Abstract
16p11.2 copy number variations have been associated with neurodevelopmental disorders. Human induced pluripotent stem cells were generated from fibroblasts obtained from a patient diagnosed with schizophrenia with a 16p11.2 deletion. The generated cell line was further validated for its pluripotency and potential to differentiate into the three germ layers.
1. Resource table
| Unique stem cell line identifier | UIi001-A https://hpscreg.eu/cell-line/UIi001-A |
|---|---|
| Alternative name(s) of stem cell line | SCZ019 |
| Institution | University of Iowa Carver College of Medicine, Iowa Neuroscience Institute |
| Contact information of distributor | Aislinn Williams, aislinn-williams@uiowa.edu |
| Type of cell line | iPSC |
| Origin | Human |
| Additional origin info required for human ESC or iPSC | Age: 33 |
| Sex: M | |
| Ethnicity if known: White, not Hispanic | |
| Cell Source | Fibroblasts |
| Clonality | Clonal |
| Associated disease | Schizophrenia |
| Gene/locus | 16p11.2 deletion (548 kb, Chr16: 29558172–30106541) |
| Date archived/stock date | March 2019 |
| Cell line repository/bank | N/A |
| Ethical approval | University of Iowa Institutional Review Board approval number 201805995 University of Iowa Human Pluripotent Stem Cell Committee approval number 2017–02 |
2. Resource utility
Copy number variations (CNV) of 16p11.2 are implicated in neuro-developmental disorders such as autism spectrum disorders (ASD) and schizophrenia. This iPSC line was generated from a patient diagnosed with schizophrenia with a 16p11.2 deletion and can be used for in vitro studies investigating the developmental aspects of neuropsychiatric disorders.
3. Resource details
Copy number variation in the 16p11.2 locus, both duplications and deletions, are associated with neurodevelopmental disorders. This region contains approximately 29 genes, including BCKDK, CORO1A, KCTD13, MAPK3, SETD1A, SEZ6L2, SRCAP, and TAOK2. Deletions in the 16p11.2 locus are most commonly associated with autism spectrum disorders, intellectual disability, and developmental delay. 16p11.2 deletion syndrome is associated with multiple variably penetrant phenotypes, including speech articulation abnormalities, limb and trunk hypotonia, hyporeflexia, seizures, macrocephaly, and Chiari I malformation (Steinman et al., 2016). Although 16p11.2 duplication has most frequently been associated with psychotic symptoms whereas the deletion is most commonly associated with ASD, studies have also shown 16p11.2 deletion carriers can present with psychotic symptoms and have been diagnosed with schizophrenia (Jutla et al., 2020; Niarchou et al., 2019). Thus, the iPSC line generated from a patient diagnosed with schizophrenia carrying the 16p11.2 deletion is a unique resource for investigating the cellular mechanisms of the overlapping phenotypes observed in patients with autism and psychosis in 16p11.2 deletion syndromes (Table 1).
Table 1.
Characterization and validation.
| Classification | Test | Result | Data |
|---|---|---|---|
| Morphology | Photography Bright field | Normal | Fig. 1 panel A |
| Phenotype | Qualitative analysis Immunohistochemistry and RT-PCR | Positive staining for Nanog, Oct3/4, Sox-2, and Tra-1–60 and positive for pluripotency gene expression; NANOG, OCT3/4, SOX-2 | Fig. 1 panel D and E |
| Quantitative analysis | OCT3/4: 99% NANOG: 93% |
Fig. 1 panel D, Supplementary figure panel A | |
| Genotype | Karyotype (G-banding) and resolution | 46XY, Resolution 400–475 | Fig. 1 panel B |
| Identity | Microsatellite PCR (mPCR) OR | not performed | N/A |
| STR analysis | 16 sites tested are tested, 100% match | Submitted in archive with journal | |
| Mutation analysis (IF APPLICABLE) | Sequencing | N/A | N/A |
| Southern Blot OR WGS | N/A | N/A | |
| Microbiology and virology | Mycoplasma | Mycoplasma testing by PCR. Negative | Supplementary figure panel B |
| Differentiation potential | Embryoid body formation | Positive for the three germ layers. mesoderm: Brachyury, VE-Cadherin; ectoderm: Tuj1, Krt-18; endoderm AFP, GATA-4 | Fig. 1 panel F and G |
| List of recommended germ layer markers | Expression of these markers has to be demonstrated at mRNA (RT PCR) or protein (IF) levels, at least 2 markers need to be shown per germ layer | Ectoderm: PAX6, SOX1, OTX1/2, TUBB3/TUJ1, MAP2, NeuN (at least 1 marker from the set above, also acceptable 1 sub-lineage specific cell type marker, e.g. DCX, SYN1, TBR2); Endoderm: SOX17, FOXA2, LEFTY1 (at least 1 marker from the set above, also acceptable 1 sub-lineage specific cell type marker, e.g., AFP, PDX1) Mesoderm: BRACHYURY/TBXT, TBX6, HAND1 (at least 1 marker from the set above, also acceptable 1 sub-lineage specific cell type marker, e.g. A-SMA, PAX3/7, NKX2.5) | RT-PCR with reference genes: mesoderm: Brachyury, VE-Cadherin; ectoderm: Tuj1, Krt-18; endoderm AFP, GATA-4 |
| Donor screening (OPTIONAL) | HIV 1 + 2 Hepatitis B, Hepatitis C | N/A | N/A |
| Genotype additional info (OPTIONAL) | Blood group genotyping | N/A | N/A |
| HLA tissue typing | N/A | N/A |
Fibroblasts were obtained from a 33-year old white male diagnosed with schizophrenia (Flaum et al., 1992) with a 16p11.2 deletion (548 kb, Chr16: 29558172–30106541, hg18 assembly) CNV. iPSCs were generated from these fibroblasts using an episomal vector kit. Colonies were selected and expanded (Fig. 1A). Loss of episomal vectors from the iPSCs was validated by PCR from cell DNA (Fig. 1C). iPSCs were tested for Mycoplasma which was not detected (Supplementary figure B). iPSCs were further analyzed for their karyotype using the G-banding method and no abnormality was observed (Fig. 1B). Short tandem repeat (STR) analysis confirmed that the iPSCs and the fibroblasts were from the same donor. The pluripotency of the iPSCs was checked by immunolabeling against Nanog, Oct3/4, Sox2, and Tra-1–60 (Fig. 1D, Supplementary Figure A, Table 2) and RT-PCR to verify mRNA expression of Nanog, Oct3/4, and Sox2 (Fig. 1E). Both on protein and mRNA levels, cells were positive for pluripotency markers. Moreover, differentiation potential into the three germ layers in vitro was tested by spontaneous embryoid body (EB) formation followed by RT-PCR. iPSC colonies formed healthy EBs (Fig. 1F) which expressed mesoderm (Brachyury, VE-Cadherin), ectoderm (Tuj1, Krt-18), and endoderm (AFP, GATA-4) layer cell markers (Fig. 1G).
Fig. 1.

Characterization and quality control data for iPSC line Uii001-A.
Table 2.
Reagents details.
| Antibodies used for immunocytochemistry/flow-cytometry | ||||
|---|---|---|---|---|
| Antibody | Dilution | Company Cat # | RRID | |
| Pluripotency markers | Rabbit anti Nanog | 1:200 | Abcam Cat# ab21624 | RRID: AB_446437 |
| Mouse anti Oct3/4 | 1:200 | Santa Cruz Biotechnology Cat# sc-5279 | RRID: AB_628051 | |
| Rabbit anti Sox-2 | 1:800 | Millipore Cat# AB5603 | RRID: AB_2286686 | |
| Mouse anti Tra-1–60 | 1:200 | Millipore Cat# MAB4360 | RRID: AB_2119183 | |
| Secondary antibodies | Donkey anti-rabbit IgG (H + L) Alexa Fluor 488 | 1:200 | Jackson ImmunoResearch Labs Cat# 711–545-152 | RRID:AB_2313584 |
| Donkey anti-mouse IgG (H + L) Alexa Fluor 594 | 1:200 | Jackson ImmunoResearch Labs Cat# 715–585-151 | RRID:AB_2310855 | |
| Donkey anti-rabbit IgG (H + L) Alexa Fluor 594 | 1:800 | Jackson ImmunoResearch Labs Cat# 711–585-152 | RRID: AB_2340621 | |
| Donkey anti-mouse IgG (H + L) Alexa Fluor 488 | 1:200 | Jackson ImmunoResearch Labs Cat# 715–545-151 | RRID:AB_2341099 | |
| Primers | ||||
| Target | Size of band | Forward/Reverse primer (5′−3′) | ||
| Episomal vectors | OriP | 544 bp | Forward: TTCCACGAGGGTAGTGAACC | |
| Reverse: TCGGGGGTGTTAGAGACAAC | ||||
| EBNA1 | 666 bp | Forward: ATCGTCAAAGCTGCACACAG | ||
| Reverse: CCCAGGAGTCCCAGTAGTCA | ||||
| Pluripotency Markers (qPCR) | NANOG | 112 bp | Forward: TCCTCCTCTTCCTCTATACTAAC | |
| Reverse: CCCACAAATCACAGGCATAG | ||||
| OCT3/4 | 131 bp | Forward: AGTCAGTGAACAGGGAATGG | ||
| Reverse: TCGGGATTCAAGAACCTACG | ||||
| SOX-2 | 140 bp | Forward: GAGAGAAAGAAAGGGAGAGAAG | ||
| Reverse: GAGAGAGGCAAACTGGAATC | ||||
| Differentiation markers | Brachyury | 165 bp | Forward: ACCCAGTTCATAGCGGTGAC | |
| Reverse: GGATTGGGAGTACCCAGGTT | ||||
| VE-Cadherin | 229 bp | Forward: CCTACCAGCCCAAAGTGTGT | ||
| Reverse: GAGATGACCACGGGTAGGAA | ||||
| TUJ1 | 237 bp | Forward: ATGCGGGAGATCGTGCACAT | ||
| Reverse: CCCTGAGCGGACACTGT | ||||
| Krt-18 | 164 bp | Forward: CACAGTCTGCTGAGGTTGGA | ||
| Reverse: GAGCTGCTCCATCTGTAGGG | ||||
| AFP | 94 bp | Forward: AAACTATTGGCCTGTGGCGA | ||
| Reverse: GGCCAACACCAGGGTTTACT | ||||
| GATA-4 | 184 bp | Forward: CAGATGCCTTTACACGCTGA | ||
| Reverse: TCCGCTTGTTCTCAGATCCT | ||||
| House-Keeping Genes (qPCR) | Beta-ACTIN | 143 bp | Forward: GCCGAGGACTTTGATTGC | |
| Reverse: GTGTGGACTTGGGAGAGG | ||||
| Mycoplasma | 5′ Myc#1 | ~500 bp | CGC CTG AGT AGT ACG TTC GC | |
| 5′ Myc#2 | CGC CTG AGT AGT ACG TAC GC | |||
| 5′ Myc#3 | TGC CTG AGT AGT ACA TTC GC | |||
| 5′ Myc#4 | CGC CTG GGT AGT ACA TTC GC | |||
| 5′ Myc#5 | CGC CTG AGT AGT ATG CTC GC | |||
| 5′ Myc#6 | TGC CTG GGT AGT ACA TTC GC | |||
| 3′ Myc#1 | GCG GTG TGT ACA AGA CCC GA | |||
| 3′ Myc#2 | GCG GTG TGT ACA AAA CCC GA | |||
| 3′ Myc#3 | GCG GTG TGT ACA AAC CCC GA | |||
4. Materials and methods
4.1. Fibroblast collection and reprogramming
Skin biopsy was obtained from the patient after obtaining informed consent. Fibroblasts were cultured in DMEM (Gibco) with 15% FBS (Atlanta Biologicals) and 1% MEM-NEAA (Gibco) at 37 °C and 5% CO2. Fibroblasts were reprogrammed using the Epi5 Episomal iPSC reprogramming kit (LifeTechnologies) following the manufacturer’s protocol using the 4D Nucleofector core unit (Lonza) for electroporation.
4.2. Cell culture
iPSCs were maintained in TeSR-E8 (Stemcell Technologies) on Matrigel (0.08 mg/ml) coated tissue culture plates at 37 °C and 5% CO2. Cells were passaged 1:2–1:3 using 1 mM sodium citrate passaging solution every 3–4 days.
4.3. Loss of episomal vector
To confirm the loss of episomal vectors in the iPSCs, DNA was isolated from reprogrammed cells at p22 with the NucleoSpin Tissue kit (Macherey-Nagel) following the manufacturer’s protocol. DNA was tested for episomal vector sequences by PCR using GoTaq Green Master Mix (Promega), including fibroblast DNA as a negative control and the vector mix as a positive control. The PCR cycle was: 2 min 94 °C, 35 × (30 s 94 °C, 30 s 65 °C, 1 min 72 °C), 7 min 72 °C, ∞ 4 °C.
4.4. Pluripotency
iPSCs at p6 were fixed with 4% PFA for 10 min and washed with DPBS. Fixed cells were incubated in primary antibodies overnight at 4 °C and in secondary antibodies for 30 min at room temperature. Nuclear staining was done with DAPI. Images were acquired using an Olympus IX83 epifluorescence microscope. Random areas on the DAPI images were selected for cell counting. Cells positive for pluripotency markers (Nanog or Oct3/4) were manually counted using ImageJ Software and reported as the percentage of total cells (DAPI).
RNA was isolated from cells at p10 using TRIzol (Invitrogen) following the manufacturer’s protocol. RT-PCR for pluripotency markers was performed by generating cDNA according to the manufacturer’s protocol (High-Capacity cDNA Reverse Transcription Kit, Applied Biosystems). PCR was performed using GoTaq Green Master Mix (Promega) and samples were run on 1% agarose gel. The PCR cycle was: 5 min 95 °C, 38 × (15 s 95 °C, 30 s 55 °C, 45 s 72 °C), 5 min 72 °C, ∞ 4 °C.
4.5. Embryoid body formation
Embryoid bodies (EB) were generated by treating iPSC colonies with 1 mM sodium citrate passaging solution, then manually lifting colonies in hPSC culture medium (DMEM/F12, 10% KOSR, 0.5% GlutaMax/B-mercaptoethanol, 1% NEAA). EBs were collected on day 10 and lysed in TRIzol reagent. RT-PCR for the three germ layers was done with the generated cDNA. The PCR cycle was: 5 min 95 °C, 38 × (15 s 95 °C, 30 s 55 °C, 45 s 72 °C), 5 min 72 °C, ∞ 4 °C.
4.6. CNV identification
The CNV was detected by array comparative genomic hybridization (aCGH) following the manufacturer’s protocol (Roche NimbleGen cgh_cnv_userguide_v7p0). Briefly, case and control DNA (from an unaffected Filipino male) were labeled with Cy3- and Cy5-coupled non-amers respectively. Each labeled DNA was cohybridized to a Roche NimbleGen human whole-genome tiling microarray (Human CGH 2.1 M Whole-Genome Tiling v2.0D Array). The array was washed, scanned, and analyzed.
4.7. Karyotyping and STR
Cells were grown in vitro and arrested at metaphase with colcemid at p14. Chromosomes were stained by the G-banding method. The chromosome number was determined by microscopic analysis and cells were examined for the presence or absence of detectable structural rearrangements. Karyotypes were prepared from computer assisted digital images of these metaphases.
To confirm the donor identity of iPSCs, we isolated DNA from iPSCs and the parent fibroblasts using the NucleoSpin Tissue kit (Macherey-Nagel) following the manufacturer’s protocol and submitted the samples to University of Arizona Genetics Core for short tandem repeat (STR) analysis.
4.8. Mycoplasma test
The presence of mycoplasma was tested using a PCR assay (Uphoff and Drexler, 2002). Spent medium was collected at p11 and centrifuged. Supernatant was discarded and pellet was resuspended in buffer containing 50 mM Tris-HCl, 100 mM EDTA, 100 mM NaCl, 1% SDS, pH 8.0, and incubated at 95 °C for 15 min. Protein was pelleted using 7.5 M ammonium acetate on ice for 5 min, followed by centrifugation at 16,000 × g for 10 min. DNA was precipitated from the supernatant using isopropanol, dried, and then rehydrated in water for PCR testing. An internal control DNA was added to each sample (except for the negative control where only water was included as a template) as a control for PCR integrity. For the positive control, we used mycoplasma DNA as a template. The mycoplasma DNA positive control template and the internal control template were both obtained from DSMZ (German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany). GoTaq Green Master Mix (Promega) was used for the PCR and the cycle was: 2 min 94 °C, 39 × (30 s 94 °C, 30 s 65 °C, 30 s 72 °C), 2 min 72 °C, ∞ 12 °C.
Supplementary Material
Acknowledgements
We thank the Patil Cytogenetics core, including Dr. Ben Darbro and Richard Van Rheeden for technical assistance with karyotyping. This project was funded by the Nellie Ball Trust (AW, TW), The Carver Charitable Trust (AW), The University of Iowa Institute for Clinical and Translational Science KL2 (NIH TR002536) (AW), The Iowa Neuroscience Institute Fellowship (DM), and The Iowa Neuroscience Specialty Program in Research Education Fellowship (NIH T32MH019113) (KK).
Footnotes
Declaration of Competing Interest
The authors declare that they have no competing financial interests or personal relationships that influenced the work reported in this paper.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2021.102636.
References
- Flaum MA, Andreasen NC, Arndt S, 1992. The Iowa prospective longitudinal study of recent-onset psychoses. Schizophr. Bull 18 (3), 481–490. [DOI] [PubMed] [Google Scholar]
- Jutla A, Turner JB, Green Snyder LeeAnne, Chung WK, Veenstra-VanderWeele J, 2020. Psychotic symptoms in 16p11.2 copy-number variant carriers. Autism Res 13 (2), 187–198. [DOI] [PubMed] [Google Scholar]
- Niarchou M, Chawner S, Doherty JL, Maillard AM, Jacquemont S, Chung WK, Green-Snyder L, Bernier RA, Goin-Kochel RP, Hanson E, et al. , 2019. Psychiatric disorders in children with 16p11.2 deletion and duplication. Transl. Psychiatry 9, 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Steinman KJ, Spence SJ, Ramocki MB, Proud MB, Kessler SK, Marco EJ, Green Snyder LeeAnne, D’Angelo D, Chen Q, Chung WK, Sherr EH, 2016. 16p11.2 deletion and duplication: Characterizing neurologic phenotypes in a large clinically ascertained cohort. Am. J. Med. Genet. A 170 (11), 2943–2955. [DOI] [PubMed] [Google Scholar]
- Uphoff Cord C., Drexler Hans G., 2002. Comparative PCR analysis for detection of mycoplasma infections in continuous cell lines. In Vitro Cell. Dev. Biol. Anim 38 (2), 79. 10.1290/1071-2690(2002)038<0079:CPAFDO>2.0.CO;2. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
