Skip to main content
NCBI home page
Acta Bio Medica : Atenei Parmensis logoLink to Acta Bio Medica : Atenei Parmensis
. 2022 May 11;93(2):e2022027. doi: 10.23750/abm.v93i2.10823

High frequency of antimicrobial resistance and virulence gene in Shigella species isolated from pediatric patients in an Iranian Referral Hospital

Babak Pourakbari 1, Mohammad Ghaffari Charati 2, Shima Mahmoudi 1, Mohammad Reza Abdolsalehi 2, Reihaneh Hosseinpour Sadeghi 1, Setareh Mamishi 1,2,✉
PMCID: PMC9171862  PMID: 35546037

Abstract

Background:

Shigella is a main cause of gastroenteritis and it is responsible for 5 to 10 % of diarrhea through the world. The aims of this study were to assess the antibiotic susceptibility pattern and the presence of 3 common virulence genes (sigA, virF, invE) of Shigella strains isolated from patients with gastroenteritis in Children’s Medical Center Hospital, Tehran, Iran.

Methods:

Over a period of 15 months, all Shigella species collected from the patients with gastroenteritis were entered to the study. Susceptibility testing of all isolates towards different antibiotics was performed using the disk diffusion method and the prevalence of virulence genes was detected by polymerase chain reaction (PCR) technology.

Results:

Among a total of 183 Shigella strains, 128 Shigella sonnei (70%) and 55 S. flexneri (30%) were isolated. The resistance rate to the antibiotics in S. sonnei strains was higher than S. flexneri. The most sensitive antibiotics for S. flexneri strains were gentamicin (98%), amikacin (85%) and ciprofloxacin (82%), while high resistance rate to trimethoprim-sulfamethoxazole (96%), ampicillin (96%), nalidixic acid (64%) and cefotaxime (60%) was observed. The frequency of invE, virF and sigA gene in S. flexneri strains was 89 %, 93 % and 56 %, respectively; whereas they found in 93 %, 96 %, and 100 % of S. sonnei strains, respectively. SigA gene was identified significantly higher in the S. sonnei strains (100%). There was no significant difference between the presence of virF and invE genes among Shigella strains.

Conclusion:

The high presence of sigA gene in S. sonnei strains plays an important role in its pathogenesis, and the high frequency of invE and virF genes showed that this classical pathway regulating the expression of Shigella virulence factor genes could play a key role in the pathogenesis of this bacterium. (www.actabiomedica.it)

Keywords: Shigella, children, antibiotics resistance, virulence factors

Introduction

Shigellosis continues to be a main public health problem worldwide, mainly in developing countries where it is endemic (1, 2) and it is considered as a prominent global cause of moderate to severe diarrhea in children (3) and adults (4). Children under five years of age face the biggest impact of the disease and 61% of deaths occur in children (5). Unfortunately, poor hygienic circumstances and low quality of water in developing countries enhance the incidence and prevalence of the disease (6). The genus Shigella includes four subgroups historically treated as species: Shigella flexneri, Shigella boydii, Shigella sonnei, and Shigella dysenteriae (7), among which, S. flexneri is the most prevailing species in developing nations followed by S. sonnei, whereas S. boydii and S. dysenteriae are less frequently isolated (8).

Although shigellosis is a self-limiting disease, antibiotics might decrease the duration of illness and consequently reduce the person to person transmission (9). Unfortunately, irregular usage of antimicrobial agents in addition to horizontal gene transfer, have given rise to the increasing resistance of Shigella spp. and the growth of multi-drug resistance against common antibiotics worldwide (10, 11). Shigella capacity to cause disease is based on genes contained in an invasion plasmid pINV of 220 Kb, such as ipaH, ipaBCD, ial, sen, virA, virB (invE), virF, icsA, sepA, and ipgD and on chromosomal genes, ipaH, iuc, sat, sigA, pic, set1A, and set1B (12, 13).

The aim of this study was to investigate the antibiotic susceptibility pattern and the distributation of three common virulence genes (sigA, virF, invE) of Shigella species isolated from patients with gastroenteritis in Tehran, Iran.

Material and methods

The study was approved by the Ethical Committee from the Tehran University of Medical Sciences, Iran (IR.TUMS.CHMC.REC.1397.008). In our cross-sectional study over a period of 15 months, from September 2018 to February 2020, all Shigella species collected from the patients with gastroenteritis were entered to the study. The isolates were identified by standard biochemical tests (14). Susceptibility testing of all Shigella isolates towards different antibiotics was performed using the disk diffusion method based on Clinical Laboratory Standard Institute (CLSI) guidelines, 2019 (15). The antimicrobials tested were: nalidixic acid, amikacin, ampicillin, gentamicin, cefotaxime, ciprofloxacin, and trimethoprim sulfamethoxazole.

In order to detect virulence genes, DNA template was obtained as method previously described by Hosseini Nave et al. (16). PCR was performed to target the virulence genes (sigA, virF, invE) by using previously reported primers (Table 1).

Table 1.

Primers used in this study

Gene Primer sequence (5' –3' ) Size of product (bp) Annealing temperature (º C) Reference
sigA-forward CCGACTTCTCACTTTCTCCCG 430 59 (21)
sigA-reverse CCATCCAGCTGCATAGTGTTTG
virF-forward TCAGGCAATGAAACTTTGAC 618 56 (21)
virF-reverse TGGGCTTGATATTCCGATAAGTC
invE-forward CGATAGATGGCGAGAAATTATATCCCG 766 60 (37)
invE-reverse CGATCAAGAATCCCTAACAGAAGAATCAC
Open in a new tab

Amplification was performed in a mixture consisting of 2.5 µl of the PCR buffer (10-times concentrated), 0. 5 µl of Mgcl2 (final concentration 200 µM), 0.5 µl of dNTPs (Fermentas, Vilnius, Lithuania, final concentration 2.5 mM), 0.5 µl of each primer, final concentration of 0.2 mM, 1.5 U of the Taq DNA polymerase (Bioron,Germany), 1 µl of DNA (final concentration 2 ng/µL) and DNase-, RNase-free deionised water (Biomedicals) to a final volume of 25 µl. Cycling conditions were carried out as follows: initial denaturation at 95º C for 7 min, followed by 30 cycles including denaturation for 5 min at 95º C, annealing for 45 s and a single final extension at 72º C for 15 min. The analysis of the amplified products was performed in 1% agarose (Sigma) and DNA bands were visualized by staining with gel red (Biotium), analysed under UV light and photographed using the GEL Doc 2000 documentation system (Bio-Rad).

Statistical Analysis

Data were analyzed using the SPSS version 16.0 software (SPSS Inc., Chicago, IL, United States) and the results were described by frequency (percentage) and mean ± standard deviation (SD). Univariate analysis was performed using the chi-squared test or Fisher’s exact test, as appropriate. P-values were based on two-tailed test results, and P < 0.05 were considered statistically significant.

Results

In this study, 183 Shigella strains (2.6%) were isolated from a total of 7121 children with gastroenteritis referred to the Children’s Medical Center Hospital, Tehran, Iran during the period of 15 months.

The most isolated species were S. sonnei with 128 cases (70%) and S. flexneri with 55 cases (30%). Among 183 patients whose stool culture was positive for Shigella bacteria, 93 patients were boys (51%) with a mean age of 5.7 years old (SD= 3.4 years, the age range of 1 to 16 years old). There was no significant difference between the distribution of Shigella bacteria in the children with gastroenteritis by age (p value=0.5) and sex (p value=0.87). The highest rate of Shigella isolates was isolated in autumn and from outpatients (n=108, 59%) and among the different wards of the hospital, emergency department had the highest rate of Shigella (35%).

The results of antibiotic susceptibility test showed high resistance rate of Shigella strains to ampicillin (p value ≥ 0.05) and trimethoprim sulfamethoxazole (p value=0.09). Generally, the resistance rate to cefotaxime, nalidixic acid, ciprofloxacin and ampicillin in S. sonnei strains was significantly higher than S. flexneri (Table 2).

Table 2.

Antibiotic susceptibility pattern and frequency of the virulence genes in Shigella isolates

Bacteria Antibiotics Genes
Amikacin Gentamycin Ampicillin Cefotaxime Trimethoprim Sulfamethoxazole Nalidixic acid Ciprofloxacin invE sigA virF
S. sonnei 127 (100%) 122 (96.1%) 6 (4.7%) 6 (4.7%) 0 3 (2.3%) 72 (56.7%) 119 (93%) 128 (100%) 123 (96.1%)
S. flexneri 46 (85.2%) 53 (98.1%) 2 (3.7%) 22 (40%) 2 (3.6%) 20 (36.4%) 40 (81.6%) 49 (89.1%) 31 (56.4%) 51 (92.7%)
Open in a new tab

The prevalence of invE, virF and sigA genes in S. flexneri strains was 89%, 93% and 56%, and in S. sonnei strains was 93%, 96% and 100%, respectively (Table 2). The sigA gene was significantly more detected in S. sonnei strains (p value ≤ 0.0001). However, no significant difference was observed between virF and invE gene detection in Shigella strains.

Discussion

Gastroenteritis is considered as one of the most vital diseases all around the world and it is more severe and dangerous among children, the elderly, and people who are malnourished or live in poor conditions. Shigella is a main cause of gastroenteritis throughout the world and it is responsible for 5 to 10 % of diarrhea through the world (17). It can be considered as a major pathogen in developing countries with lower levels of hygiene (17, 18).

In our study, 70% of the strains were S. sonnei and 30% of them were confirmed as S. flexneri. S. flexneri is responsible for most of the shigellosis burden in developing countries worldwide, while S. sonnei occurs predominantly in developed countries and in countries shifting from low- to middle-income (19, 20). The reason for this discrepancy is not clear; however, efforts to increase local health have drastically reduced the prevalence of the disease and even changed the distribution pattern of Shigella species (21, 22). This pattern change has also been observed in countries such as Brazil (23), South America (24) and China (25), which is similar to the results of studies conducted in our country in the cities of Tehran (22, 26-28), Babol (29) and Abadan (30).

In developing countries where the prevalence of shigellosis is usually reported endemically, evaluating the pattern of antibiotic resistance can be very effective in prescribing appropriate drugs. The resistance rate to the antibiotics studied in our study in S. sonnei strains was higher than S. flexneri, which was in consistent with previous studies (22, 31). Shigella strains showed high sensitivity to aminoglycosides in the present study. The most sensitive antibiotics for S. flexneri strains were gentamicin (98%), amikacin (85%) and ciprofloxacin (82%). While high resistance pattern to trimethoprim-sulfamethoxazole (96%), ampicillin (96%), nalidixic acid (64%) and cefotaxime (60%) was observed. Several studies around the world have reported increased resistance of Shigella species to common antibiotics such as trimethoprim, sulfamethoxazole, and ampicillin (23, 32, 33).

Virulence of Shigella depends on the presence of a large virulence inv plasmid, carrying an operon that encodes the type III-secretion-system (T3SS) responsible for bacterial entry (34, 35). In our study, sigA gene was significantly identified more frequent in S. sonnei strains (p value ≤ 0.0001). The high frequency of sigA gene in S. sonnei strains plays a key role in its pathogenesis, which is consistent with previous studies (7, 16, 36). However, no significant difference was observed between virF and invE genes identification in S. flexneri and sonnei strains. When Shigella growth conditions are suitable for invasion, a transcription cascade begins by activating the virF gene to express the AraC-like protein virF, which in turn activates the transcription of the invE regulatory gene (36). The high abundance of these genes indicated that this classical regulatory pathway of Shigella virulence gene expression might play a major role in its pathogenesis.

In conclusion, due to the overuse of antibiotics and the consequent increase in drug resistance, some antibiotics should be removed from the list of drugs for the treatment of Shigella, which include ampicillin and trimethoprim sulfamethoxazole. The lowest pattern of resistance in the present study was observed to gentamicin, amikacin and ciprofloxacin. The high presence of sigA, invE and virF genes showed that this classical regulatory pathway of Shigella virulence factor gene expression can play a major role in the pathogenesis of this bacterium.

Acknowledgments:

This study was taken from Dr. Mohammad Ghaffari’s postgraduate thesis.

Funding:

This project was supported by a grant (grant number: 97-01-88-32526) from Tehran University of Medical Sciences to Dr. Setareh Mamishi.

Conflicts of interest:

Each author declares that he or she has no commercial associations (e.g. consultancies, stock ownership, equity interest, patent/licensing arrangement etc.) that might pose a conflict of interest in connection with the submitted article.

Ethical Approval statement:

The study was approved by the Ethical Committee from the Tehran University of Medical Sciences, Iran (IR.TUMS.CHMC.REC.1397.008).

Authors’ Contribution:

SM1 and RHS involved in writing of the manuscript. BP, MGH, and MRA participated in data collection. SM1 and SM2 involved in funding and interpretation of data and supervised the project. BP supervised the project and involved in interpretation of data. All authors discussed the results and contributed to the final manuscript.

References

  1. Medeiros PHQS, Lima AÂM, Guedes MM, et al. Molecular characterization of virulence and antimicrobial resistance profile of Shigella species isolated from children with moderate to severe diarrhea in northeastern Brazil. Diagn Microbiol Infect Dis. 2018;90(3):198–205. doi: 10.1016/j.diagmicrobio.2017.11.002. [DOI] [PubMed] [Google Scholar]
  2. The HC, Thanh DP, Holt KE, Thomson NR, Baker S. The genomic signatures of Shigella evolution, adaptation and geographical spread. Nat Rev Microbiol. 2016;14(4):235–50. doi: 10.1038/nrmicro.2016.10. [DOI] [PubMed] [Google Scholar]
  3. Bardhan P, Faruque AS, Naheed A, Sack DA. Decrease in shigellosis-related deaths without Shigella spp.-specific interventions, Asia. Emerg Infect Dis. 2010;16(11):1718–23. doi: 10.3201/eid1611.090934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Lozano R, Naghavi M, Foreman K, et al. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet. 2012;380(9859):2095–128. doi: 10.1016/S0140-6736(12)61728-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Jain PA, Kulkarni RD, Dutta S, et al. Prevalence and antimicrobial profile of Shigella isolates in a tertiary care hospital of North Karnataka: A 12-year study. Indian J Med Microbiol. 2020;38(1):101–108. doi: 10.4103/ijmm.IJMM_20_107. [DOI] [PubMed] [Google Scholar]
  6. Eshaghi Zadeh SH, Fahimi H, Fardsanei F. Soltan Dallal MM. Antimicrobial Resistance and Presence of Class 1 Integrons Among Different Serotypes of Salmonella spp. Recovered From Children with Diarrhea in Tehran, Iran. Infect Disord Drug Targets. 2020;20(2):160–166. doi: 10.2174/1871526519666190130171020. [DOI] [PubMed] [Google Scholar]
  7. da Cruz CB, de Souza MC, Serra PT, Santos I, Balieiro A, Pieri FA, Nogueira PA, Orlandi PP. Virulence factors associated with pediatric shigellosis in Brazilian Amazon. Biomed Res Int. 2014;2014:539697. doi: 10.1155/2014/539697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Nüesch-Inderbinen M, Heini N, Zurfluh K, Althaus D, Hächler H, Stephan R. Shigella antimicrobial drug resistance mechanisms, 2004–2014. Emerg Infect Dis. 2016;22(6):1083. doi: 10.3201/eid2206.152088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Sethuvel DPM, Anandan S, Michael JS, et al. Virulence gene profiles of Shigella species isolated from stool specimens in India: its association with clinical manifestation and antimicrobial resistance. Pathog Glob Health. 2019;113(4):173–9. doi: 10.1080/20477724.2019.1632062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Davies J, Davies D. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev. 2010;74(3):417–33. doi: 10.1128/MMBR.00016-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Salimiyan Rizi K, Farsiani H, Sasan MS. High rate of resistance to ceftriaxone and azithromycin among Shigella spp. isolates at three children’s referral hospitals in Northeast Iran. J Infect Chemother. 2020;26(9):955–958. doi: 10.1016/j.jiac.2020.04.022. [DOI] [PubMed] [Google Scholar]
  12. Bastos FC, Loureiro EC. Antimicrobial resistance of Shigella spp. isolated in the State of Pará, Brazil. Rev Soc Bras Med Trop. 2011;44(5):607–10. doi: 10.1590/s0037-86822011005000051. [DOI] [PubMed] [Google Scholar]
  13. Gonzales JC, Seribelli AA, Gomes CN, et al. A high number of multidrug-resistant and predominant genetically related cluster of Shigella flexneri strains isolated over 34 years in Brazil. Braz J Microbiol. 2020;51(4):1563–1571. doi: 10.1007/s42770-020-00332-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Mahon CR, Lehman DC, Manuselis G. Elsevier Health Sciences; 2018. Textbook of diagnostic microbiology-E-Book. [Google Scholar]
  15. Melvin P. Performance Standards for Antimicrobial Susceptibility Testing 2019.pdf [Google Scholar]
  16. Hosseini Nave H, Mansouri S, Emaneini M, Moradi M. Distribution of genes encoding virulence factors and molecular analysis of Shigella spp. isolated from patients with diarrhea in Kerman, Iran. Microb Pathog. 2016;92:68–71. doi: 10.1016/j.micpath.2015.11.015. [DOI] [PubMed] [Google Scholar]
  17. Ahmed AM, Furuta K, Shimomura K, Kasama Y, Shimamoto T. Genetic characterization of multidrug resistance in Shigella spp. from Japan. J Med Microbiol. 2006;55(Pt 12):1685–1691. doi: 10.1099/jmm.0.46725-0. [DOI] [PubMed] [Google Scholar]
  18. Shakoor S, Zaidi AK, Hasan R. Tropical bacterial gastrointestinal infections. Infect Dis Clin. 2012;26(2):437–53. doi: 10.1016/j.idc.2012.02.002. [DOI] [PubMed] [Google Scholar]
  19. Malau E, Ford R, Valcanis M, et al. Antimicrobial sensitivity trends and virulence genes in Shigella spp. from the Oceania region. Infect Genet Evol. 2018;64:52–56. doi: 10.1016/j.meegid.2018.06.015. [DOI] [PubMed] [Google Scholar]
  20. Taneja N, Mewara A. Shigellosis: epidemiology in India. The Indian journal of medical research. 2016;143(5):565. doi: 10.4103/0971-5916.187104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Fan W, Qian H, Shang W, et al. Low distribution of genes encoding virulence factors in Shigella flexneri serotypes 1b clinical isolates from eastern Chinese populations. Gut Pathogens. 2017;9(1):76. doi: 10.1186/s13099-017-0222-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mahmoudi S, Pourakbari B, Moradzadeh M, et al. Prevalence and antimicrobial susceptibility of Salmonella and Shigella spp. among children with gastroenteritis in an Iranian referral hospital. Microb Pathog. 2017;109:45–8. doi: 10.1016/j.micpath.2017.05.023. [DOI] [PubMed] [Google Scholar]
  23. Sousa MÂB, Mendes EN, Collares GB, Péret-Filho LA, Penna FJ, Magalhães PP. Shigella in Brazilian children with acute diarrhoea: prevalence, antimicrobial resistance and virulence genes. Memórias do Instituto Oswaldo Cruz. 2013;108(1):30–5. doi: 10.1590/S0074-02762013000100005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Orrett FA. Prevalence of Shigella serogroups and their antimicrobial resistance patterns in southern Trinidad. Journal of health, population and nutrition. 2008;26(4):456. doi: 10.3329/jhpn.v26i4.1889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Qu F, Bao C, Chen S, et al. Genotypes and antimicrobial profiles of Shigella sonnei isolates from diarrheal patients circulating in Beijing between 2002 and 2007. Diagn Microbiol Infect Dis. 2012;74(2):166–70. doi: 10.1016/j.diagmicrobio.2012.06.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. MoezArdalan K, Zali MR, Dallal MMS, Hemami MR, Salmanzadeh-Ahrabi S. Prevalence and pattern of antimicrobial resistance of Shigella species among patients with acute diarrhoea in Karaj, Tehran, Iran. J Health Popul Nutr. 2003:96–102. [PubMed] [Google Scholar]
  27. Pourakbari B, Mamishi S, Mashoori N, et al. Frequency and antimicrobial susceptibility of Shigella species isolated in Children Medical Center Hospital, Tehran, Iran, 2001-2006. Braz J Infect Dis. 2010 doi: 10.1590/s1413-86702010000200007. [DOI] [PubMed] [Google Scholar]
  28. Mamishi S, Mashoori N, Mahboobi N, Pour Akbari B. Increasing resistance to nalidixic acid in Shigella subgroups in a comparative study between 2001-2003 and 2004-2006. Singapore Med J. 2009;50(8):791–3. PMID: 19710978. [PubMed] [Google Scholar]
  29. Barari SKR, Ahmadpour KM. Prevalence of Shigella species and their antimicrobial resistance patterns at Amirkola Children’s Hospital, North of Iran. 2007 [Google Scholar]
  30. Jomezadeh N, Babamoradi S, Kalantar E, Javaherizadeh H. Isolation and antibiotic susceptibility of Shigella species from stool samples among hospitalized children in Abadan, Iran. Gastroenterol Hepatol Bed Bench. 2014;7(4):218–23. [PMC free article] [PubMed] [Google Scholar]
  31. Mamishi S, Arab ZY, Mahmoudi S, Moradzadeh M, Taghi MHA, Pourakbari B. Antimicrobial-resistance pattern of Shigella species in children: a six-year study in an Iranian referral Hospital. Ann Ig Med Preventiva Comunita. 2019;31(4):356–64. doi: 10.7416/ai.2019.2297. [DOI] [PubMed] [Google Scholar]
  32. Aggarwal P, Uppal B, Ghosh R, Krishna Prakash S, Chakravarti A, Rajeshwari K. True Prevalence of Shigellosis in Indian Children with Acute Gastroenteritis: Have We Been Missing the Diagnosis? J Res Health Sci. 2016;16(1):11–6. [PMC free article] [PubMed] [Google Scholar]
  33. Asrat D. Shigella and Salmonella serogroups and their antibiotic susceptibility patterns in Ethiopia. East Mediterr Health J. 2008;14(4):760–7. [PubMed] [Google Scholar]
  34. Coster TS, Hoge CW, VanDeVerg LL, et al. Vaccination against shigellosis with attenuated Shigella flexneri 2a strain SC602. Infection and immunity. 1999;67(7):3437–43. doi: 10.1128/iai.67.7.3437-3443.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sansonetti PJ. Rupture, invasion and inflammatory destruction of the intestinal barrier by Shigella, making sense of prokaryote-eukaryote cross-talks. FEMS Microbiol Rev. 2001;25(1):3–14. doi: 10.1111/j.1574-6976.2001.tb00569.x. [DOI] [PubMed] [Google Scholar]
  36. Gu B, Fan W, Qin T, et al. Existence of virulence genes in clinical Shigella sonnei isolates from Jiangsu Province of China: a multicenter study. Ann Transl Med. 2019;7(14):305. doi: 10.21037/atm.2019.06.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Bonkoungou I, Lienemann T, Martikainen O, et al. Diarrhoeagenic Escherichia coli detected by 16-plex PCR in children with and without diarrhoea in Burkina Faso. Clin Microbiol Infect. 2012;18(9):901–6. doi: 10.1111/j.1469-0691.2011.03675.x. [DOI] [PubMed] [Google Scholar]

Articles from Acta Bio Medica : Atenei Parmensis are provided here courtesy of Mattioli 1885

RESOURCES