Abstract
Purpose
Personal medicine is a new notion for individualizing treatment in the future. Studying pathogenic markers including genetic variants would be beneficial in better diagnosis and management of complex diseases such as diabetes and obesity. Adenosine deaminase (ADA) is a purine metabolic enzyme and modulates insulin activity in various tissues through several different mechanisms. Increased ADA activity is associated with decreased glucose uptake. A significant increase in serum deaminase activity has been reported in patients with T2DM and obesity. ADA gene polymorphisms seem to affect ADA enzymatic activity and a polymorphism at the position 4223 in the first intron of ADA gene (ADA 4223 A/C) has been previously associated with obesity. The aim of this study was to explore ADA gene 4223 A/C polymorphism and its association with obesity in patients with Type 2 diabetes.
Methods
Obese patients (N = 133: 64 diabetic +69 non-diabetic) with BMI ≥ 30 and subjects with BMI < 30 (N = 152: 83 diabetics +69 non-diabetic) were recruited into a case-control association study. Blood samples were collected and after DNA extraction, the allele and genotype frequency for ADA gene polymorphism was determined using PCR-RFLP technique.
Results
We observed a significant increase for the frequency of AA+CA genotype in non-obese patients with diabetes compared to obese patients with diabetes (P = 0.04, OR = 2.1, 95%CI; 0.93–4.9).
Conclusion
The higher frequency of AA+CA genotype in none obese diabetes individuals and lower frequency of this genotype in obese diabetes subjects indicates an important role for ADA gene polymorphism in diabetes subjects without obesity.
Keywords: Adenosine, Gene, Variants, Polymorphism, Diabetes, Obesity
Introduction
Personal medicine has been recently introduced as a novel approach in disease treatment according to which the risk of disease as well as treatment varies from person to person [1]. Personalized medicine through detection of the underlying factors in each individual can be effective in preventing, controlling, and treating diseases. Taking advantage of genetic testing in the identification of susceptible genes in disease will be helpful. Due to the role of genetic variants in the pathogenesis of diseases, their study can play an effective role in personalized medicine [2]. Diabetes is a rapidly increasing disease in all over the world. Obesity is the major cause of diabetes development due to increased insulin resistance, which is take place in this case. Several factors are involved in development of Obesity and consequently diabetes including nutrient intake, decreased physical activity and genetic background which have great impact on metabolic system [3, 4]. Adenosine deaminase (ADA) is a purine metabolic enzyme and modulates insulin activity in various tissues through several different mechanisms, while ADA seems to play a significant role in obesity [5]. Adenosine, an endogenous anti-inflammatory metabolite, is increased in response to inflammation. Its production is increased by adipose tissue in obesity. Adenosine has anti-lipolysis function in adipose tissue and enhance insulin sensitivity for glucose transport [6]. Since ADA has been putatively associated with inflammation, and adipose tissue inflammation is the hallmark of insulin resistance in obese Type 2 diabetes (T2DM) patients, the serum level of ADA in non-obese T2DM is ill-defined. However, adenosine deaminase acts on adenosine to convert it into inosine, thereby increasing adenosine deaminase activity is observed in overweight and obese subjects [5]. As inflammation is a key mediator in diabetes, adenosine plays as a possible link between obesity and diabetes. On the other hand a preliminary case-control study shows higher serum ADA, triglycerides (TG) and fasting plasma glucose (FPG) levels in non-obese T2DM patients, and a strong correlation between ADA and FPG which suggests an association between ADA and non-obese T2DM subjects [7]. Increased ADA activity is associated with decreased glucose uptake [8] and a significant increase in serum deaminase activity has been reported in patients with T2DM [9]. It has been observed that ADA inhibition might be helpful in improvement of insulin sensitivity and other features associated with T2DM including inflammation [10]. ADA activity has been linked with maturity onset diabetes of young (MODY) and also with T2DM [11]. The rs200751 polymorphism through the effects on ADA enzyme activity is associated with obesity [12]. The role of this polymorphism has not been elucidated in patients with diabetes. The aim of this study was to explore ADA gene 4223 A/C polymorphism and its association with obesity in patients with Type 2 diabetes.
Materials and methods
The study comprised of 45 morbid obese cases with BMI > 35 which 24 were diabetics and 21 non-diabetics, 88 obese cases with 30 ≤ BMI < 35 which 40 were diabetics and 48 non-diabetics and 152 normal subjects with BMI < 30 which 83 were diabetics and 69 non-diabetics (the presence of other associated diseases was excluded from obese-diabetic subjects by an expert specialist endocrinologist) who referred to Endocrinology and Metabolism Research Institute of Tehran university of medical Sciences. All participant attended in a study designed based on WHO designed MONICA (multinational monitoring of trends and determinants in cardiovascular disease) study for coronary artery disease risk assessment. A written informed consent from the patients and controls was obtained. All the patients and controls were clinically examined and routine biochemical tests were analyzed for all subjects prior to selection. Hypertension, ischemic heart disease, neurological disorders, renal failure, chronic liver disease, cancer, and immunological disorders were excluded from this study. The study was approved by the institutional ethics committee which follows Helsinki guidelines.
Blood samples were collected in tubes (5 ml) containing EDTA and were stored at −20 °C. DNA from cases and controls was extracted from anti-coagulated blood collected in EDTA using phenol–chloroform protocol [13]. Genotyping for detection of SNP 4223A/C polymorphism of the ADA gene was performed using polymerase chain reaction restriction fragment length polymorphisms method. In brief, a DNA fragment (511 bp) containing the SNP 4223A/C was amplified by 5′- TATCTCACGGAATCCTCTGG −3′ as forward primer and 5′- TGCATCAGAGAGGGACAGTT −3′ as reverse primer. MspI restriction endonuclease digested the PCR product yielding DNA fragment of 333, 108, 28, 43 base pairs when A allele was present and DNA fragments of 186, 147, 108, 28 and 43 base pairs when allele C was present. A total of 100 ng genomic DNA was amplified in a 20 μl PCR reaction, PCR buffer containing 3 mM MgCl2, 0.25 Mm dNTPs, 5 pmol of each primer, 1 U Taq polymerase. The PCR cycles were as follows: primary denaturation was carried at 95 °C for 5 min followed by 34 cycles of 95 °C for 30 s, 57 °C for 30 s, 72 °C for 40 s. the final extension was carried at 72 °C for 5 min. The presence of product (511 base pairs) was verified on a 2% agarose gel stained with SYBER green. PCR products were digested with MspI in a 10 μl final volume. This contained 7 μl of PCR product, 1 × NE buffer, 10 U MspI. The digest was incubated overnight at 37 °C and the products of the digest were then visualized on a 3% agarose gel.
Statistical methods
Results were analyzed using SPSS software version 19.0. The chi-square test or Fisher exact analysis was used to compare frequencies of allele and genotypes, and the strength of association between different groups of ADA polymorphism was estimated by odds ratio (OR) and 95% confidence intervals (CI). For all comparison, the statistical significance was defined by a P<0.05.
Results
Demographic characteristics and biochemical measurements between normal, obese, obese group with diabetes and normal group with diabetes are shown in Table 1. Mean age of patients in the morbid group was 48.8 ± 11, 45.6 ± 7.8 in obese group and 45.2 ± 8.6 in normal group. The male/female ratio was 34/54 in obese group and 64/83 in normal group. The male/female ratio was 3/42 in morbid obese group. None of patients included in the study were under insulin therapy. Allele and genotype frequencies for ADA 4223 A/C variation conform to Hardy-Weinberg equilibrium in our population (p > 0.05). Allele and genotype frequencies for ADA gene polymorphism in different groups are shown in Table 2. There was a significant increase of the frequency of AA genotype in obese group compared to the normal group (p = 0.02, OR = 2.2, 95%CI; 1.06–4.72). When we stratified our obese group to the morbid obese BMI ≥ 35 and obese groups (35 > BMI ≥ 30) we observed a significant difference for ADA gene frequency between patients with and without diabetes in the obese group (Table 1). The frequency of AA+CA genotype was significantly increased in obese subjects without diabetes compared to obese group with diabetes (p = 0.04, OR = 2.4, 95%CI; 0.94–6.3). In addition, we observed a significant increase for AA+CA genotype in none obese patients with diabetes compared to obese patients with diabetes (p = 0.04, OR = 2.1, 95%CI; 0.93–4.9). Finally there was also a significant increase for the frequency of AA genotype in obese subjects without diabetes compared to the non-obese non-diabetes group (p = 0.03, OR = 3.3, 95%CI; 0.95–13.3). Also we grouped our subjects based on waist/height ratio (WHtR) for assessment of ADA gene polymorphism association with central obesity. Although most of diabetes patients had central obesity (WHtR>0.5) but in a very small group of patients with diabetes (WHtr ≤0.5) there was a significant increase in frequency of AA+CA genotype compared to the patients without diabetes (p = 0.01, OR = 8.5, 95%CI; 0.95–103) (Table 2).
Table 1.
Demographic characteristics and biochemical measurements between normal, obese, obese group with diabetes and normal group with diabetes
| Variable | Normal (N = 75) |
Obese (N = 72) |
Normal group with diabetes (N = 80) |
Obese group with diabetes (N = 71) |
P value (ANOVA) |
|---|---|---|---|---|---|
| Sex (male) (%) | 43.8% | 25.6% | 44.3% | 14.9% | <0.005* |
| Age | 35.22 ± 11.30 | 44.83 ± 11.49 | 51.92 ± 11.31 | 51.07 ± 10.64 | <0.005≠ |
| BMI (kg/m2) | 24.85 ± 2.98 | 33.89 ± 3.45 | 26.14 ± 2.82 | 34.60 ± 4.35 | <0.005£ |
| FBS (mg/dl) | 74.25 ± 8.57 | 80.74 ± 10.05 | 139.57 ± 75.74 | 135.05 ± 65.17 | <0.005& |
| HDL (mg/dl) | 59.14 ± 17.50 | 62.60 ± 15.45 | 62.36 ± 19.41 | 65.80 ± 16.34 | 0.13 |
| LDL (mg/dl) | 107.50 ± 29.59 | 120.50 ± 38.35 | 102.86 ± 35.93 | 105.74 ± 29.56 | 0.65 |
| Triglyceride (mg/dl) | 149.40 ± 88.73 | 184.96 ± 130.56 | 251.77 ± 200.13 | 259.64 ± 200.95 | <0.005¥ |
| Total serum cholesterol (mg/dl) | 193.33 ± 44.80 | 212.13 ± 39.39 | 205.27 ± 53.72 | 213.64 ± 39.02 | 0.02 |
Values are presented as mean ± SD;
≠ obese, obese group with diabetes and normal group with diabetes versus normal
£ obese and obese group with diabetes versus normal versus normal group with diabetes
& obese and normal subject versus obese group with diabetes versus normal group with diabetes
¥ normal subjects versus obese group with diabetes versus normal group with diabetes (p < 0.005 on Tukey’s post hoc analysis)
Table 2.
The frequency of ADA gene variant in different groups
| ADA polymorphism | Morbid obese group | Obese group | Normal group | |||
|---|---|---|---|---|---|---|
| Genotype | With diabetes | Without diabetes | With diabetes | Without diabetes | With diabetes | Without diabetes |
| (N = 24) | (N = 21) | (N = 40) | (N = 48) | (N = 83) | (N = 69) | |
| AA | 5(20.8) | 5(23.8) | 6(15)*# | 10(20.8)*& | 10(12)# | 5(7.2)& |
| AC | 13(54.1) | 8(38.09) | 12(30) | 22(45.8) | 43(51.8) | 40(57.9) |
| CC | 6 (25) | 8(38.09) | 22(55) | 16(33.3) | 30(36.1) | 24(34.7) |
| Allele | ||||||
| A | 23(47.9%) | 18(42.9%) | 24(30%) | 42(43.8%) | 63(38%) | 50(36.2%) |
| C | 25(52.1%) | 24(57.1%) | 56(70%) | 54(56.2%) | 103(62%) | 88(63.8%) |
| P value (vs. controls) | 0.63 | 0.06 | 0.75 | |||
* AA+CA vs CC, P = 0.04, OR = 2.4, 95%CI; 0.94–6.3
# AA+CA vs CC, P = 0.04, OR = 2.1, 95%CI; 0.93–4.9
& AA vs CA+ CC, P = 0.03, OR = 3.3, 95%CI; 0.95–13.3
Discussion
Both genetics and environmental factors contribute to diabetes and obesity [14, 15]. Therefore, studying genetic markers can be effective in personalized medicine [16]. It has been observed that diabetes associated genetic variation might be as a result of only a subtle variation in the gene sequence, and sometimes these variations may be common in normal population. In order to identify genetic susceptibility in complex disorders more recently genome wide association studies have been introduced as powerful tools for finding association between the common gene variations, known as single nucleotide polymorphisms (SNPs) with disease. However due to some reasons including heterogeneity in disease feature in various individuals’ studies on clinically defined homogenous populations for finding disease causing variants association with a specific clinical feature seems to be more valuable.
A major breakthrough in the molecular genetics of maturity onset diabetes of young (MODY) in the RW pedigree (The largest and best-studied MODY pedigree that diabetic subjects in this pedigree has a reduced and delayed insulin-secretory response to glucose) came in 1991, when after testing more than 75 DNA markers, Graeme Bell, Nancy Cox, and colleagues found that a DNA polymorphism in the adenosine deaminase gene (ADA) on the long arm of chromosome 20 co-segregated with MODY [10]. They identified the gene responsible for MODY which was in strong linkage disequilibrium with ADA gene. These results were confirmed and extended by Bowden et al. [17]. Although ADA gene is not a MODY locus gene but the strong linkage of ADA gene with MODY locus might be due to its contribution to the diabetes susceptibility. ADA gene seems to contribute to diabetes development through its potential role in inflammation which has an essential role in diabetes and also in obesity as an underlying factor in diabetes, but its clinical significant in T2DM has not yet been proven. An association was reported between the (4223 A/C) variant in the intron region of the ADA gene and obesity [12].
Although obesity is known as an important fundamental risk factor in development of diabetes it is ascertained by some studies that presence of diabetes is not always associated with obesity e.g. Asian T2DM patients were generally less obese when defined by Body Mass Index (BMI) and approximately 20% of north European T2DM cases are defined as non-obese type [18, 19]. Insulin resistance and impaired insulin secretion are the main physiological abnormalities associated with T2DM [12]. Immunological disturbances involving the cell mediated immune system and improper T lymphocyte function also contribute to the pathophysiology of T2DM [20]. ADA converts adenosine to inosine through an irreversible deamination reaction [21]. Alteration in serum ADA activity has been reported in fertility, fatty tissues, diabetes, cancers, and chronic heart failure [22]. ADA activity measurements in the serum of obese T2DM patients have been carried out with reports indicating an increase in ADA activity in these cases. Adenosine has anti-lipolysis function in adipose tissue and enhance insulin sensitivity for glucose transport [6]. Adenosine inhibited adenylate cyclase through A1 adenosine receptors on the adipocytes, resulting in the inhibition of lipolysis removal of endogenous adenosine by ADA resulted in an immediate rise in lypolytic activity [23]. Adenosine increases accessibility about 25% of GLUT4 to cell surface for glucose transportation and the accumulation of the insulin-induced PIP3 and PKB in post receptor phases is increased by the binding of adenosine to A1 receptor [24, 25]. It also elevated glycogenesis and glycogenolysis via increasing cyclic AMP (CAMP) by stimulation of hepatic adenylate cyclase through adenosine A2a receptor binding in liver. Both or either of these actions causes the increase of local insulin resistance and glucose output from the liver [26]. Adenosine is responsible for increasing glucose uptake into the cells [8]. Thus, higher ADA activity in insulin sensitive tissue will decrease adenosine levels which in turn decrease glucose uptake into cells. ADA also plays a crucial role in lymphocyte proliferation and differentiation and is highly active in T lymphocytes [27]. Thus, a suppression of ADA activity may help improve insulin sensitivity and inflammation, cell proliferation, and T lymphocyte activity, all of which are putatively associated with the pathophysiology of T2DM. Because a significant proportion of T2DM patients are non-obese [19], therefore in non-obese subjects the role of inflammation is thought to be less important for decreased amount of adipose tissue [28]. As inflammation plays a minimal role in non-obese patients, elevated ADA levels are thought to play a crucial role compared to obese patients. Identifying individuals genetic background of patients with diabetes can be helpful in pharmacogenetics studies and controlling the complications of diabetes [1, 29]. Gene polymorphisms such as SLC22A1 (solute carrier family 22 member 1) and SLC47A1 (solute carrier family 47 member 1) have different reaction to metformin, which could indicate the importance of personalized medicine in pharmacogenetics [30]. In addition, it has been confirmed that targeting MC4R variants in patients with obesity, has been successful in controlling the disease as an example of personalized medicine [31].
In our study we explored ADA gene 4223 A/C polymorphism and its association with obesity in patients with Type 2 diabetes. There was a significant increase of the frequency of AA genotype in obese group compared to the normal group. Similar to our study, the frequency of allele A was higher in obese group than control group in Yaghoubi et al study(p = 0.03) [32].
In one study, the level of ADA in the saliva of obese people was higher than the normal group, which shows the correlation between ADA and BMI [33]. No association was observed between ADA (G22A) variant and gestational diabetes mellitus (GDM) in the Iranian population [34]. There is an association between adiponectin marker and insulin resistance in obese patients [35].
The frequency of AA+CA genotype was significantly increased in obese subjects without diabetes compared to obese diabetic group. There was also a significant increase for the frequency of AA genotype in obese subjects without diabetes compared to the non-obese non-diabetic group. The above demonstrates that there is a strong association between obesity and ADA gene polymorphism, which was expected from the previous literature. However in the group of non-obese diabetic patients we found that the frequency of A allele was significantly higher than obese diabetics group. This fact might suggest that the pathophysiology of the development of insulin resistance in the group of non-obese diabetic is different from that which applies in obese diabetics and in this process an important role may be played by ADA. The same result was found in group of patients with diabetes without central obesity as the main indicator of insulin resistance in this group frequency of A allele was significantly higher in comparison to people who had neither diabetes nor abdominal obesity.
Our finding confirms the previous finding for association between ADA gene polymorphism and obesity [12]. However it is not clear yet whether this variation contribute to the alteration in serum ADA activity which needs to be further investigated by functional in vitro and in vivo studies. Our results indicate that the presence of A allele (AC or AA genotype) also confers risk in non-obese patients with diabetes pointing to the various regulatory mechanism for ADA gene in diabetes and obesity which requires further investigations. More studies looking at other functional variants of ADA gene in larger number of samples would be useful to clarify the role of ADA activity in diabetes with and without obesity. The higher frequency of AA+CA genotype in lean diabetes individuals and lower frequency of this genotype in obese diabetes subjects designates an important role for ADA activity in diabetes subjects without obesity and a regulatory role for ADA involved in presence of diabetes non-obese patients as an alternative to the role of adiposity and insulin resistance.
Acknowledgments
This work has been supported by Endocrinology and metabolism research institute, Tehran University of medical sciences. We gratefully thank the patients for their participation in this study.
Funding
This work has been supported by Endocrinology and metabolism research institute, Tehran University of medical sciences.
Declarations
Conflict of interest
The authors didn’t have any conflict of interest.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Sepideh Borhan Dayani, Email: atikehborhan@gmail.com.
Saeedeh Asgarbeik, Email: saeedeh.asgarbeik@yahoo.com.
Mojgan Asadi, Email: asadim@tums.ac.ir.
Mahsa M. Amoli, Email: amolimm@tums.ac.ir
References
- 1.Liao W-L, Tsai F-J. Personalized medicine in type 2 diabetes. BioMedicine. 2014;4(2) [DOI] [PMC free article] [PubMed]
- 2.Joyner MJ, Paneth N. Seven questions for personalized medicine. JAMA. 2015;314(10):999–1000. doi: 10.1001/jama.2015.7725. [DOI] [PubMed] [Google Scholar]
- 3.Bray GA. Treatment for obesity: a nutrient balance/nutrient partition approach. Nutr Rev. 1991;49(2):33–45. doi: 10.1111/j.1753-4887.1991.tb02990.x. [DOI] [PubMed] [Google Scholar]
- 4.Kokkoris P, Pi-Sunyer FX. Obesity and endocrine disease. Endocrinol Metab Clin N Am. 2003;32(4):895–914. doi: 10.1016/S0889-8529(03)00078-1. [DOI] [PubMed] [Google Scholar]
- 5.Jadhav AA, Jain A. Elevated adenosine deaminase activity in overweightand obese Indian subjects. Arch Physiol Biochem. 2012;118(1):1–5. doi: 10.3109/13813455.2011.603341. [DOI] [PubMed] [Google Scholar]
- 6.Johansson SM, et al. Adenosine A1 receptors regulate lipolysis and lipogenesis in mouse adipose tissue—interactions with insulin. Eur J Pharmacol. 2008;597(1–3):92–101. doi: 10.1016/j.ejphar.2008.08.022. [DOI] [PubMed] [Google Scholar]
- 7.Khemka VK, et al. Raised serum adenosine deaminase level in nonobese type 2 diabetes mellitus. Sci World J. 2013;2013 [DOI] [PMC free article] [PubMed]
- 8.Vergauwen L, Hespel P, Richter EA. Adenosine receptors mediate synergistic stimulation of glucose uptake and transport by insulin and by contractions in rat skeletal muscle. J Clin Invest. 1994;93(3):974–981. doi: 10.1172/JCI117104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Figler RA, et al. Links between insulin resistance, adenosine A2B receptors, and inflammatory markers in mice and humans. Diabetes. 2011;60(2):669–679. doi: 10.2337/db10-1070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Bell GI, et al. Gene for non-insulin-dependent diabetes mellitus (maturity-onset diabetes of the young subtype) is linked to DNA polymorphism on human chromosome 20q. Proc Natl Acad Sci. 1991;88(4):1484–1488. doi: 10.1073/pnas.88.4.1484. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kurtul N, et al. Adenosine deaminase activity in the serum of type 2 diabetic patients. Acta Medica-Hradec Kralove. 2004;47(1):33–36. [PubMed] [Google Scholar]
- 12.Amoli MM, et al. Adenosine deaminase gene polymorphism is associated with obesity in Iranian population. Obes Res Clin Pract. 2007;1(3):173–177. doi: 10.1016/j.orcp.2007.06.001. [DOI] [PubMed] [Google Scholar]
- 13.Di Pietro F, et al. Genomic DNA extraction from whole blood stored from 15-to 30-years at− 20 C by rapid phenol–chloroform protocol: a useful tool for genetic epidemiology studies. Mol Cell Probes. 2011;25(1):44–48. doi: 10.1016/j.mcp.2010.10.003. [DOI] [PubMed] [Google Scholar]
- 14.Permutt MA, Wasson J, Cox N. Genetic epidemiology of diabetes. J Clin Invest. 2005;115(6):1431–1439. doi: 10.1172/JCI24758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Albuquerque D, et al. The contribution of genetics and environment to obesity. Br Med Bull. 2017;123(1):159–173. doi: 10.1093/bmb/ldx022. [DOI] [PubMed] [Google Scholar]
- 16.Offit K. Personalized medicine: new genomics, old lessons. Hum Genet. 2011;130(1):3–14. doi: 10.1007/s00439-011-1028-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Bowden DW, et al. Identification of genetic markers flanking the locus for maturity-onset diabetes of the young on human chromosome 20. Diabetes. 1992;41(1):88–92. doi: 10.2337/diab.41.1.88. [DOI] [PubMed] [Google Scholar]
- 18.Mohan V, et al. Epidemiology of type 2 diabetes: Indian scenario. Indian J Med Res. 2007;125(3):217–230. [PubMed] [Google Scholar]
- 19.Vaag A, Lund SS. Non-obese patients with type 2 diabetes and prediabetic subjects: distinct phenotypes requiring special diabetes treatment and (or) prevention? Appl Physiol Nutr Metab. 2007;32(5):912–920. doi: 10.1139/H07-100. [DOI] [PubMed] [Google Scholar]
- 20.Prakash MS, et al. Altered adenosine deaminase activity in type 2 diabetes mellitus. Age. 2006;43(6.2):44–46. [Google Scholar]
- 21.Yang Z, et al. Ultraviolet polarized LiDAR system for biological aerosols. Int J Simul Syst Sci Technol. 2016;17
- 22.Christesen SD, et al. Ultraviolet fluorescence lidar detection of bioaerosols. In Atmospheric Propagation and Remote Sensing III. 1994. International Society for Optics and Photonics.
- 23.Hoshino T, et al. Elevated adenosine deaminase activity in the serum of patients with diabetes mellitus. Diabetes Res Clin Pract. 1994;25(2):97–102. doi: 10.1016/0168-8227(94)90034-5. [DOI] [PubMed] [Google Scholar]
- 24.Vannucci SJ, et al. Cell surface accessibility of GLUT4 glucose transporters in insulin-stimulated rat adipose cells. Modulation by isoprenaline and adenosine. Biochem J. 1992;288(1):325–330. doi: 10.1042/bj2880325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Takasuga S, et al. Enhancement by adenosine of insulin-induced activation of phosphoinositide 3-kinase and protein kinase B in rat adipocytes. J Biol Chem. 1999;274(28):19545–19550. doi: 10.1074/jbc.274.28.19545. [DOI] [PubMed] [Google Scholar]
- 26.Warrier AC, et al. Evaluation of adenosine deaminase activity and lipid peroxidation levels in diabetes mellitus. Indian J Clin Biochem. 1995;10(1):9. doi: 10.1007/BF02873661. [DOI] [Google Scholar]
- 27.Zavialov AV, et al. Human adenosine deaminase 2 induces differentiation of monocytes into macrophages and stimulates proliferation of T helper cells and macrophages. J Leukoc Biol. 2010;88(2):279–290. doi: 10.1189/jlb.1109764. [DOI] [PubMed] [Google Scholar]
- 28.Wisse BE. The inflammatory syndrome: the role of adipose tissue cytokines in metabolic disorders linked to obesity. J Am Soc Nephrol. 2004;15(11):2792–2800. doi: 10.1097/01.ASN.0000141966.69934.21. [DOI] [PubMed] [Google Scholar]
- 29.Elk N, Iwuchukwu OF. Using personalized medicine in the management of diabetes mellitus. Pharmacotherapy: J Human Pharmacol Drug. Therapy. 2017;37(9):1131–1149. doi: 10.1002/phar.1976. [DOI] [PubMed] [Google Scholar]
- 30.Malandrino N, Smith RJ. Personalized medicine in diabetes. Clin Chem. 2011;57(2):231–240. doi: 10.1373/clinchem.2010.156901. [DOI] [PubMed] [Google Scholar]
- 31.Blakemore AI, Froguel P. Investigation of Mendelian forms of obesity holds out the prospect of personalized medicine. Ann N Y Acad Sci. 2010;1214(1):180–189. doi: 10.1111/j.1749-6632.2010.05880.x. [DOI] [PubMed] [Google Scholar]
- 32.Yaghoubi H, Haghi M, Radjabalizadeh K. Association of adenosine deaminase (ADA) gene 4223A/C polymorphism with obesity in Ardabil, Iran. Pathobiol Res. 2017;20(2):79–87. [Google Scholar]
- 33.Chielle EO, et al. Adenosine deaminase, dipeptidyl peptidase-IV activities and lipid peroxidation are increased in the saliva of obese young adult. Clin Chem Lab Med (CCLM) 2015;53(7):1041–1047. doi: 10.1515/cclm-2014-1086. [DOI] [PubMed] [Google Scholar]
- 34.Takhshid MA, et al. G22A polymorphism of adenosine deaminase and its association with biochemical characteristics of gestational diabetes mellitus in an Iranian population. Iran J Med Sci. 2015;40(2):170. [PMC free article] [PubMed] [Google Scholar]
- 35.Chielle EO, et al. Adipocytokines, inflammatory and oxidative stress markers of clinical relevance altered in young overweight/obese subjects. Clin Biochem. 2016;49(7–8):548–553. doi: 10.1016/j.clinbiochem.2016.01.003. [DOI] [PubMed] [Google Scholar]