Skip to main content
Stem Cells logoLink to Stem Cells
. 2022 Jan 24;40(2):204–214. doi: 10.1093/stmcls/sxab016

CTGF-D4 Amplifies LRP6 Signaling to Promote Grafts of Adult Epicardial-derived Cells That Improve Cardiac Function After Myocardial Infarction

Krithika S Rao 1,2, Jessica E Kloppenburg 1, Taylor Marquis 1, Laura Solomon 1, Keara L McElroy-Yaggy 1,2, Jeffrey L Spees 1,2,
PMCID: PMC9199845  PMID: 35257185

Abstract

Transplantation of stem/progenitor cells holds promise for cardiac regeneration in patients with myocardial infarction (MI). Currently, however, low cell survival and engraftment after transplantation present a major barrier to many forms of cell therapy. One issue is that ligands, receptors, and signaling pathways that promote graft success remain poorly understood. Here, we prospectively isolate uncommitted epicardial cells from the adult heart surface by CD104 (β-4 integrin) and demonstrate that C-terminal peptide from connective tissue growth factor (CTGF-D4), when combined with insulin, effectively primes epicardial-derived cells (EPDC) for cardiac engraftment after MI. Similar to native epicardial derivatives that arise from epicardial EMT at the heart surface, the grafted cells migrated into injured myocardial tissue in a rat model of MI with reperfusion. By echocardiography, at 1 month after MI, we observed significant improvement in cardiac function for animals that received epicardial cells primed with CTGF-D4/insulin compared with those that received vehicle-primed (control) cells. In the presence of insulin, CTGF-D4 treatment significantly increased the phosphorylation of Wnt co-receptor LRP6 on EPDC. Competitive engraftment assays and neutralizing/blocking studies showed that LRP6 was required for EPDC engraftment after transplantation. Our results identify LRP6 as a key target for increasing EPDC engraftment after MI and suggest amplification of LRP6 signaling with CTGF-D4/insulin, or by other means, may provide an effective approach for achieving successful cellular grafts in regenerative medicine.

Keywords: CTGF, LRP6, epicardial, cardiac, myocardial infarction

Graphical Abstract

Graphical Abstract.

Graphical Abstract


Significance Statement.

Low engraftment and survival of transplanted cells is a problem for many forms of cell therapy. Studying primary cardiac epicardial cells (EPDC), we determined that a brief incubation (i.e., priming) with a combination of CTGF-D4 and insulin significantly increased the engraftment of EPDC in the context of myocardial infarction. Furthermore, the grafted cells were competent to migrate and improved cardiac function after 1 month. In the presence of insulin, CTGF-D4 amplified LRP6 signaling, which was required to successfully graft EPDC to the heart. Stimulation of LRP6 may provide a general strategy to improve graft success with reparative cells.

Introduction

The limited endogenous regenerative capacity of the adult mammalian heart has prompted substantial investment and effort into the development of cell-based therapies for acute myocardial infarction (MI).1,2 The ability to provide robust, persistent cell grafts in a predictable manner is highly desirable and may promote cardiac regeneration. To date, however, despite numerous animal studies and human trials aimed at treating MI and heart failure through direct cardiac cell replacement, clinical use of many promising cell types remains hampered by low levels of cell survival, engraftment, and differentiation following transplantation.

Epicardial cells and their derivatives are receiving increasing attention as promising cells for cardiac repair after injury.3-11 Adult epicardial cells that reside on the heart surface are multipotent and undergo proliferation and epithelial-to-mesenchymal transformation (EMT) after MI; this results in subepicardial thickening in areas adjacent to myocardial tissue with infarction.3,6 Epicardial-derived cardiac precursor cells migrate from the subepicardium into the injured myocardium and participate in myocardial repair and remodeling.12-15 Multiple signaling factors such as retinoic acid, FGF, Wnt, and FSTL-1 have been shown to regulate the activities of epicardial cells during development.16-18 In contrast, for adults with cardiac injury, extrinsic factors that regulate epicardial cell behavior and/or functions are poorly understood.

We and others have shown that mixed cultures of adherent human epicardial cells and epicardial-derived cells (EPDC) can be isolated from right atrial appendages commonly removed during cardiac bypass surgery.19,20 With more than 650 000 bypass surgeries performed in the US on an annual basis, obtaining atrial tissue from consenting bypass patients for cell isolation is possible at most medical centers and teaching hospitals. Thus, there is exciting potential to build banks of donor EPDC to provide MHC-matched cells for patients with cardiac disease or injury.

Winter et al reported intra-myocardial transplantation of human EPDC significantly improved cardiac function in immune-deficient mice with MI, despite finding low levels of long-term cell engraftment.19 To provide safe, effective, and predictable outcomes in cardiac patients that may be treated with autologous or heterologous EPDC, standardized methods of epicardial cell isolation and strategies that foster long-term EPDC engraftment are needed. Previously, we reported a biologic grafting drug based on a defined combination of human connective tissue growth factor (C-terminal, fourth domain peptide; CTGF-D4) and insulin that effectively primed cells to graft at sites bordering tissue with infarction after MI.21 Here we identify CD104 as a marker for epithelial-like adult epicardial cells and use it to isolate them from mixed cardiac cell populations. Furthermore, we show that CTGF-D4/insulin promotes signaling through LRP6, a Wnt co-receptor whose function is required for graft success with EPDC after MI.

Results

CD104 Is a Marker of Adult Epicardial Cells with an Epithelial-Like Phenotype

There is growing interest in the use of epicardial cells and EPDC for regenerative medicine.22,23 To effectively harness epicardial cells and their derivatives for clinical use standardized protocols for cell isolation and preparation will be necessary. At present, however, a lack of defined cell surface epitopes unique to adult epicardial cells makes standardization of their isolation and enrichment difficult. Several studies have used gene expression of epicardial cell-associated transcription factors such as Wt1,24 Gata5,25 Tbx18,26 and Tcf2127 to genetically label and study epicardial cells in vivo. However, this approach is less useful for clinical applications due to the requirement for genetic manipulation of the organism and overlapping expression of transcription factors in downstream epicardial derivatives and non-epicardial cells.28-30 Accordingly, we sought to develop methods for direct epicardial cell isolation based on differential expression of cell surface epitopes.

Several groups have used β-4 integrin (CD104) expression to identify epithelial stem-like cells from various organs/tissues including lung, dental pulp, urothelium, and the eye.31-34 CD104 is a transmembrane glycoprotein that forms a heterodimer with alpha 6 integrin and modulates epithelial cell adhesion to the basement membrane and cell proliferation.35 By immunohistochemistry of cardiac sections, we found that CD104 was expressed specifically by the epicardium in rats, mice, and humans (Fig. 1A). Consequently, we performed magnetic-activated cell sorting (MACS) using an antibody to CD104 (Fig. 1B), to selectively purify epicardial cells away from myocytes, fibroblasts, endothelial and hematopoietic cells, as well as downstream (post-EMT) epicardial derivatives from right atrial appendage explant cultures maintained in 10% fetal bovine serum (FBS) (Supplementary Fig. S1A). CD104-isolated cells expressed markers consistent with epicardial identity.36 They were uniformly positive for epithelial keratins (intermediate filament proteins), proliferative (Ki67-positive), and expressed transcription factors such as Gata4, Wt1, Tbx18, and Tcf21 (Fig. 1C, 1D). A subset of Wt1-positive cells also expressed p63 (Supplementary Fig. S1B), a marker of activated and proliferating epithelial cells.37,38

Figure 1.

Figure 1.

CD104 identifies epicardial cells prior to EMT. (A) Immunohistochemistry for β-4 integrin (CD104) indicating epicardial-restricted expression in the adult mammalian heart. Left to right: rat, mouse, human. Scale bars represent 100 µm. (B) By cell surface phenotyping, 30% of the mixed cell population from rat atrial explants express CD104. (C) Immunocytochemical characterization of rat CD104+ cells. Isolated rat CD104+ cells are proliferative (Ki67+) and express keratins (epithelial intermediate filament proteins) and transcription factors characteristic of activated epicardial cells (GATA4, Wt1) (Inset: magnified GATA4+ nucleus). Scale bars represent 50 µm. (D) RT-PCR assays for transcription factors (Tbx18, Tcf21) and GAPDH (n = 3 donors). Abbreviations: EMT, epithelial-to-mesenchymal transformation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR, reverse transcription-polymerase chain reaction.

To examine the efficiency of sorting epicardial cells based on CD104 expression, we performed 2-hour digests of whole mouse hearts with collagenase/dispase to liberate epicardial cells. To determine enrichment, we performed CD104 MACS and plated the positive MACS fraction as well as freshly isolated cells from the original mixed population (pre-sort). Isolated cells were pooled from 5 individual mice per group (n = 3 groups). After 24 hours, we stained both cultured cell populations for Keratin 18, an intermediate filament protein specific to epicardial cells in the heart20 and 4ʹ,6-diamidino-2-phenylindole (DAPI) to mark cell nuclei (Supplementary Fig. S2A-S2C). In the absence of sorting, short-term enzymatic digestion of whole hearts yielded 82 ± 9.9% K18+/DAPI+ cells. Notably, CD104 MACS further enriched for K18+/DAPI+ cells (88 ± 10.2%, P < .05, n = 3 per group). After 3-7 days of culture in a medium containing 10% FBS, most epicardial cells isolated by cell surface CD104 underwent epithelial to mesenchymal transformation (EMT) (Supplementary Fig. S1A). Epicardial EMT was confirmed by the appearance of CD90 (a.k.a. Thy-1, Fig. 2A, 2D), a cell adhesion protein expressed during differentiation,39,40 Vimentin (mesenchymal intermediate filament protein) (Fig. 2C), and concomitant loss of CD104 (Fig. 2B). Hereafter, epicardial cells expressing Vimentin and CD90 after EMT (Fig. 2C, 2D) are referred to as epicardial-derived cells (EPDC).

Figure 2.

Figure 2.

CD104 expression is lost during epicardial cell EMT. (A) Epicardial cell EMT during 1 week in culture is characterized by gain of CD90 and loss of CD104 (B). (C) EPDC express increased Vimentin levels after EMT (3 rats) by Western blot (left) and Immunocytochemistry (right). (D) After EMT, all EPDC express CD90. Scale bar represents 100 µm. Abbreviations: EMT, epithelial-to-mesenchymal transformation; EPDC, epicardial-derived cells.

CTGF-D4 Promotes Primary EPDC Grafts to Adult Hearts with MI

With a neutralization screen, we previously identified CTGF and insulin as factors present in medium conditioned by human bone marrow progenitor cells that increased the survival of cardiac progenitor cells (CPCs) during simulated ischemia (1% oxygen with nutrient deprivation).21 Furthermore, using a permanent ligation model of MI, we demonstrated that cultured CPCs could be primed with a combination of the fourth domain of CTGF (CTGF-D4) and insulin to promote CPC engraftment.21 To reduce potential fibrotic effects mediated by other domains that interact with TGF-β (eg, domain 2), we chose to prime cells with CTGF-D4 as opposed to full-length CTGF. Notably, a prior report had shown that insulin-like growth factor (IGF-1) could enhance the engraftment and differentiation of murine embryonic stem (ES) cells when co-injected into hearts with MI.41 Whereas insulin and IGF-1 are well known to promote cell survival by signaling through pathways such as IRS-1/PI3K/Akt and Ras/Raf/ERK, the mechanism by which CTGF-D4/insulin promoted graft success was unknown, thereby prompting our investigation.

Detected by in situ hybridization at 1 week after MI, CTGF mRNA expression was reported to increase markedly in subepicardial fibroblasts bordering tissue with infarction.42 In light of the subepicardial expression pattern of CTGF-D4, we sought to determine the effect(s) of CTGF-D4 on primary adult epicardial cells and whether CTGF-D4/insulin-mediated priming could promote successful grafts with EPDC after MI. To mimic a clinical scenario in which patients are re-vascularized after acute MI, we used an MI model with a 2-hour period of myocardial ischemia followed by reperfusion (MI/R).20 To test the ability of CTGF-D4/insulin to prime EPDC, we performed MI/R surgeries in adult rats and injected DiI-labeled EPDC into 2 subepicardial sites at the time of reperfusion. We evaluated graft success at 1 week or 1 month after cell injection. In contrast to vehicle-primed cells (Fig. 3A), EPDC primed by CTGF-D4/insulin effectively grafted the subepicardium in regions bordering the infarct (Supplementary Fig. S3B), proliferated (see Ki67+ EPDCs in Supplementary Fig. S3A), and migrated into the injured myocardium (Fig. 3A, right). At 1 week after MI/R and cell injection, cell counts from selected serial cardiac tissue sections containing the highest number of DiI-labeled cells demonstrated a significant increase in EPDC engraftment for rats injected with CTGF-D4/insulin-primed EPDC as opposed to vehicle-primed EPDC (cell number from the section with highest level of engraftment: vehicle, 399 cells; CTGF-D4/insulin, 14 968 cells; P < .001, n = 4 per group; Fig. 3B). Using a permanent ligation model of MI, Zhou et al performed genetic lineage tracing/fate mapping of native epicardial cells in transgenic mice.43 For our grafting experiments, since the signal from DiI-labeling may not persist long-term due to dilution after cell proliferation, we repeated the MI/R study with male to female grafts and quantified the level of male EPDC engraftment in the left ventricular (LV) wall at the injury border zone using real-time quantitative PCR (qPCR) assays for the Y chromosome. After 1 month, we detected significantly more male DNA in female hearts that received CTGF-D4/insulin-primed EPDC compared with injections of vehicle-primed EPDC (Vehicle, 0.24 ± 0.12%; CTGF-D4/insulin, 1.18 ± 0.08%; n = 4 per group; Fig. 3C).

Figure 3.

Figure 3.

CTGF-D4 promotes EPDC grafts that improve cardiac function after MI/R. (A) Left: EPDC primed with vehicle remain at subepicardial injection site and do not migrate 1 week after MI/R and cell injection. Right: With CTGF-D4/insulin priming, transplanted DiI-positive cells (red) persist in subepicardium and migrate into myocardial tissue1 wk after MI/R. The green (FITC) channel shows tissue autofluorescence. (B) Quantification of rat EPDC engraftment 1 week after transplant by counts of DiI-labeled cells. (C) Real-time qPCR for Y chromosome to detect engraftment of male cells in female hosts, 1 month after EPDC transplantation. (D-F) Echocardiographic measures in rats 1 month after MI/R and EPDC transplant. (D) Fractional shortening (FS). (E) Ejection fraction (EF). (F) Anterior wall thickness (AWT) ratio (wall thickness in systole minus thickness in diastole) (n = 5-6 rats). A-B, Scale bars represent 50 µm. Ins, insulin. Error bars represent SD. ∗P < .05, ∗∗P < .01, ∗∗∗P < .001. Abbreviations: CTGF-D4, connective tissue growth factor (C-terminal, fourth domain peptide); EPDC, epicardial-derived cells; FITC, fluorescein isothiocyanate; qPCR, quantitative polymerase chain reaction.

By echocardiography, hemodynamic measurements 1 week after MI/R and cell transplantation were similar between the 2 groups (Supplementary Fig. S3C, S3D). However, after 1 month we observed an improvement in cardiac function for animals grafted with CTGF-D4/insulin-primed cells. LV fractional shortening (FS), ejection fraction (EF) and the difference in anterior wall thickness (AWT) ratio for systole (S) and diastole (D) were greater in animals treated with CTGF-D4/insulin-primed cells compared with controls (FS; sham, 38.65% ± 3.21%, vehicle, 30.34 ± 5.39%; CTGF-D4/insulin, 40.81 ± 7.77%; one-way analysis of variance (ANOVA), P < .05; EF; sham, 73.02 ± 7.16%, vehicle, 59.62 ± 6.08%, CTGF-D4/insulin, 71.91 ± 5.33%; one-way ANOVA, P < .05; AWT (S-D), sham, 0.29 ± 0.04, vehicle, 0.19 ± 0.03, CTGF-D4/insulin 0.274 ± 0.031; one-way ANOVA, P < .05; Fig. 3D-3F).

LRP6 Regulates EPDC Differentiation and Survival

CTGF-D4 has been shown to interact with integrins and multiple cell surface receptors, including TrkA, EGFR, FGFR2, LRP1, and LRP6 (Fig. 4A).14,44-49 Exposure of EPDC to CTGF-D4 led to increased expression of CD90 and other differentiation markers such as alpha-smooth muscle actin (α-SMA, smooth muscle cells, and myofibroblasts) (Fig. 4B). Notably, prior incubation of EPDC in neutralizing antibodies against LRP6 reduced the differentiating effects of treatment with CTGF-D4 (Fig. 4B).

Figure 4.

Figure 4.

LRP6 signaling promotes differentiation and survival of primary epicardial cells. (A) CTGF has 4 distinct domains that interact with other cell ligands, cell surface receptors, and integrins. CTGF binds LRP6 through its C-terminal, fourth domain (CTGF-D4). (B) Treatment with CTGF-D4 promotes adult rat EPDC differentiation in an LRP6-dependent manner. Immunoblots: CD90 (cell adhesion, differentiation), α-SMA (smooth muscle cells and myofibroblasts). (C) (Left) Exposure of primary rat EPDC to CTGF-D4 increased cell survival during hypoxia (1% oxygen, 48 hours); this protective effect was removed by neutralizing antisera to LRP6 (n = 3). (Right) Exposure of primary rat EPDC to the LRP6 ligand DKK1 prior to treatment with CTGF-D4 prevented CTGF-D4 mediated cell protection under hypoxia (n = 3). ∗P < .05, SFM, serum-free medium. Abbreviations: CTGF-D4, connective tissue growth factor (C-terminal, fourth domain peptide); EPDC, epicardial-derived cells; SFM, serum-free medium; α-SMA, alpha-smooth muscle actin.

We next examined whether LRP6 signaling affected EPDC survival. Under conditions of simulated ischemia, blocking antibody to both Wnt co-receptors (LRP5/6) significantly diminished the protective effects of CTGF-D4. Notably, antibody specific to LRP6 alone had the same effect (Fig. 4C). Furthermore, incubation with DKK1, an LRP6-specific ligand, abolished CTGF-D4-mediated protection of EPDC (Fig. 4C). These results demonstrated that LRP6 regulated EPDC differentiation and survival and suggested that CTGF-D4 may interact with LRP6 or DKK1. β-Catenin (Wnt pathway) is important for LRP6 signaling and required for epicardial EMT and coronary artery formation during development.16 Since blockade of LRP6 removed the effects of CTGF-D4 on EPDC differentiation and survival, we performed 3 separate tests to determine whether CTGF-D4 signaled like a canonical Wnt ligand (eg, Wnt3a): (1) subcellular localization of β-catenin by immunocytochemistry to detect nuclear accumulation after CTGF-D4 treatment, (2) blotting assays to detect changes in the phosphorylation of GSK3-β after CTGF-D4 treatment, and (3) β-galactosidase activity assay with EPDCs isolated from β-catenin reporter transgenic mice (a.k.a. BAT-gal reporter mice). By immunocytochemistry, epicardial cells isolated by CD104MACS (epithelial-like) that were cultured for 24-48 hours exhibited a nuclear expression pattern for β-catenin (Supplementary Fig. S4A). However, following EMT, EPDC displayed a mosaic pattern of β-catenin expression, with cells expressing varying levels of cytoplasmic and nuclear β-catenin. Notably, exposure of EPDC to CTGF-D4 did not result in the nuclear accumulation of β-catenin (Supplementary Fig. S4A). Furthermore, by immunoblotting assays, we observed no change in the level of GSK3-β phosphorylation after exposure of EPDC to CTGF-D4 (Supplementary Fig. S4B). To examine the effects of CTGF-D4 treatment on β-catenin-dependent transcriptional activation, we isolated EPDC from wild-type and BAT-gal reporter mice. Following treatment with CTGF-D4, we observed no change in BAT-gal activity (Supplementary Fig. S4C). Thus, by these assays, CTGF-D4 alone did not act like a canonical Wnt ligand on adult EPDCs.

CTGF-D4 Amplifies LRP6 Signaling in the Presence of Insulin or DKK1

Previously, we reported a synergistic, protective effect of CTGF-D4 and insulin on human cell survival.21 To determine the effect(s) of CTGF-D4 and insulin on activation of LRP6 signaling, we performed LRP6 phosphorylation assays on primary human EPDC isolated from right atrial appendages of patients with cardiac bypass surgery.20 After 24 hours of exposure, CTGF-D4 alone did not affect pLRP6 levels in human EPDC relative to vehicle-treated control EPDC (Fig. 5A, 5C). However, in the presence of insulin, CTGF-D4 significantly increased the level of pLRP6 compared with that in vehicle-treated control cells (Fig. 5B, 5D). Of interest, during co-incubation with DKK1, CTGF-D4 treatment also significantly increased LRP6 phosphorylation. Notably, however, this effect was observed only in the absence of insulin (Fig. 5A, 5B).

Figure 5.

Figure 5.

CTGF-D4 increases phosphorylation of LRP6 in the presence of insulin or DKK1. (A, B) Immunoblots of human EPDC exposed to CTGF-D4 for 24 hours in the absence (A) or presence of insulin (B). (C, D) Quantitation of protein bands. Note that CTGF-D4 (40 ng/mL) alone does not affect LRP6 activity. However, in the presence of insulin (100 ng/mL) or DKK1 (100 ng/ml), CTGF-D4 significantly increases phosphorylation of LRP6 (n = 3 human donors). Control: vehicle (DMEM/F12 medium with 1% BSA). One-way ANOVA. ∗P < .05, ∗∗P < .01. Abbreviations: ANOVA, analysis of variance; BSA, bovine serum albumin; CTGF-D4, connective tissue growth factor (C-terminal, fourth domain peptide); DMEM, Dulbecco’s modified Eagle’s medium; EPDC, epicardial-derived cells.

LRP6 Signaling Is Required for EPDC Engraftment Following Transplantation

To test the hypothesis that CTGF-D4 signals through LRP6 to promote EPDC graft success after MI, we developed a competitive dual engraftment assay using equal portions of EPDCs labeled by green or red dyes, respectively, with 1 population incubated with anti-LRP6 and the other with nonspecific, control IgG (Fig. 6A, for details, see Supplemental Experimental Procedures). At 1 week following MI/R and cell transplantation, we observed a significant reduction in the grafting efficiency of EPDC when blocked by anti-LRP6 (Fig. 6B). To control for the process of dye labeling, we performed reciprocal dye labeling of EPDC and repeated the competitive dual engraftment experiment (Fig. 6B’). At 1 week following MI/R and cell transplantation, we observed a significant reduction in the grafting efficiency of EPDC when blocked by antibodies specific to LRP6 (number of cells from both reciprocal dye labeling in section with highest level of engraftment: Control IgG, 32 172 cells; anti-LRP6, 4034; P < .01; Fig. 6C, n = 6). Finally, to confirm the results from the competitive engraftment assay, we carried out EPDC transplants from male donors to female hosts. At 1 month after MI/R and EPDC transplantation, compared with cells incubated in control IgG, assays of genomic DNA isolated from the LV wall containing the border zone of infarction revealed a significant decrease in EPDC engraftment when LRP6 was blocked (qPCR for Y chromosome: Control IgG, 0.58 ± 0.11% male DNA; anti-LRP6, 0.16 ± 0.14% male DNA; P = .016, n = 3 per group; Fig. 6D).

Figure 6.

Figure 6.

LRP6 function is required for successful EPDC grafts. (A) Design for LRP6 neutralization experiment to assay requirement of LRP6 during EPDC engraftment after MI/R in adult rats. Cultured EPDC from the same donor/dish were lifted, split, and separately dye-labeled prior to incubation with blocking antisera (anti-Lrp6) and CTGF-D4 or nonspecific IgG (con IgG) and CTGF-D4. Note: Cells were incubated with antibodies prior to CTGF-D4. Equal proportions of EPDC were mixed and grafted together in a competitive engraftment assay. (B-B’) Representative tissue sections 1 week after MI/R and cell transplantation in adult rats. (B’) Cell control with reciprocal dye labeling. (C) EPDC counts after 1 week of engraftment. (D) qPCR data for Y chromosome at 1 month after engraftment. Error bars represent SD. Student t test. ∗P < .05, ∗∗P < .01. Scale bar represents 100 µm. Abbreviations: CTGF-D4, connective tissue growth factor (C-terminal, fourth domain peptide); EPDC, epicardial-derived cells; qPCR, quantitative polymerase chain reaction.

Discussion

Here we identified LRP6 as a target of CTGF-D4/insulin priming in EPDC and demonstrated that LRP6 signaling increases EPDC engraftment after acute MI. Results from our grafting studies in adult rats showed that CTGF-D4/insulin-primed EPDCs engrafted subepicardial sites adjacent to myocardial tissue with infarction, migrated to areas with injury, persisted for at least 1 month, and significantly improved cardiac function. By contrast, we observed minimal engraftment of vehicle-primed EPDCs that were transplanted in the same manner. Notably, rare vehicle-primed cells that engrafted the subepicardium after MI/IR surgery failed to migrate into injured myocardial tissue and did not benefit cardiac function. Also, we observed little to no EPDC engraftment in uninjured animals or in subepicardial regions distal to injury; these observations suggest EPDCs primed with CTGF-D4/insulin receive additional cues from the injury environment. In support of this concept, endogenous CTGF expression is low or absent in healthy, uninjured myocardial tissue, but is rapidly induced in border zone myocardium early after MI.50-52

In assays of cultured primary cells, we found that incubation of rat EPDC with CTGF-D4 alone did not alter β-catenin localization or transcriptional activity in a manner congruent with canonical Wnt signaling. Furthermore, incubation of human EPDC with CTGF alone did not activate LRP6 as expected for a canonical Wnt agonist such as Wnt3. By contrast, in the presence of insulin, CTGF-D4 significantly increased phosphorylation of LRP6, consistent with activation of the canonical Wnt pathway. While CTGF-D4 may have bound directly to LRP6, the combined effects of CTGF-D4 and insulin on EPDC suggest CTGF-D4 may facilitate interaction and/or co-activation of IR and LRP6. Notably, as phosphorylation of LRP6 and GSK3β was reported for kidney mesangial cells (ie, mesenchymal) that were treated only with CTGF,53 it remains possible that CTGF-D4 could activate LRP6 by itself at concentrations and/or exposure times differing from those used in our study.

In binding assays carried out with receptor mutants, Mercurio et al found that CTGF-D4 bound EGF repeats 1, 2 as well as EGF repeats 3, 4 on LRP6.49 In murine kidney pericytes exposed to CTGF-D4, co-immunoprecipitation assays with anti-pLRP6 or anti-CTGF demonstrated a direct interaction between CTGF-D4 and activated LRP6.54 Notably, however, subsequent binding assays performed by the same group with various domains of recombinant CTGF and soluble LRP6-Fc indicated only weak affinity between pure CTGF-D4 and LRP6.54 The contrasting results for CTGF-D4/LRP6 binding may be explained by the presence or absence of other factors that alter the biochemical association of CTGF-D4 with LRP6.

To amplify phosphorylation of LRP6 in EPDC, it is possible that CTGF-D4 altered the ability of LRP6 to bind canonical Wnt signaling ligands, such as Wnt3a or DKK1. Alternatively, CTGF may affect the interaction of LRP6 with atypical ligands or receptors such as insulin or IR. This second hypothesis is supported by the observed co-activation between other receptor kinases and LRP6. By co-immunoprecipitation assays, Ren et al found that PDGF receptor β and TGF-β receptor 1 could each rapidly associate with LRP6 in the presence of their respective ligands.14 Also, CTGF enhanced the binding of PDGF/PDGF receptor β and, similarly, TGF-β/TGF-βR1.55,56 For cardiac myocytes, CTGF was shown to protect against hypoxic and oxidative stress by activating the PI3-kinase/Akt/GSK-3β-signaling pathway.57 Of relevance here, this axis links IR/IGFR activation to β-catenin mediated effects on gene transcription. In a liver cell line (HEPG2), Desbois-Mouthon et al showed that insulin and IGF-1 signaled through GSK3β and/or Ras. These signaling events, in turn, led to β-catenin-mediated transcriptional activation of TCF/LEF.58

Crosstalk between LRP6 and IR/IGFR regulates glucose metabolism,59 and mutations in Wnt5a and LRP affect cardiovascular development and disease. For example, a rare mutation in LRP6 (R611C) is associated with type II diabetes, metabolic syndrome, and early-onset coronary disease.60 Healthy, non-diabetic individuals bearing this mutation are hyperinsulinemic, insulin resistant, and have reduced expression levels of IR and IGFR. Wnt/LRP6 was shown to regulate IR transcription in a TCF7L-dependant manner.61

CTGF-D4/insulin/LRP6 signaling may also affect members of the Hippo pathway. Signaling through Hippo pathway kinases limits cell proliferation and determines organ size by modifying the localization and/or function of downstream effectors such as Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ). Mitogens that inhibit the Hippo pathway, such as EGF, promote nuclear translocation of YAP by signaling through PI3K/PDK1.62 YAP controls cardiac myocyte proliferation and embryonic heart growth by regulating β-catenin levels and the IGF signaling pathway.63 Similarly, TAZ was shown to control the transcription of insulin receptor substrate 1 (IRS) and insulin sensitivity in a Wnt-dependent manner.64 As CTGF is also an important transcriptional target of YAP, CTGF-D4/insulin/LRP6 signaling may benefit EPDC graft success, in part, by increasing expression and secretion of CTGF itself through a feed-forward mechanism.

The promising engraftment results achieved here with primary cells in a clinically relevant animal model of MI suggest priming strategies with CTGF-D4/insulin or other agents that induce or amplify LRP6 signaling may provide an effective means to achieve reparative cell grafts in patients with cardiac injury. Because most cell types and adult stem/progenitor cells express the insulin receptor and multiple integrins and receptors that interact with CTGF-D4, CTGF-D4/insulin-mediated priming may promote graft success for many other reparative cell types such as human adult multipotent stromal cells and cardiac-specified progenitors or derivatives from human ES cells. In cases where reparative cells are not available for patients, it is possible that administration of recombinant CTGF-D4 or CTGF-D4/insulin to areas bordering tissue with infarction may enhance the activity of native epicardial cells to improve cardiac regeneration after MI.

Materials and Methods

Isolation and Characterization of Adult EPDC

All animal studies and procedures were reviewed and approved by the University of Vermont Institutional Animal Care and Use Committee. Rat atrial explants were cultured in a complete culture medium with 10% FBS (10% CCM). After 48 hours, primary epicardial cells were isolated by MACS using antibody specific to CD104. Sorted CD104+ cells were cultured on fibronectin-coated glass coverslips for expansion and characterization. Primary murine epicardial cells were isolated by collagenase/dispase digestion of whole hearts for 2 hours to liberate cells from the heart surface, followed by CD104 MACS. With an IRB-approved protocol, and patient consent in accordance with the Declaration of Helsinki, human EPDC were isolated from right atrial biopsies and cultured as reported previously.20 For detailed information, please refer to Supplemental Experimental Procedures.

EPDC Priming for Graft Studies

EPDCs were cultured in 10% CCM. Cells were trypsinized and centrifuged at 1000g for 8 minutes. After re-suspension in 1× phosphate-buffered saline (PBS), EPDCs were filtered to create a single-cell suspension (40-micron cell strainer, Thermo Fisher Scientific). EPDC were incubated in cell tracker dyes CMFDA (green, 50 µg/mL) or CMPTX (red, 50 µg/mL) (Thermo Fisher Scientific) for 30 minutes at 37°C. To remove excess dye, EPDC were washed and centrifuged 3 times at 800g. Cells were counted by hemocytometer, centrifuged, and re-suspended for priming in: α-MEM, α-MEM with 1% bovine serum albumin (BSA), or α-MEM with 1% BSA and CTGF-D4/insulin (40 ng/mL each). Dye-labeled EPDC were primed for 30 minutes on ice prior to subepicardial injection. Recombinant human CTGF-D4 (C terminus, 98 a.a.) was purchased from Peprotech. Recombinant human insulin was obtained from Sigma.

Myocardial Infarction and Ischemia/Reperfusion Surgery

All animal work was approved by the University of Vermont College of Medicine’s Office of Animal Care in accordance with the American Association for Accreditation of Laboratory Animal Care and National Institutes of Health guidelines. Adult Fischer rats underwent intubation and experimental open-chested MI/R surgery as previously described.20 Surgery was followed by injection of primary EPDC, recovery, and echocardiography at 1 week or 1 month prior to euthanization.

Quantitative Real-Time qPCR for Y Chromosome

The experiment was performed as previously described.65 Rat genomic DNA was isolated from homogenates of the ischemic border zone by extraction with SDS/proteinase K and Tris-buffered phenol at pH 8.0. DNA yield and purity were verified by spectrophotometer. We used 500 ng of template genomic DNA per reaction. The DNA was used as a template in real-time qPCR assays for the rat Y chromosome with an automated instrument (ABI Prism 7700 sequence detection system, Applied Biosystems). Taqman PCR master mix was used to perform qPCR reactions (ABI Perkin Elmer). Y chromosome probe (5ʹ-FAM CAA CAGAATCCCAGCATGCAGAATTCA 3ʹ-TAMRA) was used at 250 nM and each primer was used at 900 nM (forward, 5ʹ GGAGAGAGGCACAAGTTGGC 3ʹ; reverse, 5ʹ CCCCAGCTGCTTGCTGATC 3ʹ; Integrated DNA Technologies, Coralville, IA, USA). Standard curves of male DNA were generated by combining 450-0.005 ng of male DNA with 50-499.995 ng of female DNA. Each sample was run in triplicate. The Ct values from the standard curve were used to determine the percentage (%) of Y chromosome DNA in the sample.65

Immunocytochemistry and Immunohistochemistry

Isolated cells or heart tissue was dissected and fixed in 4% paraformaldehyde overnight. Tissue was equilibrated in 30% sucrose for cryo-sectioning. For histology, hearts were cut into 20 µm serial sections. Please refer to Supplemental Experimental Procedures for detailed information and a complete list of antibodies.

Statistical Analysis

Individual groups were compared by the Student’s t test (unpaired). Multiple comparisons were made by one-way ANOVA with Tukey’s post hoc testing. P values of less than .05 were considered significant.

Supplementary Material

sxab016_suppl_Supplementary_Material

Acknowledgments

We thank Roxana del Rio-Guerra, PhD, CCy in the Harry Hood Bassett Flow Cytometry and Cell Sorting (FCCS) Facility at the University of Vermont, Burlington for assistance with flow cytometry and FACS; David J. Schneider, MD, for assistance with echocardiography; Matthew LeComte, MD, PhD, and Thomas Jetton, PhD, for assistance with real-time qPCR; and Alexander Aronshtam, PhD, for technical support. The graphical abstract was created with Biorender.com.

Funding

This work was supported, in part, by National Institutes of Health (NIH) grants HL085210, NS073815, and HL132264 (to J.L.S.). Additional support was provided by the Cardiovascular Research Institute of Vermont (CVRI-VT) and a SPARK-VT award from the Department of Medicine, University of Vermont.

Conflict of Interest

J.L.S. holds patents in regard to human epicardial progenitor cells and is co-founder of Samba BioLogics, Inc. All of the other authors declared no potential conflicts of interest.

Author Contributions

K.S.R. and J.L.S. designed the research, performed the experiments, analyzed and interpreted data, and wrote the paper; K.L.M.Y. performed the experiments; L.S., J.E.K., and T.M. performed experimental assays.

Data Availability

The data underlying this article will be shared on reasonable request to the corresponding author.

References

  • 1. Laflamme MA, Murry CE.. Heart regeneration. Nature. 2011;473:326-335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Wadugu B, Kuhn B.. The role of neuregulin/ErbB2/ErbB4 signaling in the heart with special focus on effects on cardiomyocyte proliferation. Am J Physiol Heart Circ Physiol. 2012;302:H2139-H2147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Smart N, Dube KN, Riley PR.. Epicardial progenitor cells in cardiac regeneration and neovascularisation. Vascul Pharmacol. 2013;58:164-173. [DOI] [PubMed] [Google Scholar]
  • 4. Ruiz-Villalba A, Simon AM, Pogontke C, et al. Interacting resident epicardium-derived fibroblasts and recruited bone marrow cells form myocardial infarction scar. J Am Coll Cardiol. 2015;65:2057-2066. [DOI] [PubMed] [Google Scholar]
  • 5. Riley PR. An epicardial floor plan for building and rebuilding the mammalian heart. Curr Top Dev Biol. 2012;100:233-251. [DOI] [PubMed] [Google Scholar]
  • 6. Gonzalez-Rosa JM, Peralta M, Mercader N.. Pan-epicardial lineage tracing reveals that epicardium derived cells give rise to myofibroblasts and perivascular cells during zebrafish heart regeneration. Dev Biol. 2012;370:173-186. [DOI] [PubMed] [Google Scholar]
  • 7. Bollini S, Vieira JM, Howard S, et al. Re-activated adult epicardial progenitor cells are a heterogeneous population molecularly distinct from their embryonic counterparts. Stem Cells Dev. 2014;23:1719-1730. [DOI] [PubMed] [Google Scholar]
  • 8. Gittenberger-de Groot AC, Winter EM, Poelmann RE.. Epicardium-derived cells (EPDCs) in development, cardiac disease and repair of ischemia. J Cell Mol Med. 2010;14:1056-1060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Gittenberger-de Groot AC, Winter EM, Bartelings MM, et al. The arterial and cardiac epicardium in development, disease and repair. Differentiation. 2012;84:41-53. [DOI] [PubMed] [Google Scholar]
  • 10. Braitsch CM, Kanisicak O, van Berlo JH, et al. Differential expression of embryonic epicardial progenitor markers and localization of cardiac fibrosis in adult ischemic injury and hypertensive heart disease. J Mol Cell Cardiol. 2013;65:108-119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Singh MK, Epstein JA.. Epicardium-derived cardiac mesenchymal stem cells: expanding the outer limit of heart repair. Circ Res. 2012;110:904-906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Zhou B, Pu WT.. Epicardial epithelial-to-mesenchymal transition in injured heart. J Cell Mol Med. 2011;15:2781-2783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. van Wijk B, Gunst QD, Moorman AF, et al. Cardiac regeneration from activated epicardium. PLoS One. 2012;7:e44692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Ren S, Johnson BG, Kida Y, et al. LRP-6 is a coreceptor for multiple fibrogenic signaling pathways in pericytes and myofibroblasts that are inhibited by DKK-1. Proc Natl Acad Sci USA. 2013;110:1440-1445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Duan J, Gherghe C, Liu D, et al. Wnt1/βcatenin injury response activates the epicardium and cardiac fibroblasts to promote cardiac repair. EMBO J. 2012;31:429-442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Zamora M, Manner J, Ruiz-Lozano P.. Epicardium-derived progenitor cells require β-catenin for coronary artery formation. Proc Natl Acad Sci USA. 2007;104:18109-18114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Vega-Hernandez M, Kovacs A, De Langhe S, et al. FGF10/FGFR2b signaling is essential for cardiac fibroblast development and growth of the myocardium. Development. 2011;138:3331-3340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Rentschler S, Epstein JA.. Kicking the epicardium up a notch. Circ Res. 2011;108:6-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Winter EM, Grauss RW, Hogers B, et al. Preservation of left ventricular function and attenuation of remodeling after transplantation of human epicardium-derived cells into the infarcted mouse heart. Circulation. 2007;116:917-927. [DOI] [PubMed] [Google Scholar]
  • 20. Rao KS, Aronshtam A, McElory-Yaggy KL, et al. Human epicardial cell-conditioned medium contains HGF/IgG complexes that phosphorylate RYK and protect against vascular injury. Cardiovasc Res. 2015;107:277-286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Iso Y, Rao KS, Poole CN, et al. Priming with ligands secreted by human stromal progenitor cells promotes grafts of cardiac stem/progenitor cells after myocardial infarction. Stem Cells. 2014;32:674-683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Vieira JM, Riley PR.. Epicardium-derived cells: a new source of regenerative capacity. Heart. 2011;97:15-19. [DOI] [PubMed] [Google Scholar]
  • 23. van Berlo JH, Molkentin JD.. An emerging consensus on cardiac regeneration. Nat Med. 2014;20:1386-1393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Zhou B, Ma Q, Rajagopal S, et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 2008;454:109-113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Merki E, Zamora M, Raya A, et al. Epicardial retinoid X receptor α is required for myocardial growth and coronary artery formation. Proc Natl Acad Sci USA. 2005;102:18455-18460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Cai CL, Martin JC, Sun Y, et al. A myocardial lineage derives from Tbx18 epicardial cells. Nature. 2008;454:104-108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Acharya A, Baek ST, Banfi S, et al. Efficient inducible Cre-mediated recombination in Tcf21 cell lineages in the heart and kidney. Genesis. 2011;49:870-877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Wagner N, Michiels JF, Schedl A, et al. The Wilms’ tumour suppressor WT1 is involved in endothelial cell proliferation and migration: expression in tumour vessels in vivo. Oncogene. 2008;27:3662-3672. [DOI] [PubMed] [Google Scholar]
  • 29. Kikuchi K, Gupta V, Wang J, et al. tcf21+ epicardial cells adopt non-myocardial fates during zebrafish heart development and regeneration. Development. 2011;138:2895-2902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Ali SR, Ranjbarvaziri S, Talkhabi M, et al. Developmental heterogeneity of cardiac fibroblasts does not predict pathological proliferation and activation. Circ Res. 2014;115:625-635. [DOI] [PubMed] [Google Scholar]
  • 31. Pajoohesh-Ganji A, Pal-Ghosh S, Simmens SJ, et al. Integrins in slow-cycling corneal epithelial cells at the limbus in the mouse. Stem Cells. 2006;24:1075-1086. [DOI] [PubMed] [Google Scholar]
  • 32. McQualter JL, Yuen K, Williams B, et al. Evidence of an epithelial stem/progenitor cell hierarchy in the adult mouse lung. Proc Natl Acad Sci USA. 2010;107:1414-1419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Kurzrock EA, Lieu DK, Degraffenried LA, et al. Label-retaining cells of the bladder: candidate urothelial stem cells. Am J Physiol Renal Physiol. 2008;294:F1415-F1421. [DOI] [PubMed] [Google Scholar]
  • 34. Chapman HA, Li X, Alexander JP, et al. Integrin α6β4 identifies an adult distal lung epithelial population with regenerative potential in mice. J Clin Invest. 2011;121:2855-2862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Kajiji S, Tamura RN, Quaranta V.. A novel integrin (alpha E beta 4) from human epithelial cells suggests a fourth family of integrin adhesion receptors. EMBO J. 1989;8:673-680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Bochmann L, Sarathchandra P, Mori F, et al. Revealing new mouse epicardial cell markers through transcriptomics. PLoS One. 2010;5:e11429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Senoo M, Pinto F, Crum CP, et al. p63 is essential for the proliferative potential of stem cells in stratified epithelia. Cell. 2007;129:523-536. [DOI] [PubMed] [Google Scholar]
  • 38. McKeon F. p63 and the epithelial stem cell: more than status quo? Genes Dev. 2004;18:465-469. [DOI] [PubMed] [Google Scholar]
  • 39. Lennon VA, Unger M, Dulbecco R.. Thy-1: a differentiation marker of potential mammary myoepithelial cells in vitro. Proc Natl Acad Sci USA. 1978;75:6093-6097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Bakondi B, Shimada IS, Perry A, et al. CD133 identifies a human bone marrow stem/progenitor cell subpopulation with a repertoire of secreted factors that protect against stroke. Mol Ther. 2009;17:1938-1947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Kofidis T, de Bruin JL, Yamane T, et al. Insulin-like growth factor promotes engraftment, differentiation, and functional improvement after transfer of embryonic stem cells for myocardial restoration. Stem Cells. 2004;22:1239-1245. [DOI] [PubMed] [Google Scholar]
  • 42. Chuva de Sousa Lopes SM, Feijen A, Korving J, et al. Connective tissue growth factor expression and Smad signaling during mouse heart development and myocardial infarction. Dev Dyn. 2004;231:542-550. [DOI] [PubMed] [Google Scholar]
  • 43. Zhou B, Honor LB, He H, et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 2011;121:1894-1904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Wahab NA, Weston BS, Mason RM.. Connective tissue growth factor CCN2 interacts with and activates the tyrosine kinase receptor TrkA. J Am Soc Nephrol. 2005;16:340-351. [DOI] [PubMed] [Google Scholar]
  • 45. Rayego-Mateos S, Rodrigues-Díez R, Morgado-Pascual JL, et al. Connective tissue growth factor is a new ligand of epidermal growth factor receptor. J Mol Cell Biol. 2013;5:323-335. [DOI] [PubMed] [Google Scholar]
  • 46. Aoyama E, Kubota S, Takigawa M.. CCN2/CTGF binds to fibroblast growth factor receptor 2 and modulates its signaling. FEBS Lett. 2012;586:4270-4275. [DOI] [PubMed] [Google Scholar]
  • 47. Segarini PR, Nesbitt JE, Li D, et al. The low density lipoprotein receptor-related protein/α2-macroglobulin receptor is a receptor for connective tissue growth factor. J Biol Chem. 2001;276:40659-40667. [DOI] [PubMed] [Google Scholar]
  • 48. Kawata K, Kubota S, Eguchi T, et al. Role of LRP1 in transport of CCN2 protein in chondrocytes. J Cell Sci. 2012;125:2965-2972. [DOI] [PubMed] [Google Scholar]
  • 49. Mercurio S, Latinkic B, Itasaki N, et al. Connective-tissue growth factor modulates WNT signalling and interacts with the WNT receptor complex. Development. 2004;131:2137-2147. [DOI] [PubMed] [Google Scholar]
  • 50. Ohnishi H, Oka T, Kusachi S, et al. Increased expression of connective tissue growth factor in the infarct zone of experimentally induced myocardial infarction in rats. J Mol Cell Cardiol. 1998;30:2411-2422. [DOI] [PubMed] [Google Scholar]
  • 51. Chen MM, Lam A, Abraham JA, et al. CTGF expression is induced by TGF-β in cardiac fibroblasts and cardiac myocytes: a potential role in heart fibrosis. J Mol Cell Cardiol. 2000;32:1805-1819. [DOI] [PubMed] [Google Scholar]
  • 52. Dean RG, Balding LC, Candido R, et al. Connective tissue growth factor and cardiac fibrosis after myocardial infarction. J Histochem Cytochem. 2005;53:1245-1256. [DOI] [PubMed] [Google Scholar]
  • 53. Rooney B, O’Donovan H, Gaffney A, et al. CTGF/CCN2 activates canonical Wnt signalling in mesangial cells through LRP6: implications for the pathogenesis of diabetic nephropathy. FEBS Lett. 2011;585:531-538. [DOI] [PubMed] [Google Scholar]
  • 54. Johnson BG, Ren S, Karaca G, et al. Connective tissue growth factor domain 4 amplifies fibrotic kidney disease through activation of LDL receptor-related protein 6. J Am Soc Nephrol. 2017;28:1769-1782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Pi L, Chung PY, Sriram S, et al. Connective tissue growth factor differentially binds to members of the cystine knot superfamily and potentiates platelet-derived growth factor-B signaling in rabbit corneal fibroblast cells. World J Biol Chem. 2015;6:379-388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Abreu JG, Ketpura NI, Reversade B, De Robertis EM.. Connective-tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-β. Nat Cell Biol. 2002;4:599-604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Moe IT, Pham TA, Hagelin EM, Ahmed MS, Attramadal H.. CCN2 exerts direct cytoprotective actions in adult cardiac myocytes by activation of the PI3-kinase/Akt/GSK-3β signaling pathway. J Cell Commun Signal. 2013;7:31-47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Desbois-Mouthon C, Cadoret A, Blivet-Van Eggelpoël MJ, et al. Insulin and IGF-1 stimulate the β-catenin pathway through two signalling cascades involving GSK-3β inhibition and Ras activation. Oncogene. 2001;20:252-259. [DOI] [PubMed] [Google Scholar]
  • 59. Rota LM, Wood TL.. Crosstalk of the insulin-like growth factor receptor with the Wnt signaling pathway in breast cancer. Front Endocrinol. 2015;6:92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Mani A, Radhakrishnan J, Wang H, et al. LRP6 mutation in a family with early coronary disease and metabolic risk factors. Science. 2007;315:1278-1282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Singh R, De Aguiar RB, Naik S, et al. LRP6 enhances glucose metabolism by promoting TCF7L2-dependent insulin receptor expression and IGF receptor stabilization in humans. Cell Metab. 2013;17:197-209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Fan R, Kim NG, Gumbiner BM.. Regulation of Hippo pathway by mitogenic growth factors via phosphoinositide 3-kinase and phosphoinositide-dependent kinase-1. Proc Natl Acad Sci USA. 2013;110:2569-2574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Xin M, Kim Y, Sutherland LB, et al. Regulation of insulin-like growth factor signaling by Yap governs cardiomyocyte proliferation and embryonic heart size. Sci Signal. 2011;4:ra70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Hwang JH, Kim AR, Kim KM, et al. TAZ couples Hippo/Wnt signaling and insulin sensitivity through Irs1 expression. Nat Commun. 2019;10:421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Spees JL, Pociask DA, Sullivan DE, et al. Engraftment of bone marrow progenitor cells in a rat model of asbestos-induced pulmonary fibrosis. Am J Res Cri Car Med. 2007;176:385-394. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

sxab016_suppl_Supplementary_Material

Data Availability Statement

The data underlying this article will be shared on reasonable request to the corresponding author.


Articles from Stem Cells are provided here courtesy of Oxford University Press

RESOURCES