.3772. [DOI] [PubMed] [Google Scholar]
  • 29.Kanmani P, Kim H (2020) Beneficial effect of immunobiotic strains on attenuation of Salmonella induced inflammatory response in human intestinal epithelial cells. PLoS One 15:e0229647 [DOI] [PMC free article] [PubMed]
  • 30.Reyes-Turcu FE, Ventii KH, Wilkinson KD. Regulation and cellular roles of ubiquitin-specific deubiquitinating enzymes. Annu Rev Biochem. 2009;78:363–397. doi: 10.1146/annurev.biochem.78.082307.091526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Heath RJ, Goel G, Baxt LA, Rush JS, Mohanan V, Paulus GLC, Jani V, Lassen KG, Xavier RJ. RNF166 determines recruitment of adaptor proteins during antibacterial autophagy. Cell Rep. 2016;17:2183–2194. doi: 10.1016/j.celrep.2016.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Agrotis A, Pengo N, Burden JJ, Ketteler R. Redundancy of human ATG4 protease isoforms in autophagy and LC3/GABARAP processing revealed in cells. Autophagy. 2019;15:976–997. doi: 10.1080/15548627.2019.1569925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Cheng X, Sun Q. RUBCNL/Pacer and RUBCN/Rubicon in regulation of autolysosome formation and lipid metabolism. Autophagy. 2019;15:1120–1121. doi: 10.1080/15548627.2019.1596500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lee EJ, Park KS, Jeon IS, Choi JW, Lee SJ, Choy HE, Song KD, Lee HK, Choi JK. LAMP-3 (lysosome-associated membrane protein 3) promotes the intracellular proliferation of Salmonella typhimurium. Mol Cell. 2016;39:566–572. doi: 10.14348/molcells.2016.0112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Jabir MS, Ritchie ND, Li D, Bayes HK, Tourlomousis P, Puleston D, Lupton A, Hopkins L, Simon AK, Bryant C, Evans TJ. Caspase-1 cleavage of the TLR adaptor TRIF inhibits autophagy and β-interferon production during Pseudomonas aeruginosa infection. Cell Host Microbe. 2014;15:214–227. doi: 10.1016/j.chom.2014.01.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Singh P, Ravanan P, Talwar P. Death associated protein kinase 1 (DAPK1): a regulator of apoptosis and autophagy. Front Mol Neurosci. 2016;9:46. doi: 10.3389/fnmol.2016.00046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Owen KA, Casanova JE. Salmonella manipulates autophagy to "serve and protect". Cell Host Microbe. 2015;18:517–519. doi: 10.1016/j.chom.2015.10.020. [DOI] [PubMed] [Google Scholar]
  • 38.Slowicka K, Vereecke L, Mc Guire C, Sze M, Maelfait J, Kolpe A, Saelens X, Beyaert R, van Loo G. Optineurin deficiency in mice is associated with increased sensitivity to Salmonella but does not affect proinflammatory NF-κB signaling. Eur J Immunol. 2016;46:971–980. doi: 10.1002/eji.201545863. [DOI] [PubMed] [Google Scholar]
  • 39.Thurston TL, Wandel MP, von Muhlinen N, Foeglein A, Randow F. Galectin 8 targets damaged vesicles for autophagy to defend cells against bacterial invasion. Nature. 2012;482:414–418. doi: 10.1038/nature10744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Winston JT, Strack P, Beer-Romero P, Chu CY, Elledge SJ, Harper JW. The SCFbeta-TRCP-ubiquitin ligase complex associates specifically with phosphorylated destruction motifs in IkappaBalpha and beta-catenin and stimulates IkappaBalpha ubiquitination in vitro. Genes Dev. 1999;13:270–283. doi: 10.1101/gad.13.3.270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Giogha C, Lung TW, Pearson JS, Hartland EL. Inhibition of death receptor signaling by bacterial gut pathogens. Cytokine Growth Factor Rev. 2014;25:235–243. doi: 10.1016/j.cytogfr.2013.12.012. [DOI] [PubMed] [Google Scholar]
  • 42.Jennings E, Esposito D, Rittinger K. Structure-function analyses of the bacterial zinc metalloprotease effector protein GtgA uncover key residues required for deactivating NF-κB. J Biol Chem. 2018;293:15316–15329. doi: 10.1074/jbc.RA118.004255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Xie Z, Zhang Y, Huang X. Evidence and speculation: the response of Salmonella confronted by autophagy in macrophages. Future Microbiol. 2020;15:1277–1286. doi: 10.2217/fmb-2020-0125. [DOI] [PubMed] [Google Scholar]
  • 44.Moest TP, Méresse S. Salmonella T3SSs: successful mission of the secret(ion) agents. Curr Opin Microbiol. 2013;16:38–44. doi: 10.1016/j.mib.2012.11.006. [DOI] [PubMed] [Google Scholar]
  • 45.Faucher SP, Porwollik S, Dozois CM, McClelland M, Daigle F. Transcriptome of Salmonella enterica serovar Typhi within macrophages revealed through the selective capture of transcribed sequences. Proc Natl Acad Sci U S A. 2006;103:1906–1911. doi: 10.1073/pnas.0509183103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Salerno-Goncalves RA-O, Kayastha DA-O, Fasano A, Levine MM, Sztein MB. Crosstalk between leukocytes triggers differential immune responses against Salmonella enterica serovars Typhi and Paratyphi. PLoS Negl Trop Dis. 2019;13:e0007650. doi: 10.1371/journal.pntd.0007650. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Fig. 1 (5.3MB, png)

PMA induced the differentiation of THP-1 cells into macrophages. Representative bright field images of THP-1 cells differentiated for 48 h in the presence of PMA (150 ng/mL) (A). Flow cytometric analysis of THP-1 cells stained using anti-CD68, magnification, ×100 (B). (PNG 5391 kb)


Articles from Brazilian Journal of Microbiology are provided here courtesy of Brazilian Society of Microbiology

RESOURCES