Multiplex PCR Screening To Detect cry9 Genes in Bacillus thuringiensis Strains

Abstract

An extended PCR method was established to rapidly identify and classify Bacillus thuringiensis strains containing cry (crystal protein) genes toxic to lepidopteran, coleopteran, and dipteran pests (Ben-Dov et al., Appl. Environ. Microbiol. 63:4883–4890, 1997). To optimize identification of all reported cry genes, this methodology needs a complete PCR set of primers. In the study reported here, a set of universal (Un9) and specific primers for multiplex rapid screening for all four known genes from the cry9 group was designed. PCR analyses were performed for cry9 genes on 16 standard strains and 215 field isolates of B. thuringiensis. Among the standard strains, only B. thuringiensis subsp. aizawai HD-133, which harbors cry1 and cry2 genes, was positive with Un9 but negative to all four specific primers for cry9 genes. DNA of 22 field-collected isolates was also found to be positive with Un9. These isolates were classified into three cry9 profiles using specific primers; all of them harbor cry1 and cry2. This newly designed set of primers complements the existing PCR methodology for most currently known cry genes.

The soil bacterium Bacillus thuringiensis fulfills the requisites of a microbiological control agent against agricultural pests and vectors of diseases that lead to its widespread commercial application. It is a gram-positive, aerobic, endospore-forming saprophyte (1, 18). All known subspecies of B. thuringiensis produce large quantities of insecticidal crystal proteins (ICPs) which are segregated in parasporal bodies (also known as δ- endotoxins) (6). The genes encoding ICPs normally occur on large plasmids and direct the synthesis of a family of related proteins classified as cry1-28 and cyt1-2 groups according to their degree of amino acid homology (2a, 11).

Identifying novel B. thuringiensis isolates by bioassays is a long and exhaustive process which is impeded by repeated isolation of the same strains (18). Prediction of insecticidal activity of an unknown strain by serotyping seems impossible because it does not necessarily reflect the specific cry gene class(es) the strain(s) contains (1, 12). Alternatively, PCR requires minute amounts of DNA and allows quick, simultaneous screening of many B. thuringiensis samples, identification and classification of cry genes, and subsequent prediction of their insecticidal activities (3–5, 7–10, 13, 15, 16, 19, 21). Extended PCR methodology has recently been exploited to rapidly identify and classify cry genes of many groups (3, 5). A complete set of primers is required to optimize identification of all reported cry genes (18).

cry9 genes are promising tools for effective control (14, 26) and resistance management (22) of many agronomically important lepidopteran species of insect pests. For example, expression of Cry9Ca in transgenic corn protected the plant against the European corn borer (Ostrina nubilalis) (14). Cry9Ca is significantly more toxic to budworm (Choristoneura fumiferana) than the currently used Cry1A-F toxins (26) and displays high toxicity against Plutella xylostella (susceptible as well as resistant larvae), Spodoptera exigua, Spodoptera littoralis, Heliothis virescens, Agrotis segetum, and silkworm (Bombyx mori) (20, 26). Another toxin belonging to the Cry9 group is Cry9Aa, the major crystal component of B. thuringiensis subsp. galleriae, which exhibits unique toxicity toward Galleria mellonella larvae (25). The cryptic gene cry9Ba was found to be localized upstream of cry9Aa (23). The fourth protein in this group, Cry9Da, toxic to scarabaeid larvae of the order Coleoptera, was found in B. thuringiensis subsp. japonensis (2, 27).

In this study, we developed a new set of universal and specific primers for multiplex rapid screening of B. thuringiensis strains that harbor any of the four currently known cry9 genes.

B. thuringiensis strains were isolated as described previously (3) and selected for appearance of parasporal inclusions by phase-contrast microscopy. One pair of universal oligonucleotide primers (Un9) was selected from a highly conserved region present in the four cry9 genes (extracted from the GenBank database in accordance with the method outlined in reference 11) to amplify a specific fragment from cry9 genes by using the program Amplify 1.0 (Bill Engels, University of Wisconsin) (Fig. 1, lanes 2 to 4). Primer sequences, match and mismatch positions on each gene of the group, and the expected sizes of their amplicons are presented in Table 1. Sequences and match positions of the four specific primers, selected from highly variable regions in the known cry9 genes, are presented in Table 2. A mixture of the four specific primers with the universal reverse primer [Un9(r)] was used for multiplex PCR screening to identify cry9 genes by different sizes of their PCR products (Table 2; Fig. 1, lanes 5 to 7).

FIG. 1.

Agarose gel (1%) electrophoresis of PCR products obtained with universal and specific primers for cry9 genes. Lanes 1 and 8, molecular weight markers (λ_DNA cleaved by HindIII), with sizes (in kilobases) indicated on left; lanes 2 to 4, respectively, DNA of field-collected isolates U-27, K-74, and B. thuringiensis subsp. aizawai HD-133 amplified with Un9; lanes 5 to 7, respectively, DNA of field-collected isolates U-27, K-74, and B. thuringiensis subsp. aizawai HD-133 amplified with a mixture of four specific primers and one reverse Un9(r).

TABLE 1.

Characteristics of universal primers for cry9 group genes^a

Gene nomenclature		GenBank accession no.	Positions of nucleotides hybridized to primersb	Mismatch of primersc	Product size (bp)
Current	Original
cry9A	cryIG	X58120	2774–2797, 3104–3127	4, 16(d); 9(r)	354
cry9B	cryIX	X75019	2272–2295, 2602–2625	4, 16(d); 9(r)	354
cry9C	cry9C	Z37527	4354–4377, 4681–4704	0(d); 0(r)	351
cry9D		D85560	2338–2361, 2668–2691	0(d); 0(r)	354

^aThe sequences of the universal primers (d, direct; r, reverse) are as follows: Un9(d), 5′-CGGTGTTACTATTAGCGAGGGCGG-3′; Un9(r), 5′-GTTTGAGCCGCTTCACAGCAATCC-3′. 

^bStarting from the first base of the sequence (of the respective cry gene) in the GenBank database. 

^cNumbers indicate bases from 5′ of primers that do not match to the respective sequences. 

TABLE 2.

Characteristics of specific primers for cry9 genes

Primer paira	Sequence of primersb	Gene recognized	Positionsc	Product size (bp)
EB-9A(d)	GGTTCACTTACATTGCCGGTTAGC	cry9A	1581–1604	1,547
Un9(r)	GTTTGAGCcGCTTCACAGCAATCC		3104–3127
EB-9B(d)	GCAAATGCATTTAGCGCTGGTCAA	cry9B	1925–1948	701
Un9(r)	GTTTGAGCcGCTTCACAGCAATCC		2602–2625
EB-9C(d)	CCACCAGATGAAAGTACCGGAAG	cry9C	3473–3495	1,232
Un9(r)	GTTTGAGCCGCTTCACAGCAATCC		4681–4704
EB-9D(d)	GCAATAAGGGTGTCGGTCACTGG	cry9D	1754–1776	938
Un9(r)	GTTTGAGCCGCTTCACAGCAATCC		2668–2691

^a(d) and (r), direct and reverse primers, respectively. 

^bBases that do not match appropriate sequences are shown in lowercase letters. 

^cStarting from the first base of the sequence (of the respective cry gene) in the GenBank database. 

Amplification was carried out in a DNA MiniCycler (MJ Research, Inc., Watertown, Mass.) for 30 reaction cycles each. Reactions were routinely carried out in 25 μl; 1 μl of template DNA was mixed with reaction buffer, a 150 μM concentration of each deoxynucleoside triphosphate, a 0.2 to 0.5 μM concentration of each primer, and 0.5 U of Taq DNA polymerase (Appligene). Template DNA was denatured (1 min at 94°C) and annealed to primers (45 s at 56°C), and extensions of PCR products were achieved at 72°C for 50 s and 90 s for Un9 and specific primers, respectively. Each experiment was accompanied by a negative control (i.e., without DNA template).

Multiplex PCR screening for cry9 genes was performed on 16 B. thuringiensis standard strains previously used by us (3), as well as on 215 B. thuringiensis field isolates. Among the standard strains, only B. thuringiensis subsp. aizawai HD-133 yielded an amplicon with Un9 (Fig. 1, lane 4), though it was negative to the specific primers (lane 7). This strain contains cry2Ab (in addition to the four cry1 genes -Aa, -Ab, -Ca, and -Da [3, 10, 15]) and yielded a strong amplification product with universal primers for cry7 and cry8 (3). Another group (21) that claimed to have found cry2Ab in this strain only confirmed our previous finding (3). The low quality of their “degenerated family” primers for cry7 and cry8 (21) resulted in nonspecific amplicons (compare with reference 3). Another gene, cry1I (cryV in the old nomenclature), has also been found in this (21) and other B. thuringiensis subsp. aizawai strains (13, 24), and the product of this gene is known to be secreted into the medium in the early stationary phase (17).

A new gene, cry9Ea, has very recently been discovered in B. thuringiensis subsp. aizawai SSK-10 (2a) and should be recognized by Un9. Un9(d) hybridizes to nucleotides 2448 to 2471 with no mismatches, while Un9(r) hybridizes to nucleotides 2775 to 2798 with a single mismatch at residue 18. The resulting amplicon would be 351 bp in length. A new specific primer for cry9Ea should be designed to allow identification of cry9Ea in the strains that were positive to Un9 (see the Addendum in Proof).

Of the field-collected isolates, 22 yielded positive results with Un9 (Table 3). These were screened further for the presence of four cry9 genes. Three different cry9 gene profiles were found which contained also several combinations of cry1 and cry2 (Table 3). Fifteen isolates contained cry9Aa and cry9Ba (Fig. 1, lane 5) and two contained only cry9Da (lane 6), whereas five did not yield an amplicon by PCR with any of the four specific cry9 primers tested. None of our field-collected isolates contained cry9Ca.

TABLE 3.

Distribution of cry9 gene profiles of B. thuringiensis field-collected isolates

cry9 gene profile	cry-type gene profile identified previouslyb	No. of isolate(s)
cry9D	cry1Aa, -Ab + cry2Ab	1
	cry1Aa, -Ab, -Ac + cry2Aa, -Ab	1
cry9A, -B	cry1Ab, -D + cry2Ab	4
	cry1Ab, -Ac, -D + cry2Ab	1
	cry1Ab, -D + cry2Ab, -Ac	10
cry9a	cry1Ab, -D + cry2Ab, -Ac	1
	cry1Aa, -Ab, -C, -D + cry2Ab	4

^acry9 (without letter) indicates positive with universal and negative with specific primers. 

^bBen-Dov et al. (3). 

It is interesting to note that the specific primer EB-9B(d) nonspecifically amplified a cry9Da fragment of 1,534 bp (Fig. 1, lane 6). Alignment analysis discovered that it anneals with low binding strength to bases 1158 to 1181 in the cry9Da coding sequence. Increasing the temperature to 60 to 62°C can prevent this nonspecific annealing.

The recent report by Bravo et al. (5) on an expanded set of general and specific primers includes a set for detecting three genes of the cry9 group (excluding cry9Da). At least one of these specific primers (spe-cry9C), corresponding to bases 1853 to 1868 (yielding an amplicon of 306 bp), is predicted to nonspecifically anneal also to bases 1961 to 1976 in cry9Ca (to amplify a fragment of 198 bp); it may thus interfere with amplification of the 306-bp fragment of cry9Ca. In addition, spe-cry9C is predicted to anneal nonspecifically both directly and in the reverse direction to cry9Ca and cry9Aa, thus giving rise to further nonspecific amplifications.

Bravo et al. (5) detected cry9 genes in 2.6% of their B. thuringiensis strain collection, whereas we found them in 10.2% of our collection (Table 3). This apparent difference in frequencies may reflect a real difference in prevalence of cry9 genes between the Latin American and Asian collections. It may however be due to the fact that in addition to a set of four specific primers we used a pair of universal primers (Un9) which amplifies all five cry9 genes (and also potentially other unknown genes of this family).

Our screening procedure identified five field-collected B. thuringiensis isolates positive to Un9 but not to any of our specific primers for four cry9 genes. This may indicate that these isolates contain new cry9 genes. They may be potential biological control agents against insect pests.

ADDENDUM IN PROOF

The new specific primer EB-9E(a), 5′-GCGGCTGGCTTTACTTTACCGAG-3′, designed to identify cry9Ea by hybridization to nucleotides 1975 to 1977, amplified PCR product of 824 bp with Un9(r). B. thuringiensis subsp. aizawai HD-133 and four of the five field-collected isolates (positive to Un9) yielded an amplicon specific to cry9Ea.