Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2000 Jan;66(1):98–104. doi: 10.1128/aem.66.1.98-104.2000

Expression of Alcaligenes eutrophus Flavohemoprotein and Engineered Vitreoscilla Hemoglobin-Reductase Fusion Protein for Improved Hypoxic Growth of Escherichia coli

Alexander D Frey 1, James E Bailey 1, Pauli T Kallio 1,*
PMCID: PMC91791  PMID: 10618209

Abstract

Expression of the vhb gene encoding hemoglobin from Vitreoscilla sp. (VHb) in several organisms has been shown to improve microaerobic cell growth and enhance oxygen-dependent product formation. The amino-terminal hemoglobin domain of the flavohemoprotein (FHP) of the gram-negative hydrogen-oxidizing bacterium Alcaligenes eutrophus has 51% sequence homology with VHb. However, like other flavohemoglobins and unlike VHb, FHP possesses a second (carboxy-terminal) domain with NAD(P)H and flavin adenine dinucleotide (FAD) reductase activities. To examine whether the carboxy-terminal redox-active site of flavohemoproteins can be used to improve the positive effects of VHb in microaerobic Escherichia coli cells, we fused sequences encoding NAD(P)H, FAD, or NAD(P)H-FAD reductase activities of A. eutrophus in frame after the vhb gene. Similarly, the gene for FHP was modified, and expression cassettes encoding amino-terminal hemoglobin (FHPg), FHPg-FAD, FHPg-NAD, or FHP activities were constructed. Biochemically active heme proteins were produced from all of these constructions in Escherichia coli, as indicated by their ability to scavenge carbon monoxide. The presence of FHP or of VHb-FAD-NAD reductase increased the final cell density of transformed wild-type E. coli cells approximately 50 and 75%, respectively, for hypoxic fed-batch culture relative to the control synthesizing VHb. Approximately the same final optical densities were achieved with the E. coli strains expressing FHPg and VHb. The presence of VHb-FAD or FHPg-FAD increased the final cell density slightly relative to the VHb-expressing control under the same cultivation conditions. The expression of VHb-NAD or FHPg-NAD fusion proteins reduced the final cell densities approximately 20% relative to the VHb-expressing control. The VHb-FAD-NAD reductase-expressing strain was also able to synthesize 2.3-fold more recombinant β-lactamase relative to the VHb-expressing control.


One of the foremost examples of inverse metabolic engineering (the genetic transfer of useful phenotypes to heterologous organisms) is expression of Vitreoscilla hemoglobin (VHb) in aerobic bacteria, yeast, fungi, and plants to enhance their growth and productivity (2, 6, 14, 25). Although the exact mechanism by which VHb causes these effects is unknown, it has been hypothesized that due to its unusual kinetic parameters for oxygen binding and release (KD = 72 μM) (45), VHb is able to scavenge oxygen molecules from solution and provide them for cellular activities in heterologous organisms (18, 45, 49). More detailed observations of biochemical and physiological changes accompanying VHb expression in Escherichia coli indicate increased overall ATP production and turnover rates, increase in cytochrome o expression and specific activity, decreased levels of reduced pyridine nucleotides, and changes in central carbon metabolism (7, 18, 27, 38–40). Experiments were conducted with engineered E. coli to determine if globins besides VHb can be applied to enhance hypoxic growth and protein production levels. E. coli cells expressing either of two different hemoglobin-like proteins, horse heart myoglobin and yeast flavohemoglobin, each having some sequence homology with VHb, grew to lower final cell densities than did VHb-expressing E. coli in oxygen-limited fed-batch cultivations (19).

Recently, a family of two-domain globins containing N-terminal oxygen binding and C-terminal reductase activities, termed FNR (ferredoxin NADP+ reductase)-like proteins has been identified. The FNR-like proteins are not identical with the well-characterized global transcriptional regulator FNR (fumarate nitrate reduction), which controls the expression of genes required for anaerobic metabolism in E. coli (42). FNR-like proteins have been identified in both prokaryotic and eukaryotic organisms such as E. coli (43), Erwinia chrysanthemi (12), Bacillus subtilis (23), Candida norvegensis (15), Fusarium oxysporum (37), and Saccharomyces cerevisiae (51). One such protein, a megaplasmid-encoded cytoplasmic hemoglobin-like protein (FHP [flavohemoglobin protein]), was also identified in a facultatively lithoautotrophic, hydrogen-oxidizing, gram-negative bacterium, Alcaligenes eutrophus (4, 30, 48). A. eutrophus grows, like Vitreoscilla, in oxygen-scarce environments and has respiratory-type metabolism, but A. eutrophus can also grow without oxygen if either nitrate or nitrite is present as the terminal electron acceptor (4, 30). Limited oxygen supply causes an approximately 20-fold increase in FHP content, suggesting that expression of FHP in A. eutrophus, like that of VHb in Vitreoscilla, is regulated by oxygen (3, 31).

The N-terminal hemoglobin domain of FHP (termed FHPg in this report) shows high sequence homology (51%) with VHb (8, 44). FHP is a monomeric polypeptide of 403 amino acids (44.8 kDa) consisting of two different protein modules: an N-terminal hemoglobin (FHPg; residues 1 to 147) domain and a C-terminal redox-active domain with binding sites for flavin adenine dinucleotide (FAD) (residues 153 to 258) and for NAD(P)H (residues 266 to 403). The reductase domain is able to reduce several artificial electron acceptors as well as cytochrome c. Furthermore, the b-type heme-iron complex of the FHPg domain is capable of reversibly binding oxygen in its reduced state (30, 31), confirming that FHP is a member of the FNR-like protein family (1, 20). The different domains of the FHP polypeptide are connected by short sequences of five to seven amino acids, Pro148-Gly-Gly-Trp-Lys152 and Phe259-His-Ile-Asp-Val-Asp-Ala265, between FHPg-FAD and FAD-NAD domains, respectively (8). The three-dimensional structure of the FHP has also been resolved by X-ray crystallography (10).

The goal of this research was to study potential biotechnological applications of the expression of FHPg, FHP, and fused parts thereof (NAD-FAD domains) in E. coli under microaerobic culture conditions in a bioreactor. In addition, the vhb gene was fused with sequences encoding NAD, FAD, and FAD-NAD activities of the C-terminal domain of FHP. Hypoxic growth of E. coli constructs expressing these different heterologous and fusion proteins was compared with growth of VHb-expressing E. coli, reaching higher final cell densities relative to plasmid carrying VHb-negative E. coli (21), in a controlled hypoxic bioreactor.

MATERIALS AND METHODS

E. coli strains and plasmids.

E. coli DH5α [F− endA1 hsdR17 (rk− mk+) supE44 thi-1 λ− recA1 gryA96 relA1 (φ80dlacZΔM15) Δ(lacZYA-argF)U169; Gibco BRL Life Technologies] was used as a host during the subcloning steps. E. coli MG1655 (λ− F−; Cold Spring Harbor Laboratory) was used to analyze the effect of VHb or of other globin and globin-reductase constructions on growth of cells in a microaerobic bioreactor. pRED2 carrying the Vitreoscilla vhb gene has been described elsewhere (21, 22). pUC19 (50) was used for subcloning, and pKQV4 (36) was used as an isopropyl-β-d-thiogalactopyranoside (IPTG)-inducible expression vector. pPPC1, a derivative of pKQV4 containing the vhb gene, has been described by Kallio et al. (19). pGE276 (8), containing the fhp gene of A. eutrophus, was a generous gift from B. Friedrich (Humboldt University of Berlin, Berlin, Germany).

DNA manipulations.

All restriction endonucleases were purchased from commercial suppliers and used according to the recommended protocols. DNA manipulations were performed according to standard protocols (33).

PCR (32) was used to amplify the genes encoding VHb (GenBank accession no. X13516) (22) and FHP (GenBank accession no. X74334) (8) and open reading frames coding for FHPg, NAD, and FAD protein domains of FHP or their combinations. PCR amplifications were performed with a Perkin-Elmer GeneAmp 9600 PCR system and Pwo polymerase (Boehringer Mannheim). Oligonucleotides for PCRs were synthesized by Microsynth (Balgach, Switzerland) and are shown in Table 1. Translational stop codons (CTA and TTA) were also inserted into the gene structures encoding new fusion proteins if necessary (Table 1). The oligonucleotides were designed in a way that the hinge sequences between the various domains of fusion proteins (globin-reductase) remained highly conserved and that amino acid sequences relative to the original sequence of FHP were minimally altered (summarized in Fig. 1). The amino acid sequences of the FHPg and VHb domains contain 147 and 146 residues, respectively. Thus, Gly150 within the FHP protein sequence was changed to Thr149 in VHb-FAD and VHb-FAD-NAD fusion proteins. This change generates a new restriction site for KpnI. Linkage of the NAD domain (LHIDVDA) with either the VHb or FHPg domain changed Leu (L) to Phe (F) or Pro (P), respectively (Fig. 1B). PCR-amplified gene fragments were purified by using a QIAquick PCR purification kit (Qiagen, Basel, Switzerland). DNA fragments were separated by agarose gel electrophoresis and recovered by using a QIAquick gel extraction kit.

TABLE 1.

Oligonucleotides used for PCR amplifications of vhb, fhp, and the open reading frames of fhp encoding FHPg, NAD, and FAD subunits

Oligonucleotide Sequence (5′→3′)a
1 CGGAATTCCGATGCTGACCCAGAAAACAAAAG
EcoRI start fhp
2 TGCACTGCAGTGCACTATTATTGTTCCGCAGAGCGCTC
PstI stop 2× fhp
3 TGCACTGCAGTGCATTACTACTCAGCAAACAGGTCG
PstI stop 2× nad
4 CGGAATTCCGATGTTAGACCAGCAAACCATT
EcoRI start vhb
5 GGGGTACCGGGTTCAACCGCTTGAGCGTAC
KpnI vhb
6 GGGGTACCTGGAAGGGGTGGCGCACCTTTGTG
KpnI fad
7 ACGTTGACGCCAAGACACCCATTGTCCTGATC
HincII nad
8 GCGTCAACGTCGATATGGAATTCAACCGCTTGAGCGTAC
HincII vhb
9 CGTCAACGTCGATATGGGGTTGTTCCGCAGAGCGCTC
HincII fhp
10 TGCACTGCAGTGCACTATTAGCTTCCATAGGGCGCAG
PstI stop 2× fad
a

Restriction sites, translational start (ATG) and stop (CTA and TTA) codons are in boldface, and coding sequences of the genes are in italics. 

FIG. 1.

FIG. 1

(A) Protein domains of native Vitreoscilla VHb and A. eutrophus FHP. Alignment of VHb (residues 1 to 146) (22) and FHP (1 to 403) amino acid sequences reveals three different modules in FHP: hemoglobin domain (FHPg; positions 1 to 147), FAD-binding domain (153 to 258) and NAD(P)H-binding domain (266 to 403) (8). The linker regions between the FHPg and FAD (PGGWK) and the FAD and NAD (LHIDVDA) domains are shown. (B) The protein modules of chimeric proteins and hinge sequences. Gly150 was changed to Thr149 in pAX4 and pAX9, expressing VHb-FAD-NAD (residues 1 to 402) and VHb-FAD (1 to 257) proteins, respectively, and written in bold italics. Because VHb is one residue shorter than FHPg (146 versus 147), renumbering of amino acid residues in VHb fusion proteins was necessary. The LHIDVDA linker sequence was changed to FHIDVDA and PHIDVDA in pAX12 (VHb-NAD) and pAX14 (FHPg-NAD), respectively.

A PCR screening method was used to identify E. coli DH5α transformants carrying the correct gene inserts either in pUC19 or in pKQV4. The reaction mixture for one sample contained 0.4 μl of dimethyl sulfoxide, 1.0 μl of 10× Taq buffer, 0.1 μl of Taq polymerase (5 U/μl; Boehringer Mannheim), 1 μl of each primer (final concentration of each primer, 100 pmol/μl), deoxynucleoside triphosphates added to a final concentration of 10 mM, and H2O added to give a total volume of 10 μl in a well of a 96-well PCR plate (Axon Lab, Baden-Dättwil, Switzerland). A single ampicillin-resistant colony was picked aseptically from overnight-incubated Luria-Bertani (LB) agar plates (33) supplemented with ampicillin (100 μg/ml) and transferred to a well of the PCR plate. Standard PCR techniques were used for DNA amplification (32). Reaction mixtures were analyzed for amplified gene fragments of the expected molecular size by agarose gel electrophoresis (33), and the correct recombinant plasmid was used for further characterization.

Plasmid DNAs for DNA sequencing were isolated and purified from overnight-grown bacteria cultures by using a QIAprep Spin MiniPrep kit (Qiagen). A Thermo Sequenase fluorescence-labeled primer cycle sequencing kit (Amersham International) was used for DNA sequencing reactions (34), and cycle sequencing was performed as recommended by the manufacturer. The infrared (IRD-41)-labeled sequencing primer pair pKKfor (5′ CTC AAG GCG CAC TCC CGT TCT), plus pKKrev (5′ GAG TTC GGC ATG GGG TCA GGT G) and universal primer pair -40 forward plus -40 reverse, for DNA sequencing of pKQV4 and pUC19 derivatives, respectively, were obtained from MWG-Biotech (Ebersberg, Germany). The sequencing reactions were separated in a LI-COR 4000 L automated DNA sequencer (LI-COR, Inc., Lincoln, Neb.). IRD-41-labeled DNA fragments were visualized by using a scanning laser microscope assembly. DNA sequence data were collected and analyzed by using the LI-COR Base ImagIR software.

Construction of VHb-reductase, FHP, and FHPg-reductase expression vectors.

Plasmids pRED2 and pGE276 were used as templates for vhb and fhp gene amplifications, respectively. The oligonucleotides were designed so that only one amino acid was changed within the proposed linker region between the protein domains (Fig. 1). The gene fragments encoding FHP and the FHPg and FHPg-FAD domains of FHP were PCR amplified by using oligonucleotides 1 and 3, 1 and 2, and 1 and 10, respectively (Table 1). Purified DNA fragments were digested with EcoRI and PstI and subcloned directly into pKQV4 digested with the same enzymes. Correct plasmids were identified by the PCR screening method, and authenticity of reading frames of the expression cassettes in pAX1 (FHPg), pAX5 (FHP), and pAX6 (FHPg-FAD) was verified by DNA sequencing.

Construction of plasmids pAX4 (VHb-FAD-NAD), pAX9 (VHb-FAD), pAX12 (VHb-NAD), and pAX14 (FHPg-NAD) is summarized below (Fig. 1B). In all cases, two subcloning steps using pUC19 were necessary for construction of the expression cassettes. The gene fragment encoding the FHPg subunit of FHP was PCR amplified with oligonucleotides 1 and 9 (Table 1) and a purified 6.5-kb SalI-XhoI fragment of pGE276 as a template. The PCR fragments were isolated and digested with EcoRI and HincII. The fragments were subcloned into pUC19 digested with the same enzymes, and the new plasmid was named pAX13. The gene fragment encoding the NAD domain was amplified with oligonucleotides 3 and 7 (Table 1) and the same template as mentioned above. The purified PCR fragments were HincII-PstI digested and subcloned into pAX13 to generate pAX2. The expression cassette synthesizing FHPg-NAD was removed with EcoRI-PstI digestion and subcloned into EcoRI-PstI-digested pKQV4 to generate pAX14. An identical cloning strategy was used to construct the expression cassette synthesizing VHb-NAD, using oligonucleotide pairs 4-8 and 3-7 (Table 1) for vhb and the open reading frame encoding the NAD domain of FHP, respectively. The expression vector producing VHb-NAD was named pAX12.

Expression cassettes for VHb-FAD and VHb-FAD-NAD production (Fig. 1B) were constructed by using a slight modification of the protocol outlined above. The vhb gene was amplified with oligonucleotides 4 and 5 (Table 1). The vhb PCR fragment was double digested with EcoRI and KpnI and inserted into pUC19 digested with the same enzymes, yielding plasmid pAX7. The open reading frame of the fhp gene encoding the FAD module was amplified with oligonucleotides 6 and 10 (Table 1), double digested with KpnI and PstI, and ligated with pAX7, resulting in pAX16. The complete cassette for VHb-FAD expression was excised from pAX16 by using EcoRI and PstI and ligated with EcoRI-PstI digested pKQV4 to form pAX9. An identical cloning strategy was applied for the VHb-FAD-NAD expression cassette. The vhb and fhp gene fragments encoding FAD-NAD were amplified with oligonucleotide pairs 4-5 and 3-6, respectively (Table 1). The final expression plasmid producing VHb-FAD-NAD was named pAX4. The amplified expression cassettes in vectors pAX4 (VHb-FAD-NAD), pAX9 (VHb-FAD), pAX12 (VHb-NAD), and pAX14 (FHPg-NAD) were subjected to DNA sequencing, and the sequences of the reading frames were verified.

Bioreactor cultivations.

Cultures for both plasmid DNA isolations and bioreactor inoculations were grown on a shaker at 37°C and 250 rpm for approximately 14 h in 50-ml shake flasks containing 10 ml of LB medium (33) supplemented with ampicillin (100 μg/ml).

Fed-batch cultivations of E. coli MG1655 carrying various VHb, VHb-reductase, FHPg, or FHPg-reductase expression vectors were performed in a defined glucose batch medium supplemented, per liter, with 150 mg of Casamino Acids (Difco), 30 mg of yeast extract (Difco), and 100 mg of ampicillin (19), using a Sixfors bioreactor unit (Infors, Bottmingen, Switzerland) allowing six controlled cultivations at the same time. To start Sixfors bioreactor fed-batch cultivations, 3.0 ml of seeding culture was used to inoculate 300 ml of glucose batch medium, and process parameters were maintained at 37°C, pH 7 ± 0.2 (adjusted either with 2 M NaOH or with 2 M H3PO4), 300 rpm, and 120 ml of air per min. The composition of feed medium has been described previously (19). Expression of hemoglobins and hemoglobin-reductase constructions were induced by IPTG addition (final concentration of 100 μM) when the optical densities (A600) of cultures were approximately 1. Fed-batch mode was commenced with 1 ml of feed medium per h when the culture reached an A600 of approximately 2, and the feeding rate was increased to 2 ml/h when the A600 was approximately 4. Thereafter, the feeding rate was maintained constant at 2 ml/h until the end of 30 h of microaerobic fed-batch cultivations.

Dissolved oxygen concentration and exhaust gases (CO2 and O2) from bioreactors were monitored as described previously (17, 19).

Analytical techniques.

The soluble fractions of both non-globin-producing and globin-expressing E. coli MG1655 cells (for VHb, FHPg, FHPg-FAD-NAD, FHPg-FAD, FHPg-NAD, VHb-FAD-NAD, VHb-FAD, and VHb-NAD constructions) were prepared by harvesting 100 ml of bioreactor-cultivated cells followed by centrifugation in a Beckman J2-21M centrifuge with a JLA 10.500 rotor at 4°C for 10 min and 7,000 × g. Supernatants were discarded, and cell pellets were resuspended in 10 ml of lysis buffer (100 mM Tris-HCl [pH 7.5], 50 mM NaCl, 1 mM EDTA). Cells were disrupted in a French press (SLM-Aminco) at 1,200 lb/in2. Cell debris was removed by centrifugation in a Beckman GS-6R at 4°C for 15 min and 3,200 × g. The supernatants were poured in new tubes, and clear soluble fractions were recovered by centrifugation for 15 min at 14,000 rpm at 4°C in an Eppendorf centrifuge. Globin activities were assayed by CO difference spectroscopy (reduced + CO minus reduced spectrum) as described previously (13).

Acetate concentrations of bioreactor samples were determined with a Beckman SYNCHRON CX5CE autoanalyzer. A Boehringer Mannheim acetate kit (product no. 148261) was adapted for the Beckman autoanalyzer system and used to measure acetate concentrations from the bioreactor samples. Ethanol concentrations were measured enzymatically with a Beckman autoanalyzer and a Beckman alcohol kit. The measured concentrations were normalized to the final A600 values of the cultures.

β-Lactamase activities expressed by plasmids pKQV4 (control), pAX1 (FHPg), pAX4 (VHb-FAD-NAD), pAX5 (FHP), pAX6 (FHPg-FAD), pAX9 (VHb-FAD), pAX12 (VHb-NAD), pAX14 (FHPg-NAD), and pPPC1 (VHb) were determined with the chromogenic cephalosporin nitrocefin (Becton Dickinson) as a substrate (28). The samples were withdrawn at the end of hypoxic bioreactor cultivations, cells were disrupted in a French press, and the change of absorbance at 482 nm was recorded at room temperature (27). The total soluble protein of each sample was determined with a Bio-Rad protein assay kit, based on the method of Bradford (5). Activity of β-lactamase is reported in units per milligram of soluble protein.

RESULTS

Construction of hemoglobin (VHb and FHPg) and hemoglobin-reductase expression vectors.

Most of the known bacterial hemoglobin proteins, such as FHP and HMP, show two different activities, an oxygen-binding activity and a reductase activity (8, 43). These two different biochemical properties are linked in a single two-domain protein containing N-terminal hemoglobin and C-terminal reductase modules (Fig. 1A). VHb and the recently identified new globin of Vitreoscilla stercoraria do not have reductase activity in the same polypeptide (16, 22, 44). However, it is well documented that VHb requires reductase activity for physiological function, and such an unlinked NADH-methemoglobin reductase has been identified in Vitreoscilla. E. coli also contains an unidentified reductase system capable of catalyzing the reduction of VHb in vivo (9, 46). However, maintenance of the redox state of heme iron of VHb, catalyzed by a heterologous reductase, may be an activity-limiting factor in a heterologous host and decrease the beneficial effects of VHb expression such as relieving oxygen stress under hypoxic conditions. To determine whether fusion of a heterologous reductase domain to VHb provides improved benefits, the following three expression vectors were constructed: pAX4 (VHb-FAD-NAD), pAX9 (VHb-FAD), and pAX12 (VHb-NAD). The N-terminal domain of FHP is highly homologous with VHb (8). Thus, it may also be possible that FHP is able to expedite growth of E. coli cells under hypoxic conditions. To study this hypothesis, we also constructed four new expression vectors, pAX1 (FHPg), pAX5 (FHP), pAX6 (FHPg-FAD), and pAX14 (FHPg-NAD), as described in Materials and Methods. The VHb expression plasmid pPPC1 has been described previously (19). Structures of the novel expression modules with hinge sequences, relative to the wild-type structures, are summarized in Fig. 1B.

Microaerobic bioreactor cultivations.

VHb-expressing wild-type E. coli MG1655 cells showed improved growth relative to the common VHb-positive cloning host E. coli DH5α under oxygen-limited culture conditions (19). Thus, E. coli MG1655 cells expressing VHb (pPPC1), FHPg (pAX1), or separate globin-reductase fusions (pAX5, pAX6, pAX4, pAX9, pAX12, and pAX14) were cultivated at least twice in a microaerobic Sixfors bioreactor. The dissolved oxygen concentration readings by polarographic electrodes were zero after approximately 6 h of various cultivations and remained there until the end of fed-batch processes. Differences in growth behavior between various constructions became apparent after approximately 8 to 9 h of cultivation, where A600 was approximately 3, and the growth of non-VHb-expressing control MG1655:pKQV4 ceased rapidly. Obviously, the supply of oxygen was not sufficient to support effective growth of nonglobin-expressing E. coli cells beyond this point (Fig. 2).

FIG. 2.

FIG. 2

OD600 (optical density at 600 nm) trajectories of E. coli MG1655 expressing proteins showing FHPg domain activity: pAX1 (FHPg; ●), pAX5 (FHP; ▴), pAX6 (FHPg-FAD; ■), and pAX14 (FHPg-NAD; ⧫). The control plasmid was pKQV4 (▾). The cells were cultivated under hypoxic conditions in a Sixfors bioreactor as described in Materials and Methods.

Growth curves of MG1655:pAX1, MG1655:pAX5, MG1655:pAX6, and MG1655:pAX14 expressing FHPg or FHP-reductase derivatives of A. eutrophus are shown in Fig. 2. The growth curves of VHb-expressing (pPPC1) or VHb-reductase-expressing (pAX4, pAX9, and pAX12) E. coli MG1655 cells are shown in Fig. 3. Non-globin-expressing MG1655:pKQV4 was used as an internal control between various cultivations, and the final A600 of the control was 5.5 ± 0.5 at the end of 30 h of cultivation. E. coli MG1655:pAX1 (FHPg-expressing) cells reached a final A600 of 8.3 ± 0.9, which is similar to the final A600 of 7.9 ± 0.5 for Vitreoscilla VHb-expressing MG1655:pPPC1 cells (Fig. 2 and 3).

FIG. 3.

FIG. 3

Time course of OD600 (optical densities at 600 nm) of E. coli MG1655 with the various VHb constructs: pPPC1 (VHb; ●), pAX4 (VHb-FAD-NAD; ▴), pAX9 (VHb-FAD; ⧫), and pAX14 (VHb-NAD; ■). ▾, MG1655 cells carrying the control plasmid, pKQV4.

Coexpression of the NAD part of the reductase together with the VHb (MG1655:pAX12) or FHPg (MG1655:pAX14) domain reduced the final A600 values of E. coli approximately 20% relative to either MG1655:pPPC1 (VHb) or MG1655:pAX1 (FHPg), but these constructions eventually attained a final optical density slightly higher than that of the cultures carrying the control plasmid pKQV4. Final A600 values for MG1655:pAX12 and MG1655:pAX14 were 6.4 ± 1.0 and 6.4 ± 0.9, respectively. MG1655:pAX6 (FHPg-FAD) and MG1655:pAX9 (VHb-FAD) showed slightly increased final optical densities, 9.0 ± 1.0 and 9.9 ± 0.9, respectively, relative to VHb- or FHPg-expressing cells (Fig. 2 and 3). E. coli MG1655:pAX5 expressing full-length A. eutrophus FHP flavohemoprotein (A600 of 12.0 ± 1.5) reached approximately 2.2-fold and 50% higher final cell densities relative to the control MG1655:pKQV4 (5.5 ± 0.5) and VHb-expressing MG1655:pPPC1 (7.9 ± 0.5), respectively. MG1655:pAX4 (VHb-FAD-NAD) cells reached the highest final optical densities, A600 of 13.9 ± 1.4, at the end of 30 h of hypoxic fed-batch cultivations (Fig. 3). This value was on average approximately 75 and 15% higher than those for the original VHb-expressing clone MG1655:pPPC1 (7.9 ± 0.5) and the FHP-expressing construct MG1655:pAX5 (12.0 ± 1.5), respectively (Fig. 2 and 3). These results clearly show that the beneficial effect of VHb can be improved substantially by using protein engineering to combine directly its advantageous oxygen-binding properties with a fused reductase activity.

All expression vectors were also analyzed for insert maintenance by a PCR screening method. The results obtained with different oligonucleotide primer combinations showed that the expression cassettes were stably maintained during prolonged hypoxic bioreactor cultivations (data not shown).

By-product accumulation during hypoxic bioreactor cultivations.

The excretion of by-products such as acetate and ethanol allows E. coli cells to discard a surplus of reduction equivalents, regenerating NAD+ and NADP+, which are needed to metabolize glucose. Final concentrations of acetate and ethanol from samples withdrawn from bioreactors at the end of 30 h cultivation were assayed in a Beckman autoanalyzer, and values were normalized to 1 unit of A600. Our results show reduced excretion of acetate from strains expressing various VHb, FHPg, and hemoglobin-reductase constructions relative to the control MG1655:pKQV4. For MG1655:pAX4 (VHb-FAD-NAD) and MG1655:pAX5 (FHP), the smallest specific acetate levels were measured: 4.9 ± 0.3 mM/A600 and 4.6 ± 0.1 mM/A600, respectively. These values were approximately 40% lower than specific acetate accumulation of the vector control MG1655:pKQV4 cultivation (8.2 ± 0.7 mM/A600). Expression of the hemoglobin domain alone, either in MG1655:pAX1 (FHPg; 6.4 ± 0.3 mM/A600) or in MG1655:pPPC1 (VHb; 5.9 ± 0.7 mM/A600), resulted in smaller decreases (approximately 22 and 28%, respectively) in the production of acetate relative to the control (Table 2).

TABLE 2.

Final acetate concentrations of E. coli MG1655 expressing various hemoglobin constructions cultivated in a hypoxic bioreactora

Plasmid Hemoglobin Mean acetate concn (mM/A600) ± SEM
pPPC1 VHb 5.94 ± 0.69
pAX1 FHPg 6.43 ± 0.31
pAX4 VHb-FAD-NAD 4.89 ± 0.31
pAX5 FHP 4.63 ± 0.11
pAX9 VHb-FAD 5.63 ± 1.02
pAX6 FHPg-FAD 6.04 ± 0.96
pAX12 VHb-NAD 7.78 ± 1.41
pAX14 FHPg-NAD 6.38 ± 0.30
pKQV4 Control 8.20 ± 0.69
a

Determined at the end of 30 h of microaerobic cultivation and normalized to A600. 

The excretion of ethanol from the samples was also measured at the end of cultivations. The results indicate that FHPg-expressing cells produced 40% less ethanol (1.4 ± 0.4 mM/A600) relative to MG1655:pKQV4 (2.3 ± 1.5 mM/A600). Surprisingly, VHb-expressing MG1655:pPPC1 cells produced 2.9 times more ethanol (4.0 ± 0.1 mM/A600) relative to FHPg-producing strain MG1655:pAX1 under similar culture conditions. In addition, accumulation of ethanol was also reduced in MG1655:pAX6 and MG1655:pAX4, approximately 25 and 38%, respectively, relative to the control MG1655:pKQV4. These results show that ethanol accumulation is not always decreased in hemoglobin-expressing cells relative to the hemoglobin-negative control.

Analysis of biological activities of VHb-, FHPg-, and globin-reductase hemoproteins by CO-binding assay.

Cells were harvested at the end of hypoxic fed-batch cultivations, and samples for CO-binding assays were prepared as described in Materials and Methods. The biochemical activity of the globins in all constructions can be determined by using a standard technique (13). The maximum and minimum values of the recorded spectra of the different constructions are given in Table 3. Due to lack of a reported extinction coefficient either for FHP or for FHPg and to the novel nature of the heme-reductase fusion proteins, it is impossible to predict the effects of the reductase tails on the extinction coefficients. Thus, it is not possible to compare the specific activities of the different heme domains. Our results are only qualitative, giving no information about the specific activity of globins per milligram of soluble protein. However, the results clearly show that biologically active hemoproteins were produced in all E. coli strains expressing various recombinant globins (Table 3). The CO-difference spectrum of MG1655:pKQV4 revealed no hemoglobin activity, as shown previously (19), indicating that the recorded curves represent the activity of overexpressed heterologous hemoproteins and are not artifacts of E. coli HMP expression (data not shown).

TABLE 3.

CO-binding assaya of various E. coli MG1655-expressed hemoglobin proteins

Plasmid Hemoglobin Absorption value (nm) for activity
Maximum Minimum
pPPC1 VHb 419 437
pAX1 FHPg 422 437
pAX4 VHb-FAD-NAD 422 443
pAX5 FHP 422 439
pAX9 VHb-FAD 419 436
pAX6 FHPg-FAD 421 438
pAX12 VHb-NAD 416 442
pAX14 FHPg-NAD 419 436
a

Performed as described in reference 13. 

The hemoglobin domain of A. eutrophus flavohemoprotein (FHPg) has maximal absorption at a slightly longer wavelength (422 nm) relative to the γ band of VHb (419 nm) (Table 3). A similar maximal absorption value is observed in strains expressing FHPg protein fused with either the FAD-NAD or FAD domain. A slight shift of the absorption maximum (419 nm) for the FHPg-NAD-expressing strain was recorded. In addition, the absorption maximum has changed in VHb-FAD-NAD-expressing (422 nm) and VHb-NAD-expressing (416 nm) strains relative to the VHb-producing strain (419 nm) (Table 3). This variation may result from a slightly varying three-dimensional structure of the hemoglobin domains of the fusion proteins. These results also verify that FHP contains a CO-binding b-type heme cofactor such as VHb and also HMP of E. coli (30, 41, 43).

Analysis of β-lactamase activity at the end of hypoxic cultivations.

Production of a model recombinant protein, β-lactamase, was also assayed for samples withdrawn from a microaerobic bioreactor (Table 4). The results showed that MG1655:pAX1 (FHPg; 109 ± 3 U/mg), MG1655:pAX5 (FHP; 113 ± 10 U/mg), MG1655:pAX9 (VHb-FAD; 106 ± 5 U/mg), and MG1655:pPPC1 (VHb; 119 ± 13 U/mg) produced 24, 28, 20, and 35% more β-lactamase, respectively, relative to MG1655:pKQV4 (88 ± 3 U/mg). The production of β-lactamase was 3.1- or 2.3-fold higher in the fastest-growing strain, MG1655:pAX4 (VHb-FAD-NAD; 271 ± 3 U/mg), relative to MG1655:pKQV4 (control) or MG1655:pPPC1 (VHb; 119 ± 13 U/mg), respectively, at the end of 30 h of hypoxic fed-batch cultivations. The production of β-lactamase was reduced in MG1655:pAX6 (FHPg-FAD; 40 ± 1 U/mg), MG1655:pAX12 (VHb-NAD; 62 ± 15 U/mg), and MG1655:pAX14 (FHPg-NAD; 36 ± 3 U/mg) relative to the control, MG1655:pKQV4 (Table 4). This observation was surprising because recombinant E. coli MG1655 strains expressing various hemoprotein gene constructions were always able to reach higher final optical densities relative to the non-VHb-expressing control.

TABLE 4.

Final β-lactamase activities of microaerobically grown E. coli MG1655 expressing various hemoglobins

Plasmid Hemoglobin β-Lactamase activity (avg ± SD)a
pPPC1 VHb 119 ± 13
pAX1 FHPg 109 ± 3
pAX4 VHb-FAD-NAD 271 ± 3
pAX5 FHP 113 ± 10
pAX9 VHb-FAD 106 ± 5
pAX6 FHPg-FAD 40 ± 1
pAX12 VHb-NAD 62 ± 15
pAX14 FHPg-NAD 36 ± 3
pKQV4 Control 88 ± 3
a

Final β-lactamase activity expressed as units per milligram of soluble protein. 

β-Lactamase results reported here do not take into account the various problems and limitations encountered with the optimization of heterologous protein production in E. coli (47). However, each type of experiment conducted here included the same genetic background (E. coli MG1655), and plasmid constructions were derived from the same parental plasmids with the pBR322 origin of replication. Thus, the above results suggest that VHb-reductase-expressing cells are able to redirect cellular resources more efficiently toward recombinant protein production relative to FHP-expressing cells.

DISCUSSION

Our results show that the beneficial effect of VHb expression on microaerobic bacterial growth can be improved substantially by expressing instead a fusion protein (VHb-FAD-NAD) containing vhb and the reductase gene module of fhp. The positive effect of fused reductase expression was also observed when FHP was expressed in microaerobic E. coli. The expression of these two proteins resulted in 2.2-fold (FHP) and 2.5-fold (VHb-FAD-NAD) increases in final cell densities relative to the VHb-expressing strain. VHb expression has been shown to modulate cellular metabolism of E. coli (7, 18, 27, 38–40). VHb influences the energy level by interacting with the respiratory chain, thus leading to increased proton pumping, higher ATP production rates, and a less reduced contingent of pyridine nucleotide cofactors (7, 18, 38, 39). Recently, it has been shown that HMP expression elicits different physiological effects relative to VHb in E. coli. HMP is able to protect E. coli cells against nitrosating agents, NO-related species, and oxidative stress (24). The detailed physiological functions of FHP of A. eutrophus in E. coli and other heterologous hosts remain to be investigated. No significant changes in either aerobic or anaerobic growth were seen in A. eutrophus strains lacking the entire flavohemoprotein gene in the genome (8). However, A. eutrophus fhp mutants did not accumulate nitrous oxide in significant amounts as observed in wild-type cells. This finding suggest that FHP may interact in an unidentified way with gas metabolism under denitrification conditions in A. eutrophus (8).

The reductase domain (FAD-NAD) of A. eutrophus FHP is part of the FNR-like protein family and is widespread among prokaryotic and eukaryotic organisms (1). A well-studied example is HMP of E. coli. HMP has an N-terminal hemoglobin domain and a C-terminal FNR-like module (43). This module consists of two functionally inseparable and evolutionarily conserved domains, the FAD- and NADP+-binding domains. The FNR-like module of HMP reduces the heme iron of the hemoglobin domain by transferring electrons from NAD(P)H to the heme moiety via the protein-associated FAD group (1). Poole et al. (29) have shown that HMP is a reductase of broad substrate specificity, and the prosthetic heme group of the hemoglobin domain is not necessarily involved in electron transfer in E. coli. Thus, the FAD-binding domain is able to donate electrons directly to other acceptors such as cytochrome c (29). There are at least two different ways for electrons to be channeled from NAD(P)H: either via FAD to the oxidized heme iron or via FAD to different putative electron acceptors. It may be possible that FHP functions in a similar way in A. eutrophus and even in heterologous prokaryotes.

Normally, the binding of O2 to the heme iron is a reversible reaction, but the binding of oxygen can lead to a redox reaction in which the ferroheme [Fe(II)] group of the hemoglobin is oxidized to ferriheme [Fe(III)] (26). The oxidized iron [Fe(III)] is incapable of binding oxygen, therefore limiting the biochemical and physiological effects of the hemoglobins. HMP has been shown to possess flavin reductase activity capable of reducing iron complexes such as ferric citrate with a negligible rate relative to main ferric/flavin reductase activities in E. coli (11, 29). Previously, VHb and an associated reductase protein, called NADH-cytochrome o reductase, have been shown to constitute an electron-transferring path for the oxidation of NADH and to increase the oxygen uptake several fold in Vitreoscilla (46). Recently, it was also shown that the coexpression of NADPH cytochrome P450, an alkane-inducible monooxygenase, with an NADPH cytochrome P450 oxidoreductase of Candida tropicalis led to an elevated level of P450-catalyzed monooxygenase activity in S. cerevisiae (35). This experiment shows that the metabolic activity of a heterologous hemeprotein, such as VHb, may be limited by reductase activity in a novel host and suggests that the coexpression of an additional reductase may increase electron flux from NAD(P)H to the heme of the hemoglobin-like domain. The electron flow may concomitantly increase the regeneration rate of the ferriheme to ferroheme of the prosthetic heme of oxygen binding hemoglobin in E. coli.

All constructions showed VHb and FHPg activity, as judged by the CO-binding assay. Our results indirectly suggest that the recombinant reductase system was also expressed in an active form because the fusion constructions expressing either VHb-FAD, FHPg-FAD, VHb-reductase, or FHP were able to increase cell growth relative to either VHb- or FHPg-expressing E. coli (Fig. 2 and 3). This assumption is supported by results showing that the native enzyme of E. coli HMP transfers two H+ ions from NADH to FAD and consecutively passes the electrons in two steps, via the heme group to a putative substrate (29). Therefore, it is likely that either reduction equivalents could not be passed from NADH to the heme due to lack of the electron transfer-mediating FAD moiety or the novel three-dimensional structure of fusion proteins is sterically able to hinder the transfer of reduction equivalents from endogenous reductase domain to VHb-NAD and FHPg-NAD constructions. As a consequence, hemoglobin has reduced affinity toward oxygen after oxidation of the prosthetic heme group of the heme moiety. Thus, the beneficial effect of heterologous hemoglobin expression is lost in hypoxic E. coli.

ACKNOWLEDGMENTS

This research was supported by the ETH.

We thank Heidi Ernst for skillful DNA sequencing of the plasmid constructions.

REFERENCES

  • 1.Andrews S C, Shipley D, Keen J N, Findlay J B C, Harrison P M, Guest J R. The haemoglobin-like protein (HMP) of Escherichia coli has ferrisiderophore reductase activity and its C-terminal domain shares homology with ferredoxin NAPD+ reductases. FEBS Lett. 1992;302:247–252. doi: 10.1016/0014-5793(92)80452-m. [DOI] [PubMed] [Google Scholar]
  • 2.Bailey J E, Sburlati A, Hatzimanikatis V, Lee K, Renner W A, Tsai P S. Inverse metabolic engineering: a strategy for directed genetic engineering of useful phenotypes. Biotechnol Bioeng. 1996;52:109–121. doi: 10.1002/(SICI)1097-0290(19961005)52:1<109::AID-BIT11>3.0.CO;2-J. [DOI] [PubMed] [Google Scholar]
  • 3.Boerman S J, Webster D A. Control of heme content in Vitreoscilla by oxygen. J Gen Appl Microbiol. 1982;28:35–43. [Google Scholar]
  • 4.Bowien B, Schlegel H G. Physiology and biochemistry of aerobic hydrogen-oxidizing bacteria. Annu Rev Microbiol. 1981;35:405–452. doi: 10.1146/annurev.mi.35.100181.002201. [DOI] [PubMed] [Google Scholar]
  • 5.Bradford M M. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 6.Bülow L, Holmberg N, Lilius G, Bailey J E. The metabolic effects of native and transgenic hemoglobins on plants. Trends Biotechnol. 1999;17:21–24. doi: 10.1016/s0167-7799(98)01252-9. [DOI] [PubMed] [Google Scholar]
  • 7.Chen R, Bailey J E. Energetic effect of Vitreoscilla hemoglobin expression in Escherichia coli: an on-line 31P NMR and saturation transfer study. Biotechnol Prog. 1994;10:360–364. [Google Scholar]
  • 8.Cramm R, Siddiqui R A, Friedrich B. Primary sequence and evidence for a physiological function of the flavohemoprotein of Alcaligenes eutrophus. J Biol Chem. 1994;10:7349–7354. [PubMed] [Google Scholar]
  • 9.Dikshit K L, Webster D A. Cloning, characterization and expression of the bacterial globin gene from Vitreoscilla in Escherichia coli. Gene. 1988;70:377–386. doi: 10.1016/0378-1119(88)90209-0. [DOI] [PubMed] [Google Scholar]
  • 10.Ermler U, Siddiqui R A, Cramm R, Friedrich B. Crystal structure of the flavohemoglobin from Alcaligenes eutrophus at 1.75 Å resolution. EMBO J. 1995;14:6067–6077. doi: 10.1002/j.1460-2075.1995.tb00297.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Eschenbrenner M, Coves J, Fontecave M. Ferric reductases in Escherichia coli: the contribution of the haemoglobin-like protein. Biochem Biophys Res Commun. 1994;198:127–131. doi: 10.1006/bbrc.1994.1018. [DOI] [PubMed] [Google Scholar]
  • 12.Favey S, Labesse G, Vouille V, Boccara M. Flavohemoglobin HmpX: a new pathogenecity determinant in Erwinia chrysanthemi strain 3937. Microbiology. 1995;141:863–871. doi: 10.1099/13500872-141-4-863. [DOI] [PubMed] [Google Scholar]
  • 13.Hart R A, Bailey J E. Purification and aqueous 2-phase partitioning properties of recombinant Vitreoscilla hemoglobin. Enzyme Microb Technol. 1991;13:788–795. doi: 10.1016/0141-0229(91)90061-e. [DOI] [PubMed] [Google Scholar]
  • 14.Holmberg N, Lilius G, Bailey J E, Bülow L. Transgenic tobacco expressing Vitreoscilla hemoglobin exhibits enhanced growth and altered metabolite production. Nat Biotechnol. 1997;15:244–247. doi: 10.1038/nbt0397-244. [DOI] [PubMed] [Google Scholar]
  • 15.Iwaasa H, Takagi T, Shikama K. Amino acid sequence of yeast hemoglobin. A two-domain structure. J Mol Biol. 1992;227:948–954. doi: 10.1016/0022-2836(92)90236-d. [DOI] [PubMed] [Google Scholar]
  • 16.Joshi M, Mande S, Dikshit K L. Hemoglobin biosynthesis in Vitreoscilla stercoraria DW: cloning, expression, and characterization of a new homolog of a bacterial globin gene. Appl Environ Microbiol. 1998;64:2220–2228. doi: 10.1128/aem.64.6.2220-2228.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kallio P T, Bailey J E. Intracellular expression of Vitreoscilla hemoglobin (VHb) enhances total protein secretion and improves the production of α-amylase and neutral protease in Bacillus subtilis. Biotechnol Prog. 1996;12:31–39. doi: 10.1021/bp950065j. [DOI] [PubMed] [Google Scholar]
  • 18.Kallio P T, Kim D J, Tsai P S, Bailey J E. Intracellular expression of Vitreoscilla hemoglobin alters Escherichia coli energy metabolism under oxygen-limited conditions. Eur J Biochem. 1994;219:201–208. doi: 10.1111/j.1432-1033.1994.tb19931.x. [DOI] [PubMed] [Google Scholar]
  • 19.Kallio P T, Tsai P S, Bailey J E. Expression of Vitreoscilla hemoglobin is superior to horse heart myoglobin and yeast flavohemoglobin expression for enhancing Escherichia coli growth in a microaerobic bioreactor. Biotechnol Prog. 1996;12:751–757. doi: 10.1021/bp960071v. [DOI] [PubMed] [Google Scholar]
  • 20.Karplus P A, Daniels M J, Herriot R J. Atomic structure of ferredoxin-NADP+ reductase: prototype for a structurally novel flavoenzyme family. Science. 1991;25:60–66. [PubMed] [Google Scholar]
  • 21.Khosla C, Bailey J E. Heterologous expression of a bacterial haemoglobin improves the growth properties of recombinant Escherichia coli. Nature. 1988;331:633–635. doi: 10.1038/331633a0. [DOI] [PubMed] [Google Scholar]
  • 22.Khosla C, Bailey J E. The Vitreoscilla hemoglobin gene: molecular cloning, nucleotide sequence and genetic expression in Escherichia coli. Mol Gen Genet. 1988;214:158–161. doi: 10.1007/BF00340195. [DOI] [PubMed] [Google Scholar]
  • 23.LaCelle M, Kumano M, Kurita K, Yamane K, Zuber P, Nakano M M. Oxygen-controlled regulation of the flavohemoglobin gene in Bacillus subtilis. J Bacteriol. 1996;178:3803–3808. doi: 10.1128/jb.178.13.3803-3808.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Membrillo-Hernández J, Coopamah M D, Anjum M F, Stevanin T M, Kelly A, Hughes M N, Poole R K. The flavohemoglobin of Escherichia coli confers resistance to a nitrosating agent, a “nitric oxide releaser,” and paraquat and is essential for transcriptional responses to oxidative stress. J Biol Chem. 1999;274:748–754. doi: 10.1074/jbc.274.2.748. [DOI] [PubMed] [Google Scholar]
  • 25.Minas W, Brünker P, Kallio P T, Bailey J E. Improved erythromycin production in a genetically engineered industrial strain of Saccharopolyspora erythraea. Biotechnol Prog. 1998;14:561–566. doi: 10.1021/bp980055t. [DOI] [PubMed] [Google Scholar]
  • 26.Naqui A, Chance B. Enhanced superoxide dismutase activity of pulsed cytochrome oxidase. Biochem Biophys Res Commun. 1986;136:433–437. doi: 10.1016/0006-291x(86)90929-0. [DOI] [PubMed] [Google Scholar]
  • 27.Nilsson M, Kallio P T, Bailey J E, Bülow L, Wahlund K-G. Expression of Vitreoscilla hemoglobin in Escherichia coli enhances ribosome and tRNA levels: a flow field-flow fractionation study. Biotechnol Prog. 1999;15:158–163. doi: 10.1021/bp9900155. [DOI] [PubMed] [Google Scholar]
  • 28.O'Callaghan C H, Morris A, Kirby S M, Shingler A H. A novel method for detection β-lactamase by using a chromogenic cephalosporin substrate. Antimicrob Agents Chemother. 1972;4:283–288. doi: 10.1128/aac.1.4.283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Poole R K, Rogers N J, Dímello R A M, Hughes M N, Orii Y. Escherichia coli flavohemoglobin (Hmp) reduces cytochrome c and Fe(III)-hydroxamate K by electron transfer from NADH via FAD: sensitivity of oxidoreductase activity to haem-bound dioxygen. Microbiology. 1997;143:1557–1565. doi: 10.1099/00221287-143-5-1557. [DOI] [PubMed] [Google Scholar]
  • 30.Probst I, Schlegel H G. Respiratory components and oxidase activities in Alcaligenes eutrophus. Biochim Biophys Acta. 1976;440:412–428. doi: 10.1016/0005-2728(76)90075-x. [DOI] [PubMed] [Google Scholar]
  • 31.Probst I, Wolf G, Schlegel H G. An O2-binding flavohemoprotein from Alcaligenes eutrophus. Biochim Biophys Acta. 1979;576:471–478. doi: 10.1016/0005-2795(79)90422-7. [DOI] [PubMed] [Google Scholar]
  • 32.Saiki R K, Gelfand D H, Stoffel S, Schaarf S J, Higuchi R, Horn G T, Mullis K B, Erlich H A. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 1988;239:487–491. doi: 10.1126/science.2448875. [DOI] [PubMed] [Google Scholar]
  • 33.Sambrook J, Frisch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  • 34.Sanger F, Nicklen S, Coulson A R. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 1977;74:5463–5467. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sanglard D, Beretta I, Wagner M, Käppeli O, Fiechter A. Functional expression of the alkane-inducible monooxygenase system of the yeast Candida tropicalis in Saccharomyces cerevisiae. Biocatalysis. 1990;4:19–28. [Google Scholar]
  • 36.Strauch M A, Spiegelman G B, Perego M, Johnson W C, Burbulys D, Hoch J A. The transition state transcription regulator abrB of Bacillus subtilis is a DNA binding protein. EMBO J. 1989;8:1615–1621. doi: 10.1002/j.1460-2075.1989.tb03546.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Takaya N, Suzuki S, Matsuo M, Shoun H. Purification and characterization of a flavohemoglobin from the denitrifying fungus Fusarium oxysporum. FEBS Lett. 1997;414:545–548. doi: 10.1016/s0014-5793(97)01069-7. [DOI] [PubMed] [Google Scholar]
  • 38.Tsai P S, Hatzimanikatis V, Bailey J E. Effect of Vitreoscilla hemoglobin dosage on microaerobic Escherichia coli carbon and energy metabolism. Biotechnol Bioeng. 1996;49:139–150. doi: 10.1002/(SICI)1097-0290(19960120)49:2<139::AID-BIT3>3.0.CO;2-R. [DOI] [PubMed] [Google Scholar]
  • 39.Tsai P S, Nägeli M, Bailey J E. Intracellular expression of Vitreoscilla hemoglobin modifies microaerobic Escherichia coli metabolism through elevated concentration and specific activity of cytochrome o. Biotechnol Bioeng. 1996;49:151–160. doi: 10.1002/(SICI)1097-0290(19960120)49:2<151::AID-BIT4>3.0.CO;2-P. [DOI] [PubMed] [Google Scholar]
  • 40.Tsai P S, Rao G, Bailey J E. Improvement of Escherichia coli microaerobic oxygen metabolism by Vitreoscilla hemoglobin: new insights from NAD(P)H fluorescence and culture redox potential. Biotechnol Bioeng. 1995;47:347–354. doi: 10.1002/bit.260470309. [DOI] [PubMed] [Google Scholar]
  • 41.Tyree B, Webster D A. The binding of cyanide and carbon monoxide to cytochrome o purified from Vitreoscilla. J Biol Chem. 1978;253:6988–6991. [PubMed] [Google Scholar]
  • 42.Unden G, Schirawski J. The oxygen-responsive transcriptional regulator FNR of Escherichia coli: the search for signals and reactions. Mol Microbiol. 1997;25:205–210. doi: 10.1046/j.1365-2958.1997.4731841.x. [DOI] [PubMed] [Google Scholar]
  • 43.Vasudevan S G, Armarego W L F, Shaw D C, Lilley P E, Dixon N E, Poole R K. Isolation and nucleotide sequence of the hmp gene that encodes a haemoglobin-like protein in Escherichia coli K-12. Mol Gen Genet. 1991;226:49–58. doi: 10.1007/BF00273586. [DOI] [PubMed] [Google Scholar]
  • 44.Wakabayashi S, Matsubara H, Webster D A. Primary sequence of a dimeric bacterial haemoglobin from Vitreoscilla. Nature. 1986;322:481–483. doi: 10.1038/322481a0. [DOI] [PubMed] [Google Scholar]
  • 45.Webster D A. Structure and function of bacterial hemoglobin and related proteins. Adv Inorg Biochem. 1988;7:245–265. [PubMed] [Google Scholar]
  • 46.Webster D A, Liu C Y. Reduced nicotinamide adenine dinucleotide cytochrome o reductase associated with cytochrome o purified in Vitreoscilla. J Biol Chem. 1974;249:4257–4260. [PubMed] [Google Scholar]
  • 47.Weickert M J, Doherty D H, Best E A, Olins P O. Optimization of heterologous protein production in Escherichia coli. Curr Opin Biotechnol. 1996;7:494–499. doi: 10.1016/s0958-1669(96)80051-6. [DOI] [PubMed] [Google Scholar]
  • 48.Weihs V, Schmidt K, Schneider B, Friedrich B. The formation of an oxygen-binding flavohemoprotein in Alcaligenes eutrophus is plasmid-determined. Arch Microbiol. 1989;151:546–550. [Google Scholar]
  • 49.Wittenberg J B, Wittenberg B A. Mechanisms of cytoplasmic hemoglobin and myoglobin function. Annu Rev Biophys Chem. 1990;19:217–241. doi: 10.1146/annurev.bb.19.060190.001245. [DOI] [PubMed] [Google Scholar]
  • 50.Yanisch-Perron C, Vieira J, Messing J. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene. 1985;33:103–119. doi: 10.1016/0378-1119(85)90120-9. [DOI] [PubMed] [Google Scholar]
  • 51.Zhu H, Riggs A F. Yeast flavohemoglobin is an ancient protein related to globins and a reductase family. Proc Natl Acad Sci USA. 1992;89:5015–5019. doi: 10.1073/pnas.89.11.5015. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES