Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 1999 Aug;65(8):3714–3716. doi: 10.1128/aem.65.8.3714-3716.1999

Multiplex PCR Screening To Detect cry9 Genes in Bacillus thuringiensis Strains

Eitan Ben-Dov 1, Qingfeng Wang 1, Arieh Zaritsky 1, Robert Manasherob 1, Ze’ev Barak 1, Bert Schneider 1, Aloviddin Khamraev 2, Mukhtar Baizhanov 3, Victor Glupov 4, Yoel Margalith 1,*
PMCID: PMC91556  PMID: 10427071

Abstract

An extended PCR method was established to rapidly identify and classify Bacillus thuringiensis strains containing cry (crystal protein) genes toxic to lepidopteran, coleopteran, and dipteran pests (Ben-Dov et al., Appl. Environ. Microbiol. 63:4883–4890, 1997). To optimize identification of all reported cry genes, this methodology needs a complete PCR set of primers. In the study reported here, a set of universal (Un9) and specific primers for multiplex rapid screening for all four known genes from the cry9 group was designed. PCR analyses were performed for cry9 genes on 16 standard strains and 215 field isolates of B. thuringiensis. Among the standard strains, only B. thuringiensis subsp. aizawai HD-133, which harbors cry1 and cry2 genes, was positive with Un9 but negative to all four specific primers for cry9 genes. DNA of 22 field-collected isolates was also found to be positive with Un9. These isolates were classified into three cry9 profiles using specific primers; all of them harbor cry1 and cry2. This newly designed set of primers complements the existing PCR methodology for most currently known cry genes.


The soil bacterium Bacillus thuringiensis fulfills the requisites of a microbiological control agent against agricultural pests and vectors of diseases that lead to its widespread commercial application. It is a gram-positive, aerobic, endospore-forming saprophyte (1, 18). All known subspecies of B. thuringiensis produce large quantities of insecticidal crystal proteins (ICPs) which are segregated in parasporal bodies (also known as δ- endotoxins) (6). The genes encoding ICPs normally occur on large plasmids and direct the synthesis of a family of related proteins classified as cry1-28 and cyt1-2 groups according to their degree of amino acid homology (2a, 11).

Identifying novel B. thuringiensis isolates by bioassays is a long and exhaustive process which is impeded by repeated isolation of the same strains (18). Prediction of insecticidal activity of an unknown strain by serotyping seems impossible because it does not necessarily reflect the specific cry gene class(es) the strain(s) contains (1, 12). Alternatively, PCR requires minute amounts of DNA and allows quick, simultaneous screening of many B. thuringiensis samples, identification and classification of cry genes, and subsequent prediction of their insecticidal activities (3–5, 7–10, 13, 15, 16, 19, 21). Extended PCR methodology has recently been exploited to rapidly identify and classify cry genes of many groups (3, 5). A complete set of primers is required to optimize identification of all reported cry genes (18).

cry9 genes are promising tools for effective control (14, 26) and resistance management (22) of many agronomically important lepidopteran species of insect pests. For example, expression of Cry9Ca in transgenic corn protected the plant against the European corn borer (Ostrina nubilalis) (14). Cry9Ca is significantly more toxic to budworm (Choristoneura fumiferana) than the currently used Cry1A-F toxins (26) and displays high toxicity against Plutella xylostella (susceptible as well as resistant larvae), Spodoptera exigua, Spodoptera littoralis, Heliothis virescens, Agrotis segetum, and silkworm (Bombyx mori) (20, 26). Another toxin belonging to the Cry9 group is Cry9Aa, the major crystal component of B. thuringiensis subsp. galleriae, which exhibits unique toxicity toward Galleria mellonella larvae (25). The cryptic gene cry9Ba was found to be localized upstream of cry9Aa (23). The fourth protein in this group, Cry9Da, toxic to scarabaeid larvae of the order Coleoptera, was found in B. thuringiensis subsp. japonensis (2, 27).

In this study, we developed a new set of universal and specific primers for multiplex rapid screening of B. thuringiensis strains that harbor any of the four currently known cry9 genes.

B. thuringiensis strains were isolated as described previously (3) and selected for appearance of parasporal inclusions by phase-contrast microscopy. One pair of universal oligonucleotide primers (Un9) was selected from a highly conserved region present in the four cry9 genes (extracted from the GenBank database in accordance with the method outlined in reference 11) to amplify a specific fragment from cry9 genes by using the program Amplify 1.0 (Bill Engels, University of Wisconsin) (Fig. 1, lanes 2 to 4). Primer sequences, match and mismatch positions on each gene of the group, and the expected sizes of their amplicons are presented in Table 1. Sequences and match positions of the four specific primers, selected from highly variable regions in the known cry9 genes, are presented in Table 2. A mixture of the four specific primers with the universal reverse primer [Un9(r)] was used for multiplex PCR screening to identify cry9 genes by different sizes of their PCR products (Table 2; Fig. 1, lanes 5 to 7).

FIG. 1.

FIG. 1

Agarose gel (1%) electrophoresis of PCR products obtained with universal and specific primers for cry9 genes. Lanes 1 and 8, molecular weight markers (λDNA cleaved by HindIII), with sizes (in kilobases) indicated on left; lanes 2 to 4, respectively, DNA of field-collected isolates U-27, K-74, and B. thuringiensis subsp. aizawai HD-133 amplified with Un9; lanes 5 to 7, respectively, DNA of field-collected isolates U-27, K-74, and B. thuringiensis subsp. aizawai HD-133 amplified with a mixture of four specific primers and one reverse Un9(r).

TABLE 1.

Characteristics of universal primers for cry9 group genesa

Gene nomenclature
GenBank accession no. Positions of nucleotides hybridized to primersb Mismatch of primersc Product size (bp)
Current Original
cry9A cryIG X58120 2774–2797, 3104–3127 4, 16(d); 9(r) 354
cry9B cryIX X75019 2272–2295, 2602–2625 4, 16(d); 9(r) 354
cry9C cry9C Z37527 4354–4377, 4681–4704 0(d); 0(r) 351
cry9D D85560 2338–2361, 2668–2691 0(d); 0(r) 354
a

The sequences of the universal primers (d, direct; r, reverse) are as follows: Un9(d), 5′-CGGTGTTACTATTAGCGAGGGCGG-3′; Un9(r), 5′-GTTTGAGCCGCTTCACAGCAATCC-3′. 

b

Starting from the first base of the sequence (of the respective cry gene) in the GenBank database. 

c

Numbers indicate bases from 5′ of primers that do not match to the respective sequences. 

TABLE 2.

Characteristics of specific primers for cry9 genes

Primer paira Sequence of primersb Gene recognized Positionsc Product size (bp)
EB-9A(d) GGTTCACTTACATTGCCGGTTAGC cry9A 1581–1604 1,547
Un9(r) GTTTGAGCcGCTTCACAGCAATCC 3104–3127
EB-9B(d) GCAAATGCATTTAGCGCTGGTCAA cry9B 1925–1948 701
Un9(r) GTTTGAGCcGCTTCACAGCAATCC 2602–2625
EB-9C(d) CCACCAGATGAAAGTACCGGAAG cry9C 3473–3495 1,232
Un9(r) GTTTGAGCCGCTTCACAGCAATCC 4681–4704
EB-9D(d) GCAATAAGGGTGTCGGTCACTGG cry9D 1754–1776 938
Un9(r) GTTTGAGCCGCTTCACAGCAATCC 2668–2691
a

(d) and (r), direct and reverse primers, respectively. 

b

Bases that do not match appropriate sequences are shown in lowercase letters. 

c

Starting from the first base of the sequence (of the respective cry gene) in the GenBank database. 

Amplification was carried out in a DNA MiniCycler (MJ Research, Inc., Watertown, Mass.) for 30 reaction cycles each. Reactions were routinely carried out in 25 μl; 1 μl of template DNA was mixed with reaction buffer, a 150 μM concentration of each deoxynucleoside triphosphate, a 0.2 to 0.5 μM concentration of each primer, and 0.5 U of Taq DNA polymerase (Appligene). Template DNA was denatured (1 min at 94°C) and annealed to primers (45 s at 56°C), and extensions of PCR products were achieved at 72°C for 50 s and 90 s for Un9 and specific primers, respectively. Each experiment was accompanied by a negative control (i.e., without DNA template).

Multiplex PCR screening for cry9 genes was performed on 16 B. thuringiensis standard strains previously used by us (3), as well as on 215 B. thuringiensis field isolates. Among the standard strains, only B. thuringiensis subsp. aizawai HD-133 yielded an amplicon with Un9 (Fig. 1, lane 4), though it was negative to the specific primers (lane 7). This strain contains cry2Ab (in addition to the four cry1 genes -Aa, -Ab, -Ca, and -Da [3, 10, 15]) and yielded a strong amplification product with universal primers for cry7 and cry8 (3). Another group (21) that claimed to have found cry2Ab in this strain only confirmed our previous finding (3). The low quality of their “degenerated family” primers for cry7 and cry8 (21) resulted in nonspecific amplicons (compare with reference 3). Another gene, cry1I (cryV in the old nomenclature), has also been found in this (21) and other B. thuringiensis subsp. aizawai strains (13, 24), and the product of this gene is known to be secreted into the medium in the early stationary phase (17).

A new gene, cry9Ea, has very recently been discovered in B. thuringiensis subsp. aizawai SSK-10 (2a) and should be recognized by Un9. Un9(d) hybridizes to nucleotides 2448 to 2471 with no mismatches, while Un9(r) hybridizes to nucleotides 2775 to 2798 with a single mismatch at residue 18. The resulting amplicon would be 351 bp in length. A new specific primer for cry9Ea should be designed to allow identification of cry9Ea in the strains that were positive to Un9 (see the Addendum in Proof).

Of the field-collected isolates, 22 yielded positive results with Un9 (Table 3). These were screened further for the presence of four cry9 genes. Three different cry9 gene profiles were found which contained also several combinations of cry1 and cry2 (Table 3). Fifteen isolates contained cry9Aa and cry9Ba (Fig. 1, lane 5) and two contained only cry9Da (lane 6), whereas five did not yield an amplicon by PCR with any of the four specific cry9 primers tested. None of our field-collected isolates contained cry9Ca.

TABLE 3.

Distribution of cry9 gene profiles of B. thuringiensis field-collected isolates

cry9 gene profile cry-type gene profile identified previouslyb No. of isolate(s)
cry9D cry1Aa, -Ab + cry2Ab 1
cry1Aa, -Ab, -Ac + cry2Aa, -Ab 1
cry9A, -B cry1Ab, -D + cry2Ab 4
cry1Ab, -Ac, -D + cry2Ab 1
cry1Ab, -D + cry2Ab, -Ac 10
cry9a cry1Ab, -D + cry2Ab, -Ac 1
cry1Aa, -Ab, -C, -D + cry2Ab 4
a

cry9 (without letter) indicates positive with universal and negative with specific primers. 

b

Ben-Dov et al. (3). 

It is interesting to note that the specific primer EB-9B(d) nonspecifically amplified a cry9Da fragment of 1,534 bp (Fig. 1, lane 6). Alignment analysis discovered that it anneals with low binding strength to bases 1158 to 1181 in the cry9Da coding sequence. Increasing the temperature to 60 to 62°C can prevent this nonspecific annealing.

The recent report by Bravo et al. (5) on an expanded set of general and specific primers includes a set for detecting three genes of the cry9 group (excluding cry9Da). At least one of these specific primers (spe-cry9C), corresponding to bases 1853 to 1868 (yielding an amplicon of 306 bp), is predicted to nonspecifically anneal also to bases 1961 to 1976 in cry9Ca (to amplify a fragment of 198 bp); it may thus interfere with amplification of the 306-bp fragment of cry9Ca. In addition, spe-cry9C is predicted to anneal nonspecifically both directly and in the reverse direction to cry9Ca and cry9Aa, thus giving rise to further nonspecific amplifications.

Bravo et al. (5) detected cry9 genes in 2.6% of their B. thuringiensis strain collection, whereas we found them in 10.2% of our collection (Table 3). This apparent difference in frequencies may reflect a real difference in prevalence of cry9 genes between the Latin American and Asian collections. It may however be due to the fact that in addition to a set of four specific primers we used a pair of universal primers (Un9) which amplifies all five cry9 genes (and also potentially other unknown genes of this family).

Our screening procedure identified five field-collected B. thuringiensis isolates positive to Un9 but not to any of our specific primers for four cry9 genes. This may indicate that these isolates contain new cry9 genes. They may be potential biological control agents against insect pests.

Acknowledgments

This investigation was supported by INTAS project no. 96-1490, U.S.-Israel Cooperative Development Research Program, U.S. Agency for International Development Grant no. TA-MOU-CA13-067, and by a post-doctoral fellowship (to E.B.-D.) from the Israel Ministry of Science.

Gideon Raziel is gratefully acknowledged for producing the picture.

ADDENDUM IN PROOF

The new specific primer EB-9E(a), 5′-GCGGCTGGCTTTACTTTACCGAG-3′, designed to identify cry9Ea by hybridization to nucleotides 1975 to 1977, amplified PCR product of 824 bp with Un9(r). B. thuringiensis subsp. aizawai HD-133 and four of the five field-collected isolates (positive to Un9) yielded an amplicon specific to cry9Ea.

REFERENCES

  • 1.Aronson A I. Bacillus thuringiensis and its use as a biological insecticide. Plant Breed Rev. 1994;12:19–45. [Google Scholar]
  • 2.Asano S. Identification of cry gene from Bacillus thuringiensis by PCR and isolation of unique insecticidal bacteria. Mem Fac Agric Hokkaido Univ. 1996;19:529–563. [Google Scholar]
  • 2a.Bacillus thuringiensis Toxin Nomenclature Website. 27 April 1999, revision date. [Online.] http://www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html. [19 June 1999, last date accessed.]
  • 3.Ben-Dov E, Zaritsky A, Dahan E, Barak Z, Sinai R, Manasherob R, Khameraev A, Troyetskaya A, Dubitsky A, Berezina N, Margalith Y. Extended screening by PCR for seven cry-group genes from field-collected strains of Bacillus thuringiensis. Appl Environ Microbiol. 1997;63:4883–4890. doi: 10.1128/aem.63.12.4883-4890.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bourque S N, Valero J R, Mercier J, Lavoie M C, Levesque R C. Multiplex polymerase chain reaction for detection and differentiation of the microbial insecticide Bacillus thuringiensis. Appl Environ Microbiol. 1993;59:523–527. doi: 10.1128/aem.59.2.523-527.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bravo A, Sarabia S, Lopez L, Ontiveros H, Abarca C, Ortiz A, Ortiz M, Lina L, Villalobos F J, Peña G, Nuñez-Valdez M-E, Soberón M, Quintero R. Characterization of cry genes in a Mexican Bacillus thuringiensis strain collection. Appl Environ Microbiol. 1998;64:4965–4972. doi: 10.1128/aem.64.12.4965-4972.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bulla L A, Jr, Bechtel D B, Kramer K J, Shethna Y I, Aronson A I, Fitz-James P C. Ultrastructure physiology and biochemistry of Bacillus thuringiensis. Crit Rev Microbiol. 1980;8:147–204. doi: 10.3109/10408418009081124. [DOI] [PubMed] [Google Scholar]
  • 7.Carozzi N B, Kramer V C, Warren G V, Evolan S, Koziel M G. Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles. Appl Environ Microbiol. 1991;59:3057–3061. doi: 10.1128/aem.57.11.3057-3061.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ceron J, Covarrubias L, Quintero R, Ortiz A, Ortiz M, Aranda E, Lina L, Bravo A. PCR analysis of the cryI insecticidal crystal family genes from Bacillus thuringiensis. Appl Environ Microbiol. 1994;60:353–356. doi: 10.1128/aem.60.1.353-356.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cerón J, Ortíz A, Quintero R, Güereca L, Bravo A. Specific PCR primers directed to identify cryI and cryIII genes within a Bacillus thuringiensis strain collection. Appl Environ Microbiol. 1995;61:3826–3831. doi: 10.1128/aem.61.11.3826-3831.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chak K F, Chow C D, Tseng M Y, Kao S S, Tuan S J, Feng T Y. Determination and distribution of cry-type genes of Bacillus thuringiensis isolates from Taiwan. Appl Environ Microbiol. 1994;60:2415–2420. doi: 10.1128/aem.60.7.2415-2420.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Crickmore N, Zeigler D R, Feitelson J, Schnepf E, Van Rie J, Lereclus D, Baum J, Dean D H. Revision of the nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiol Mol Biol Rev. 1998;62:807–813. doi: 10.1128/mmbr.62.3.807-813.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.de Barjac H, Frachon E. Classification of Bacillus thuringiensis strains. Entomophaga. 1990;35:233–340. [Google Scholar]
  • 13.Gleave A P, Williams R, Hedges R J. Screening by polymerase chain reaction of Bacillus thuringiensis serotypes for the presence of cryV-like insecticidal protein genes and characterization of a cryV gene cloned from B. thuringiensis subsp. kurstaki. Appl Environ Microbiol. 1993;59:1683–1687. doi: 10.1128/aem.59.5.1683-1687.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Jansens S, Van Vliet A, Dickburt C, Buysse L, Piens C, Saey B, De-Wulf A, Gossele V, Paez A, Goebel E, Peferoen M. Transgenic corn expressing a Cry9C insecticidal protein from Bacillus thuringiensis protected from European corn borer damage. Crop Sci. 1997;37:1616–1624. [Google Scholar]
  • 15.Juárez-Pérez V M, Ferrandis M D, Frutos R. PCR-based approach for detection of novel Bacillus thuringiensis genes. Appl Environ Microbiol. 1997;63:2997–3002. doi: 10.1128/aem.63.8.2997-3002.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kalman S, Kiehne K L, Libs J L, Yamamoto T. Cloning of novel cryIC-type gene from a strain of Bacillus thuringiensis subsp. galleriae. Appl Environ Microbiol. 1993;59:1131–1139. doi: 10.1128/aem.59.4.1131-1137.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kostichka K, Warren G W, Mullins M, Mullins A D, Craing J A, Koziel M G, Estruch J J. Cloning of a cryV-type insecticidal protein gene from B. thuringiensis: the cryV-encoded protein is expressed early in stationary phase. J Bacteriol. 1996;178:2141–2144. doi: 10.1128/jb.178.7.2141-2144.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kumar P A, Sharma R P, Malik V S. The insecticidal proteins of Bacillus thuringiensis. Adv Appl Microbiol. 1996;42:1–43. doi: 10.1016/s0065-2164(08)70371-x. [DOI] [PubMed] [Google Scholar]
  • 19.Kuo W S, Chak K F. Identification of novel cry-type genes from Bacillus thuringiensis strains on the basis of restriction fragment length polymorphism of the PCR-amplified DNA. Appl Environ Microbiol. 1996;62:1369–1377. doi: 10.1128/aem.62.4.1369-1377.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lambert B, Buysse L, Decock C, Jansens S, Piens C, Saey B, Seurinck J, Van Audenhove K, Van Rie J, Van Vliet A, Peferoen M. A Bacillus thuringiensis insecticidal crystal protein with a high activity against members of the family Noctuidae. Appl Environ Microbiol. 1996;62:80–86. doi: 10.1128/aem.62.1.80-86.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Masson L, Erlandson M, Puzstai-Carey M, Brousseau R, Juárez-Pérez V, Frutos R. A holistic approach for determining the entomopathogenic potential of Bacillus thuringiensis strains. Appl Environ Microbiol. 1998;64:4782–4788. doi: 10.1128/aem.64.12.4782-4788.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.McGaughey W H, Whalon M E. Managing insect resistance to Bacillus thuringiensis toxins. Science. 1992;258:1451–1455. doi: 10.1126/science.258.5087.1451. [DOI] [PubMed] [Google Scholar]
  • 23.Shevelev A B, Svarinsky M A, Karasin A I, Kogan Y N, Chestukhina G G, Stepanov V M. Primary structure of cryX, the novel δ-endotoxin-related gene from B. thuringiensis ssp. galleriae. FEBS Lett. 1993;336:79–82. doi: 10.1016/0014-5793(93)81613-5. [DOI] [PubMed] [Google Scholar]
  • 24.Shin B-S, Park S-H, Choi S-K, Koo B-T, Lee S-T, Kim J-I. Distribution of cryV-type insecticidal protein genes in Bacillus thuringiensis and cloning of cryV-type genes from B. thuringiensis subsp. kurstaki and B. thuringiensis subsp. entomocidus. Appl Environ Microbiol. 1995;61:2402–2407. doi: 10.1128/aem.61.6.2402-2407.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Smulevitch S V, Osterman A L, Shevelev A B, Kaluger S V, Karasin A I, Kadyrov R M, Zagnitko O P, Chestukhina G G, Stepanov V M. Nucleotide sequence of a novel δ-endotoxin gene cryIg of B. thuringiensis ssp. galleriae. FEBS Lett. 1991;293:25–28. doi: 10.1016/0014-5793(91)81144-w. [DOI] [PubMed] [Google Scholar]
  • 26.Van Frankenhuyzen K, Gringorten L, Gauthier D. Cry9Ca1 toxin, a Bacillus thuringiensis insecticidal crystal protein with high activity against the spruce budworm (Choristoneura fumiferana) Appl Environ Microbiol. 1997;63:4132–4134. doi: 10.1128/aem.63.10.4132-4134.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wasano N, Ohba M. Assignment of δ-endotoxin genes of the four lepidoptera-specific Bacillus thuringiensis strains that produce spherical parasporal inclusions. Curr Microbiol. 1998;30:408–411. doi: 10.1007/s002849900401. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES