Assessment of resveratrol on diabetes of zebrafish (Danio rerio)

Abstract

Purpose

Zebrafish (Danio rerio) is an established model for studying various metabolic diseases. The aim of this study was to evaluate the effect of resveratrol as a natural polyphenol on reducing inflammation caused by hyperglycemia (diabetes) and its effect on digestive tissue as well as TNF-α, IFN-γ, and INL1β genes in zebrafish.

Methods

Within a 20-day period, the research was performed on 120 adult zebrafish, which were randomly classified into eight groups: two experimental treatments (induced glucose = +G) and (without glucose = −G), where each main group was as follows: CTRL = control and RSV resveratrol with doses 10, 20, and 30 μmol/L. At the end of the period, the blood glucose level was measured using glucose test strip, staining of intestinal tissue was done by hematoxylin and eosin (H&E), and expression of INF-γ, IL1-β, and TNF-α genes extracted from the intestinal was measured via internal method RT-PCR. Data analysis in this study was performed using SPSS software version 21. One-way ANOVA and mean comparison of treatments by Duncan test were used for data analysis. All statistical analyses were performed at a significant level (P < 0.5) where the mean data were presented with standard deviation.

Results

According to the results, the lowest blood sugar level at the end of the experiment belonged to the group (G-RSV20) where no significant difference was observed between treatments (P > 0.05). The highest expression of IL1-β gene belonged to the (G + CTRL) group (P < 0.05), while the (G + RSV20) group showed the lowest expression of the INF-γ gene and had a significant difference with other groups (P < 0.05). In (G + RSV10) treatment, the lowest expression of TNF-α gene was observed and there was no significant difference with other treatments (P > 0.05). Resveratrol would improve the absorption of nutrients in the intestinal tissue by increasing the number of goblet cells as well as the width and height of the villi.

Conclusion

Collectively, this study indicated that treatment with resveratrol could improve metabolic-mediated performances by reducing blood glucose, increasing food absorption in the intestine tissue, and reducing the expression of inflammatory genes in type 2 diabetic zebrafish model.

Introduction

Hyperglycemia is the result of non-production of insulin, insulin insufficiency, or the cells’ unresponsiveness to insulin [1]. In 2019, around 463 million adults had diabetes; the concerning point is that this trend is growing rapidly, and will reach 700 million up to 2045. In 2019, diabetes caused the death of 4.2 million people [2]. In Iran, around 11% of the population above 25 years of age suffer from diabetes [2].

Accordingly, whole animal models are essential for better understanding of the development and progression of metabolic dysfunction. Zebrafish is an excellent model for examining metabolic dysfunction, as they have the key organs that are important for regulation of energy homeostasis and metabolism in mammals, including digestive organs, adipose tissue, and skeletal muscle (Lieschke and Currie, 2007). Controlling and regulating the metabolic homeostasis of the total energy of the body involves complex interactions between different organs. In laboratory experiments, complexity in the body cannot be re-created, so the study of metabolism requires complete animal approaches as it occurs in a multicellular context. Zebrafish is a good model in which metabolism can be studied thanks to possessing all main organs necessary to control metabolism in humans (Asha et al., 2013). Around 70 to 80% of the zebrafish genes are similar to human genome counterparts [3]. The national Institute of health (NIH) has introduced zebrafish as a biological model for investigating metabolic diseases given maintenance of function in metabolism of lipids, lipid biology, and glucose homeostasis [4].

Resveratrol (3,4′ and 5 trihydroxy acetylene) is a natural phytotoxin material mostly found in cereals, fruits, vegetables, dry beans, and plant-based drinks including tea, coffee, and wine. Resveratrol has various biological and pharmaceutical properties such as anti-diabetes, anti-obesity, anticancer, anti-inflammatory, antioxidant as well as cardioprotective effects [5, 6]. Generally, treatment of diabetes involves reducing blood sugar, improving insulin sensitivity, and preserving the pancreas beta cells [7]. Resveratrol causes inhibition of cell oxidative stress and prevents inflammation in the body of diabetics through activating the SIRT1 system [8]. Resveratrol can stimulate intracellular metabolic pathways, helping cells effectively use insulin and glucose, thereby reducing the blood glucose level [9]. Also, through stimulating AMPK, it supports the hypoglycemic effects in diabetes mellitus animal models [10].

Tumor necrosis factor (TNF-α) molecule enhances the production of different types of hematopoietic and non-hematopoietic cells, including macrophages, T lymphocyte, B lymphocyte, and neutrophils [11]. Bacterial lipopolysaccharide (LPS) is the most important inducer of TNF-α production [12]. It has been reported that resveratrol causes reduced inflammation through inhibiting the production of cytokines such as TNF alpha, IL-1, IL-6, and VGEF under in vitro conditions [13]. These effects are due to anti-inflammatory, antioxidant, antiplatelet, and lipid reducing properties. It also supports modulating blood glucose and protects the beta cells in pancreas (insulin production) [14]. The aim of the present study was to determine the effect of resveratrol on parameters associated with hyperglycemia (diabetes), digestive tissue, hepatic enzyme, and TNF-α gene on zebrafish. Clarification of this issue would lead to better insights into the resveratrol mechanisms.

Materials and methods

Experimental design

The tests were performed on 120 zebrafish with the approximate weight of 0.4 ± 0.5 g and length of 3 ± 0.5 cm (the fish used in this research had a specific genetic ID, and as such they were purchased from the principal laboratory of research Center on zebrafish at Tampere University, Finland). The fish were randomly assigned and kept inside eight incubators (n = 15 in each group) with a volume of 2 L with 1:1 ratio at 28 °C with the light- dark cycle of 10:14 h (8 a.m. light). During the maintenance periods of the fish, dissolved oxygen was about 7 mg /L and pH around 7. The fish were fed three times, with the food being GEMMA Micro (Skretting company). It was composed of 59% protein, 14% fat, 0.2% fiber, and 14% ash (Skretting a Nutreco company). All protocols were performed according to the Research Center of Endocrine Glands and Metabolism of Tehran University of Medical Sciences. After a three-week adaptation period, adult zebrafish which had been placed randomly inside eight tanks were divided into two experimental groups (induced glucose = +G) and (without glucose = −G). Each of the major groups included four subgroups known as (control = CTRL), (Resveratrol = RSV) with doses 10, 20, and 30 μmol/L.

Induction of hyperglycemia

The fish were kept for 4 days with the glucose concentration of 50 mM (Merck Germany). On day 5, glucose concentration was elevated up to 100 ml. Then, in order to prevent the mortality, the status of the fish was monitored constantly for three days. Thereafter, the glucose concentration was heightened to 200 mM. Glucose concentration with the doses of 50, 100, and 200 mM [15, 16] was calculated based on its molecular weight, with 79, 160, and 317 g being added to the glucose -containing treatments respectively.

Resveratrol treatments

The fish were subject to 10, 20, and 30 μmol/L of resveratrol (Jamison Canada) [17]. Each capsule contained 50 mg of resveratrol; in order to obtain the doses required in this research, one capsule was dissolved in 8 L of water, where 1.4 L, 2.6 L, and 4 L of this solution were added to water for the doses of 10, 20, and 30 respectively. In the treatments containing (glucose+ resveratrol), resveratrol was added to the treatments at glucose concentrations of 100 and 200 mM glucose.

Determination of blood glucose levels

For all experiments of blood glucose determination, before beginning the experiment, three fish were randomly collected from each tank, whereby feeding was stopped for 12 h, and exposed to glucose free water in the tank in order to prevent contamination of the glucometer strips [18]. Next, the tail was immediately cut, whereby the blood glucose level was measured by placing the glucose meter strip (One Touch Ultra Accu check) directly on the tail [19]. The blood glucose level was measured in two stages at 50 and 200 mM concentrations.

Intestinal histology

For histological studies, the fish were dissected, whereby the intestinal tissue was separated and placed inside Bowen tissue stabilizing solution. Forty-eight hours following stabilization, the samples were stored in alcohol 70%, and kept in that until the next phases of experiments [20]. The intestinal tissue preparation stages included dehydration, clarification and embroidery using a tissue processing device (Pouyan MK1420 Iran). After this stage, incisions were made 6 μm thick using a microtome device (Pouyan MK1110 Iran). Next, tissue slides were stained using hematoxylin-eosin (H&E) method [21]. Microscopic investigation of the intestinal tissue was performed using optical microscope with 40X magnification equipped with a digital imaging camera (Nikon eclipse 50i).

Gene expression

The genes studied in this research included IFN-γ, IL-1β, and TNF-α, where β-actin gene was used as a housekeeping gene. RNA extraction was done from the zebrafish intestinal using RNX-Plus Solution for total RNA isolation kit, EX6101 (Sinaclone Co Iran), according to the manufacturer’s instructions [22]. RNA concentration was determined for cDNA preparation using nanodrop, and after homogenization the value of 452.34 ± 98.56 (ng/ul) was used (2000c Thermo scientific). Further, 3 μL of RNA was used for cDNA synthesis via reactive 50 reverse transcription kit (A101161 Parstoos Iran). Before conducting the real-time PCR, 1 μL of cDNA was diluted as the pattern for reaction with 100 μL of PCR primer (Sinaclone Iran). The expression of the studied mRNA genes was checked via cyber green method by Step One Plus device with the catalog number of 4,376,782 belonging to Applied Biosystems company (USA) with one block and 96 wells. The thermal profile for all reactions was as follows: 95 °C followed by 40 cycles, 15 s at 95 °C, 20 s at 55 °C, and eventually one cycle for 30 s at 72 °C. The degree of fluorescence at the end of each cycle was recorded by the device. The thermal profile between 60 and 95 °C was considered for drawing the melting curve and gaining confidence about existence of one peak for all samples and absence of dimer primer.

Once Cts were determined, the data were introduced into Rest and Excel software, after which ∆Ct and ∆∆Ct were calculated for the samples by the following formula.

$$\mathrm{\Delta }\mathrm{Ct}=\mathrm{Ct}\mathrm{sample}-\mathrm{Ct}\mathrm{housekeeping}\mathrm{gene}$$

$$\mathrm{\Delta }\mathrm{Ct}=\mathrm{Ct}\mathrm{TNF}-\mathrm{\alpha }-\mathrm{Ct}\mathrm{\beta }-\mathrm{actin}$$

$$\mathrm{\Delta }\mathrm{\Delta }\mathrm{Ct}=\mathrm{\Delta }\mathrm{Ct}\mathrm{sample}-\mathrm{\Delta }\mathrm{Ct}\mathrm{control}$$

Then, 2^-ΔΔct relation was applied to determine the extent of changes in the mRNA gene expression. The mean 2^-ΔΔct, standard deviation, and P value were calculated for the treatment groups in order to investigate the significance or insignificance of the effect of resveratrol on the samples. The primer sequence used is shown in Table 1.

Table 1.

List of Primers used for Real-Time PCR experiment for tumor necrosis factor (TNF-α), Interferon gamma (IFN-γ), Interleukin-1β (IL-1β), and Beta actin (bACT)

Gene Name	forward primer (5–3) Seq (5-3)	Gene bank accession number
TNF-α – F	GCTGGATCTTCAAAGTCGGGTGTA	AY427649
TNF-α _R	TGTGAGTCTCAGCACACTTCCATC	AY427649
IFN-γ _F	GAATGGCTTGGCCGATACAGGATA	AB126869
IFN-γ _R	TCCTCCACCTTTGACTTGTCCATC	AB126869
IL-1β _F	CATTTGCAGGCCGTCACA	CU695198
IL-1β _R	GGACATGCTGAAGCGCACTT	CU695198
bACT_F	ACAGGGAAAAGATGACACAGATCA	AF057040
bACT_R	CAGCCTGGATGGCAACGTA	AF057040

Statistical analysis

All results have been presented with standard error. Data analysis was performed through one-way analysis of variance (ANOVA), plus Duncan test for mean comparison [23]. This analysis was performed through SPSS 21, with the diagrams drawn using Excel software. All statistical analyses were performed at a significance level P < 0.05 and the mean data were presented with standard deviation.

Conflict of interest:

The authors declared that there was no conflict of interest. The ethical code of the work is (IR.IAU.BABOL.REC.1399.134).

Results

Effect of resveratrol on blood glucose

The results indicated that the maximum blood sugar level in the beginning of the experiment was observed in (G + RSV10) group, and it had a significant difference with others (p < 0.05). On the other hand, at the end of the sampling, the maximum level was observed in (G + CRTL) group (p < 0.05). At the end of the experimental period, considering the glucose level at the beginning of experiment, the minimum blood glucose level was related to (G-RSV20) group (Fig. 1).

Fig. 1.

The effect of resveratrol at 200 and 50 (mM) glucose levels for 20 days on zebrafish; for each group, at least 5 zebrafish were used. Different lowercase letters in each row indicate a significant difference between treatments. (P < 0/05)

Effect of resveratrol on intestinal tissue

The results of the zebrafish intestinal histology indicated that the maximum villus diameter and minimum villus width belonged to (G-RSV20) group (Fig. A). On the other hand, the minimum villus was related to (G-RSV30), while the maximum villus width was associated with G + RSV30 group, though no significant difference was observed with other groups. The maximum lamina propria diameter was observed in (G + CTRL) and (G + RSV10) groups, while the minimum value was related to (G-RSV20) group, though no significant difference was observed with other groups. Further, the maximum Submucosa diameter occurred in (G + CTRL) group, while (G + RSV30) group had the minimum submucosa diameter and the maximum muscle diameter, and had no significant difference with other groups. The minimum muscle diameter occurred in (G + RSV10) group (Fig. B). The maximum level of Passgoblet cells occurred in (G-RSV20) group, while the minimum was observed in (G + CTRL) group, and no significant difference was observed with other groups. The maximum level of Albgoblet cells occurred in the (G-RSV10) group, while the minimum bleogned to (G-CTRL) group, and no significant difference was observed with other groups (Fig. 2C).

Fig. 2.

The effect of resveratrol on the intestinal tissue of zebrafish including villus diameter and width, lamina propria, submucosa, muscle diameter, as well as PAS & Alb goblet cells. Different lowercase letters in each row indicate a significant difference between treatments. (P < 0/05)

Investigation of intestinal histological results for zebrafish, with the maximum villus height observed in G-RSV20, and the maximum villus width in the (G + RSV30) group (Fig. 3)

Fig. 3.

The intestinal tissue, middle part. A: (G-CTRL), B: (G + CTRL), C: (G-RSV10), D: (G + RSV10), E: (G-RSV20), F: (G + RSV20), H: (G-RSV30), I: (G + RSV30), H&E staining, X40 magnification

Figure 4 displays the intestinal histology results of zebrafish, with the maximum number of goblet cells observed in (G + RSV20), and the minimum in (G + CTRL) group. Also, according to Fig. 5, the largest and lowest number of goblet cells was observed in (G + RSV10) and in (G-CTRL) groups, respectively.

Fig. 4.

Intestinal tissue, the middle part. A: (G-CTRL), B: (G + CTRL), C: (G-RSV10), D: (G + RSV10), E: (G-RSV20), F: (G + RSV20), G: (G-RSV30), H: (G + RSV30) (PAS staining, X40 magnification)

Fig. 5.

Intestinal tissue, middle part. A: (G-CTRL), B: (G + CTRL), C: (G-RSV10), D: (G + RSV10), E: (G-RSV20), F: (G + RSV20), G: (G-RSV30), H: (G + RSV30) (Alb staining, X40 magnification)

Effect of resveratrol on gene factors

The statistical data obtained from the expression of IFN-γ gene indicated that the zebrafish fed RSV resulted in elevated mRNA gene expression in the (G + RSV20) group, which had no significant difference with other groups. It also caused reduced expression of IFN-γ gene in the (G-RSV30) group, which had a significant difference with other groups (p < 0.05). The maximum mRNA gene expression in IL1-β was related to the (G + CTRL) group, and had a significant difference with other groups (p < 0.05). On the other hand, the minimum expression was observed in the (G-RSV30) group, and had no significant difference with other groups. The results of TNF-α gene expression indicated that its maximum level was related to the (G-CTRL) group, which had a significant difference with other groups (p < 0.05). Further, the minimum TNF-α gene expression was observed in the (G + RSV10) group, which had no significant difference with other groups (Fig. 6).

Fig. 6.

The effect of resveratrol for 20 days on TNF-α, IL1-β, and INF-γ of zebrafish (compared to the control group). Different lowercase letters in each row indicate a significant difference between treatments. (P < 0/05)

Discussion

By inhibiting SIRT1 system, resveratrol can inhibit cell oxidative stress, prevent development of inflammation in the body of diabetics, and improve insulin sensitivity [8]. Studies show that carbohydrate uptake is greater in the feed of omnivorous warm water fresh compared to that of carnivorous cold-water fish [24]. Since zebrafish is omnivorous and is native to warm waters, most probably carbohydrate is considered as an important component of their diet, and has a positive correlation with their development [25]. Based on recent studies, it is not surprising that zebrafish indicates glucose transport 18 as well as many genes including hexokinases, which are implicated in glucose metabolism [25, 26]. The results of this research indicated that (G-RSV20) at the end of the experiment managed to lower the blood sugar of zebrafish. Further, the control treatment containing glucose had the maximum level of blood glucose. The results of research on laboratory animals with diabetic status indicated that consumption of RSV can cause significant prevention, reduction, or modification of disorders associated with type II diabetes in the organs of different animal models such as mice and pigs through affecting various metabolic pathways [27].

One of the mechanisms of blood glucose control is probably through the effect of resveratrol on ATP-dependent potassium channels in the mitochondria of pancreatic beta cells and the reduction of their hyperpolarization through the reduction of ATP; since increasing the ATP / ADP ratio is essential for insulin secretion, it reduces insulin secretion following a rise in insulin sensitivity in tissues (Bagul et al., 2015). The SIRT1 protein, through which resveratrol often exerts its effects in mammals, is a member of the NAD + −dependent protein family and is involved in glucose metabolism, homeostasis, and insulin sensitivity, whose activity can be enhanced depending on the increase in NAD + / NADH. Activation of this protein may be another mechanism of resveratrol (Marouf et al., 2010; Bhullar et al., 2015). Resveratrol can boost glucose uptake and decrease lipid levels by activating AMP-dependent protein kinase (AMPK) and increasing its phosphorylation (Movahed, 2016).

Zebrafish type II diabetes mellitus as an animal model responds positively to antidiabetic drugs such as metformin and glimepiride [28]. Metformin boosts the insulin function through increasing the displacement of glucose transporters, enhancing the AMP-kinase activity, or reducing DPP4 activity [29]. The results of Zang et al. indicated that T2DM zebra fish may also respond to other antidiabetic drugs, allowing for screening this fish to find new drugs [4]. New studies suggest that the biological activity of the effect of glycosylation compound can be assessed in the zebrafish larvae [30]. This is especially important for research on natural products, since plants generally store chemicals as glycosides which are then activated by hydrolysis enzyme [31]. Thus, zebrafish can be considered as an independent system, in which screening of antidiabetic drugs, validation of its effects on T2DM complications, and pharmacokinetics can be investigated [32]. One important limitation in the chronic hyperglycemia method is that for example in some experiments, the blood glucose of some fish did not increase after immersion in D glucose water 111 mM for 14 days [33]. Doresemans et al. estimated the percentage of responders and nonresponders to blood glucose level as 83 versus 17% respectively [34]. It is possible that the fish would show individual sensitivity considering age, gender, and the capacity of compensating blood sugar by creating more pancreas beta cells. Gai et al. indicated that overfeeding blood sugar would significantly elevate the blood glucose level, yet treatment with RSV for 8 weeks would cause hyperglycemia with overfeeding [17]. Blood glucose elevation in the overfed zebra after consuming RSV remained unaffected, which is probably due to differences in food compounds such as the lipid and blood glucose between rodents and zebrafish, or alternatively because of differences between these two species and a specific mechanism for the function of RSV [17].

Galanin is a 29-30 amino acid neuropeptide widely expressed in nervous and peripheral systems [35]. The first biological activity of galanin was its impact on the plasma glucose level in dogs and mice [36]. Use of galnon by Podlasz et al. indicated that non-peptide galanin receptor agonist had no significant effect on the blood glucose level in zebrafish [37]. The lack of apparent increase in the blood glucose level after administering galnon was found by Quynh et al. in which galnon even caused release of insulin in the isolated pancreas islands of the mice [38]. Galnon has a shared tendency to galanin receptors [39]. Consumption of galanin analog Nax5055 results in elevated blood glucose in zebrafish [37].

Changes in the intestinal morphology may affect the rate of metabolism and function of nutrients [40]. According to the results obtained in this research, the increase in the height of villi may lead to growth of the entire luminal villus absorbent region, proper functioning of the digestion enzyme, greater transportation of nutrients across the villus, and improved nutrient absorption function [41]. The results of this research showed that RSV could lead to increased villus in the (G-RSV20) as well as its enhanced width in the (G + RSV30) treatment. Consumption of methionine results in elevated villus height, greater villus width, and eventually larger villus area across all parts of the intestine [42]. The obtained results revealed that across all intestinal parts, the number of goblet cells sustained via PAS and AB methods increased in the mice treated with methionine compared to the control group, which may suggest increased mucin secretion [43]. As with the results obtained in this research where RSV with 10 and 20 μmol/L doses caused elevated number of goblet cells in AB and PAS staining methods, the results of research performed on Yellow tailed tetra showed that use of rations containing oregano extract results in development of intestinal villi [44]. This increase of intestinal villi would improve the digestion and absorption, thereby contributing to more efficient consumption of nutrients [45]. Plant extracts also lead to improved immunity of the body. This in turn causes increased availability of nutrients for absorption in the intestine, and eventually better growth [45]. In the present study, the number of goblet cells was higher in the RSV-fed treatment compared to the control. Secretions of goblet cells establish a kind of protection for epithelial cells. These cells also decrease the digestive tube friction and facilitate the movement of food throughout the digestive system [46]. Various studies have shown that the number and function of goblet cells change under different conditions. For example, the extent of production of mucous materials increases at the time of higher microbial load [47]. Also, some researchers have reported that presence of digestive parasites causes increased number of goblet cells [48].The result of Sanchez-Fidalgo et al. In 2010 showed that in DSS-induced chronic colitis, both expression of proinflammatory cytokines (TNF-a, NO, and IL-1b) and increased anti-inflammatory mediators (IL-10) in the colonic mucosa would reduce inflammation following resveratrol treatment (Sanchez-Fidalgo et al., 2010). In addition, the reduction in ileus inflammation in mice treated with resveratrol and curcumin may be due to the proliferation of intestinal epithelial cells in the ileal mucosa (Bereswill et al., 2010).

Use of Coriandrum Sativum in the food ration results in reduced number of goblet cells in the intestine. The obtained results indicated that in the treatments containing a large extract concentration, the number of goblet cells was higher compared to the treatment containing a lower extract concentration [49].

The results indicated that RSV caused reduction of INF-γ and IL-1β genes (G-RSV30), while (G + RSV10) indicated the minimum level of TNF-α. Studies have shown that activation of neutrophils and macrophages due to oxidative stress as well as propagation of inflammatory cytokines including IL-6, IL-1β, and TNF-α result in reduced insulin secretion, hepatic steatosis, and a series of metabolic disorders in diabetes [50]. The imbalance in the production and secretion of inflammatory plus inhibitory cytokines is an important driving force for inflammation in diabetes [51]. TNF-α, as an important inflammatory cytokine, plays an important role in development of insulin resistance. This cytokine causes insulin resistance through impairing the expression of one of the glucose transporters (GLUT4) and inhibiting phosphorylation of insulin receptor [52]. RSV can be effective in controlling nonalcoholic fatty liver disease (NAFLD) by reducing the level of inflammatory factors such as TNF-α and hs-CRP, as well as increasing antioxidant enzymes such as superoxide dismutase, glutathione peroxidase, and catalase [53].

TNF-α causes impairment in insulin messaging pathway through reducing the kinase activity of insulin receptor or increasing serine phosphorylation in insulin receptor substrate (IRS-1). In obese mice, use of TNF-α inhibitors, such as pentoxifylline, led to normalization of its expression in the adipose tissue as well as improved insulin resistance [54]. High glucose concentration results in protein glycosylation and production of advanced glyoxalin end products (AGEs). Thus, accumulation of AGEs activates NF-KB for inducing the expression of TNF-α, which results in chronic inflammation [55]. Flaxseed oil supplement for 8 weeks resulted in a significant decrease in the glucose tolerance level, IL-1β, and TNF-α in obese and diabetic individuals [56].

Elsewhere, Zhu et al. observed significant increase in a series of inflammatory cytokines including IL-1β, TNF-α, IL-6, and IL-17A in diabetic rats induced by streptozocin-nicotinamide (STZ-NA) [57]. Similar to IL-6, it has been found that TNF-α is also involved in insulin resistance. The study by Szkudelska showed that elevation of TNF-α content was completely prevented through RSV treatment. In Goto-Kakizaki (GK) mice under treatment, TNF-α reached the values observed in nondiabetic animals. RSV has definite anti-inflammatory effects in the skeletal muscles of GK mice [58]. Presence of inflammation in the liver of mice was confirmed with elevated TNF-α and to a lesser extent with IL-1β. It was also observed that both indicators diminished to some extent in response to treatment with RSV. RSV mitigates the inflammatory status by reducing the expression of inflammatory genes and proteins in different T2DM models [59]. Glucose causes stimulation of pancreas beta cells and production of IL-1β. Meanwhile, IL-1β, while affecting the beta cells, causes greater production and secretion of these cytokines, eventually causing loss of beta cell function with progression of inflammatory conditions [60]. The IL-1β serum level did not show any significant difference in patients with T2DM who had received no treatment compared to the control [61]. Consumption of sitagliptin (100 mg/day) in two therapeutic courses (4 weeks and 12 months) had no effect on IL-1β level in T2DM patients [62]. With regard to the anti-inflammatory effects of sitagliptin, Satoh et al. examined T2DM patients undergoing treatment with Sitagliptin (50 mg/day) for 3 months. They observed reduced TNF-α level as well as diminished expression of TNF-α in the monocytes of patients undergoing treatment with Sitagliptin in comparison to the nontreated group [63].

Conclusions

Overall, the results indicated that resveratrol plays a significant role in controlling hyperglycemic among diabetic patients and in improving the food absorption in the intestinal tissue. Resveratrol caused elevated IFN-γ as well as reduced IL-1β and TNF-α.

Declarations

Conflict of interest

On behalf of all authors, the corresponding author states that there is no conflict of interest.